Difference between revisions of "Team:SPSingapore/home"

For description

For experiment and protocol

For result

For design

For Team part

For basic part

For composite part

For part collection

Yi Han

Received 2 bacterial stab cultures, EsaR/I plasmid from addgene (CHL) and BBa_K299812 from iGEM HQ.

Streaked out on plates with amp.

Adrian

Transformed:

+Kit plate 1 9N Ba_K763002 chl

+Kit plate 4 13L BBa_E0040 amp

DNa was received in powder form in plates, and resuspended in 10ul ultrapure H2O respectively. Plates were stored in -20/

Yi Han

Plates cracked in incubator as they dried from lack of humidity.

Transfer to small incubator with beaker of water for humidity no single colonies for inv plasmid -> streak again.

Wrong antibiotic for EsaR/I plasmid-> streak out again

Yi Han

Inoculate single colony of invasin plasmid carrying bacteria in 3mL LB+amp

Transformation of 13L repeated with 1ul of DNA.

No colonies grew for 13L on all plates ->adjust incubator, make new media

Miniprep of inoculated bacteria for invasin plasmid, incubate sample in 37degC for 1h 20min

Xin Yi and Yi Han

Miniprep of EsaR/I plasmid for 4 colonies

Restriction digest for EsaR with XbaI/BamHI

Xin Yi

Sent EsaR clone 4 and INv-4 for sequencing.

YFP and GFP transformation results - no colonies for YFP

The GFP transformation repeated with 100ng of plasmid was sucessful.

4 colonies of gfp plasmid were inoculated in 3mL LB+amp and grown overnight.

Miniprep of gfp plasmids

RE digest with EcoRI and RsaI

Yanting

Inoculated 3mLS of Inv-4 and EsaR-4 plasmid carrying bacteria into 100mL LB+ appropriate Antibiotic

Cell culture-> HEK293 cells revived from freezing down appeared detached.

Yi Han + Yanting

Storage of bacterial glycerol stocks for Inv-4, EsaR4 in 25% glycerol

Yanting: grew HEK293T cells in T25 glask

Gel extract to clean up gfp plasmids which loading dye had accidentally been added to.

Yi Han

Miniprep of gfp plasmids, preparation of samples for sequencing

Yi Han

All gfp plasmids had a correct sequence

Yunting kept glycerol stocok for all, and inoculation of 3mL of gfp3 into 100mL LB+amp for midiprep

Yi Han + Yunting

Midiprep of gfp plasmid PCR of gfp with KpnI-gfp and XhoI-gfp primers

Yunting + Duy

Nanodrop of gfp product-> 595.5ng/ul

RE digest of EsaR vector with KpnI/XHoI

Gel electrophoreseis at 1000V for 30min

Gel extraction: 3.9ng/ul and 6.9ng/ul for Esa fragment and GFP --> low yield

Yunting

Gel extraction using Promega binding solution to melt gel, followed by thermo scientific kit

Adrian

Gel extraction optimisation

Hypothesised that the Binding buffer has a problem/DNA does not bind to column

1: 2X promega binding buffer volume

2: Increase incubation time for binding to 5min

Switch binding buffer to that of thermo scientific PCR purification kit

Use sodium acetate if available? TO facilitate stronger binding to column

Results

1: ~10ng/ul

2: ~9ng/ul

not succesful

further optimisation-> warm buffer, incubate for 5min

elute in 30/20ul smaller volumes

Yihan

1: Thermoscientific miniprep columns with 2XThermoscientific binding buffer

2: Thermoscientific PCR purification kit 2X buffer

3: Promega kit 2X buffer

Yihan

PCR (mastermix: 8)

Reagent	Amount
PCR buffer	10 ul * 8 = 8-ul
primers	0.8ul, 0.8ul
DNA polymerase	4ul
dH2O	61.75 * 8 = 494ul
Templates	5.55*7 = 38.75ul

Digest more plasmid (Esa plasmid)

4 rxns ( KpnI/XhoI digest) 50ul each

Reagent	Amount
Buffer
KpnI	2ul
XhoI	2ul
DNA	34.8ul
H2O	141.2ul

Yihan

PCR

RP_XhoI_GFP and FP_KpnI_GFP with GFP midiprep

For 15 reactions with control .: Mastermix * 17

PCR protocol “GFP 1” (32 cycles)

