Difference between revisions of "Team:CHINA CD UESTC/Method"
| Line 165: | Line 165: | ||
<p> | <p> | ||
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%"> | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%"> | ||
| − | •pET28a: <br>For consideration of the longest operon size (17kb), we divided mamAB operon into three parts | + | •pET28a: <br>For consideration of the longest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to come true the insertion of mamAB. |
</p> | </p> | ||
</div> | </div> | ||
| Line 172: | Line 172: | ||
<p> | <p> | ||
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%"> | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/3/3c/CHINA_CD_UESTC_METHOD08