GFP PCR product -> 448ng/ul

Gel extraction

Qiagen gel extraction kit at MBI

Esa gel band from 14/6

Nanodrop: 16.4 ng/ul, 260/280 = 2.60

• RE digest (KpnI, XhoI)

• 3 Replicates of the following

Ligation (2x reaction) 40ul

Note: ALL digested DNA in tube labeled lacGFP.ligation was used

Nanodrop of ligation: 1114.0ng/ul. 260/280 = 3.7

Transformation

Transformation of ligated esa-GFP plasmid into DH5\alpha cells

DH5\alpha ,<- unlabelled brown vial inside DH5\alpha box at -80

Plates spread at 11:40h

LB + chloroamphenicol

+4x (100ul)

+10x (40ul)

+20x (20ul)

+LB - 20x (20ul)

remaining transformed cells (~220ul) are kept at 4C

--> labeled as placGFP in brown tube

Oservation: only 4x placGFP plate has colonies (7)

spread one new LB + chlor plate with 200ul of transformed bacteria

picked 6 colonies to grow for miniprep in LB + chl liq media

Conclusion:

+protocol works

+optimization for increase vol needed

cloning of synparts in amp vector

+comes as 4mg dry DNA

+40ul of DI/RNAse free H20

+for transformation, 150ml on wed

Unknown

Miniprep of placGFP followed by RE digest (Kpn, XhoI): 50 ul total

Colony PCR for synparts

+ Failed

+ Might need optimization

Yihan

RE digest (XhoI, KpnI) of esa and GFP

Yunting

Gel electrophoresis (100V, 40min)

+ Lane 2: gpf: no bands

+ Lane 3: 100bp ladder

+ Lane 4: blank

+ Lane 5: esa: 2 bands

+ Lane 6: 1kb ladder

+ Lane 7:blank

<Picture of gel>

Optimizing gel extract protocol

+ RE GFP from PCR (directly RE)

+ promega agarose 1% gel

+ add NaAC in binding buffer

Result:

+ yield for cut plasmid was 12.8ng/ul

+ GFP was 8.6ng/ul

Ligation reaction 6 reactions

+ 6x ligation result transformed into competent DH5\alpha 20 ul, 50ul, 100ul plated on LB + chl

Yunting

Ligation of GFP tester plasmid.

Performed 4x ligation using RE- digested esa and GFP (CY, 22/6). Ligation rxn at room temperature for 30min instead of 10min.

Included vector-only and insert-only controls.

Stored in -20deg.

Will run gel tmr. Insert only control should be same size as gfp product. Same for the other control. Can try to plate vector only to see re-ligation??

Nanodrop:

PlacGFP - 642.8ng/ul. 260/280=3.89

Vector ctrl - 756.6ng/ul. 260/280=4.11

Insert ctrl - 557 ng/ul. 260/280=3.86

Yanting

Ran 0.8% pre-cast gel at 100V for 45min.

10ul of each sample to 2ul of loading dye.

Gel lanes:

100bp; uncut esa (used esa4 from -20);

pLacGFP; vector ctrl; insert ctrl; 1kb.

[YH] Re-run gel. 35ul of each sample. No bands.

<insert gel picture>

RE of esa and Gfp pcr product.

Gel electrophoresis.

Cast a thick 1% gel (60ml) with combined wells. [Don't need to cast thick gel next time, takes too long to melt]

Gel run at 100V,  45min. Lanes: 100bp, esa, gfp 1&2, 1kb

Gel extraction of RE esa & gfp.

Nanodrop:

Esa- 37.7ng/ul. 260/280= 1.83

Gfp - 25.1ng/ul. 260/280= 1.84

6x ligation:

[Chi Yan + Yunting] Midiprep of EsaR plasmid

[Yihan Yunting] Gel electrophoresis of inv colony PCR

insert picture gel

[Xinyi] Colony pcr for placgfp for >18 colonies

insert gel picture

Yanting

Subculture of HEK 293

P4 -> p5

Grow/split into 150mm dish for freezing on sat(20/6)

-->30ml DMEM + 1ml cells

90mm dish for maintenance (buffer)

-->10ml DMEM + 30ul cells

Cells combined from 3 90mm dishes

Yanting

Freezing of HEK293

P6

Cells from a 150 mm dish and 90mm dish

Adrian

Prepared restreak of inv/hly plasmid from original stab culture

Yanting and Yunting

Colony PCR of invasin

Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7).

Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.

Also constituted dNTP w 2.5mM of each atcg triphosphate.

Yanting

100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”.

When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.

Yunting

Placed BBa_K299812 plate in incubator for overnight growth.

Yanting and Yunting

Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.

Primer conc=0.5 uM, template DNA dissolved in 10ul h20.

Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.

100V for 34min.

Tubes 1-2: FP-prefix, RP-suffix.

3-4: FP-VF2, RP-VR.

5-6: FP-prefix, RP_Inv_M2.

7-8: RP-suffix, FP_Inv_M1.

No template control with FP-prefix, RP-suffix.

[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].

Results: Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.

Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time).

Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.

Yihan

Inoculation of positive colonies in liquid culture. 3mL and shaking incubation.

Yunting

Miniprep of positive colonies from 30h liquid culture.

Eluted in 50ul elution buffer and stored at -20.

C= 225.9ng/ul. 260/280=1.86

D= 297.7ng/ul. 1.87

Yunting

Colony PCR with thermogradient: 14rxn

C/D-1,2: Col3.

C/D-3,4: Col12.

D-5,6: Col 9.

D-7,8: Col 10.

Negative control (no template): Col 8.

Gel ran for 80V, 1h.

D-1,2: VF2, VR.

D-3,4: FP-prefix, RP-suffix.

D-5,6: FP-prefix, FP_M2.

D-7,8: FP-prefix, FP_invF.

C-1,2: VF2, VR.

C-3,4: FP-prefix, RP-suffix.

Results Notes:

Too much template DNA (~250ng). Separate the universal primers (to avoid differing extension time).

Yanting

RE digest of inv/hyl plasmid with EcoRI and PstI for 2 hours at 37oC.

Lane 1-4: 1kb ladder, 100bp ladder, RE of colony C, RE of colony D.

Size is correct: 4kb main band (inv+hly part) and 2kb (plasmid backbone). These plasmid DNA should have the part.

Yanting and Yunting

Colony PCR, used with temperature gradient to vary annealing temperature. 10rxn

100V for 45min (can run for longer).

Result:

Lane 1: 1kb ladder; lane 2: 100bp ladder;

lane 3-7: FP prefix + RP suffix (5 repeats with increasing annealing temperatures) has 2 bands ~800 bp & 100-200bp (probably non specific bands, will lower # of cycles in future, use higher annealing temp, lower annealing time).

Expected size of inv+hly part is 4.1kb.

lane 8-9: VF + M2 has a thick band 800-900bp.

Expected size is 600+130bp (VF adds ~130bp compared to FP_prefix) .: doesn’t seem to be correct….

lane 10-11: VF + inv F has no bands. Expected is at least 200bp (bcos universal primers).

lane 12: VR + inv F seems to have a small band <100bp. Non specific amplification?

Expected is 1.5+0.1 kb (from VR).

Yanting

RE with XbaI and PstI

Incubate at 37degC for 2.5h (1130-1400)

Results: Gel loaded 1kb ladder, uncut, RE digested. 100V for 1h.

Plasmid doesn't have XbaI site - RE digested DNA is a linear 6kb band.

Yunting

Cast a big gel. Stored in 4 deg. [Used up 26/6]

Pre-cast two 0. 8% gels. Stored in 4deg. [Used up on 24 & 25/6]

Chi Yan and Yunting

Midiprep of esaR plasmid.

Airdry ON.

Transformation of ligated FNRgfp plasmid into dH5alpha

Cleaned waterbath, de-iced the fridge.

Today, we also did a spring cleaning for the lab

Adrian

BBPrefix_esaRBS PCR

success-> PCR purification

esaRBS_GFP_BBsuffix

failed -> troubleshooting-> new OFP_esaRBBS_GFP

Redid 30/6 with new primers

success with new primers-> fusion pcr

Clarice

Fusion PCR with esaRBS, GFP

annealing temp 50degC

Gel electrophoresis: looks correct-> PCR Purification

RE digest of esaRBS+GFP

Clarice

COlny PCR with different colonies (15 colonies)

FP_BB_Prefix and RP_BB_Suffix

Success

Clarice

Colony PCR successful - inouclated colony 2,3,4,12 in 3mL LB

PCR-FNRsynpart BBP

Clarice

Verify minipreppped esaGFP plasmid

Clarice

Transformatin of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)

Yihan

Ran gel of gfp plasmid EcoRI/PstI, took out gel slice for vector - 4kb

Gel extraction:

+gfpvector->38.7ng/ul fragment-> direction purification 226.4ng/ul

+LIgation reaction (5:1) 6X

ligate for 2 hours at 16 hours transform, plate, grow ON

Yihan

No colonies-> ligation did not work

Recalcualte ligation reaction (3:1),7x

350ng vector->9ul vector

446.3ng insert-> 2ul 7ul

ligase 110

H2O

12ul buffer

Yihan and Clarice

colonies for EsaGFP

grew Colony PCR for 14 colonies

Unsuccessful-> no bands observed

Yihan

Trying out an idea for workshop

Trial for blue/white screen

Streak out pGFPuv and pGEMT on plate with amp added spread 40ul of 0.1M IPTG and 30ul of 5%xgal, dried and on plate without amp

Yihan

Ran gel with FNR Pcr and gfp pcr

size of pcr product was correct but gel picture was not saved

FNR Product was pcr purified

Plasmid extraction for colony 2,3,4 of esaGFP - > 2,3 were sent for sequencing and primers did not bind, chromatogram was messed up.

Fusion PCR for FNRGFP:

Chi yan

Gel was run for fusion pcr size was correct

Clarice RE digest:

Chi yan

Ran gel for gfpp plasmid

gel purificaiton and extraction of 4kb fragment

Yihan

no colonies for FNRgfp plasmid

Inv plasmid verification

Gel extraction RE digest of EsaR-GFP plasmid

Transformation of FNRgfp anaerobe jar

E. coli grew in both conditions p putida-> some growth in anaerobe chamber proper streak plate in aerobic conditions

packet runs out after 16hours

Yihan and Yunting

LIgation for FNRgfp (4X)

Trial run of anaerobe chamber:

+ open sachet to decrease O2 at 3.30pm

+ takes 2.5h to activate

place streak plate of p putida a strict aerobe and e coli, facultative aerobe in chamber at 30deg C to grow O/N

P. putida is an abligate aerobe and if chmaber works ,it will not grow

E. coli should grow in both conditions

controls grown outside chamber

Yihan

FNRgfp-> no colonies after transformation

religation (4X reaction)

transformation of FNR gfp into 20ul of BL21

Yihan

No colonies grew

Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder

Chi Yan

RE digest of FNR-GFP fusion PCR with EcoRI and PstI

Direct purification using Promega kit

Overnight ligation (4X reaction)

200ng of gfp plasmid (4.4ul)

400ng of insert (5:1) (?ul)

4ul T4 ligase

8ul T4 ligase buffer

? H2O

Yihan

Ncbi search in BL21 genome revealed that it does have FNR transcriptional regulator

http://www.ncbi.nlm.nih.gov/nuccore/CP010816.1

In dH5alpha as well

http://www.ncbi.nlm.nih.gov/gene/945908

However no direct data on our specific strains of dH5alpha and BL21

One of the participants taking a closer look at GFP-tagged E. coli under our very own SPS microscope.

The SPS iGEM Team of 2015 hosted a genetic engineering workshop for students from the Faculty of Science on 5th August 2015, in the Active Learning Room and the SPS Wet Lab. The workshop aimed to equip science students with an understanding of both the techniques of synthetic biology, and its risks and rewards. Participants were given the opportunity to be immersed in both the theoretical and wet lab components of synthetic biology.

Students were first guided through the concepts of genetic engineering, and the available wet lab tools and techniques used. After some light refreshments, they then got a chance to try their hands at designing their very own gene vectors with a fun set of theoretical puzzles.

One of the workshop facilitators explaining the process of constructing a genetic vector.

Participants and facilitators hard at work figuring out genetic puzzles

After lunch, the participants performed Fusion PCR (Polymerase Chain Reaction) and performed bacterial transformation in the SPS Wet Lab. They also had a look at green fluorescent protein (GFP) expressed in E. coli, as an example of one of the methods that are commonly used to quantify protein expression.

Participants beginning PCR in the SPS Wet Lab!

Loading a gel is hard work – participants ran a DNA gel to confirm if their PCR reaction was successful

All in all, both the workshop participants and facilitators spent an enjoyable day both learning and sharing about genetic engineering. The SPS iGEM Team of 2015 would like to thank all participants for spending their day with us! We would also like to thank Science Dean’s Office for their kind sponsorship, as well as the SPS staff and SPS community for their support.

A final group photograph with some of the facilitators and workshop participants

Video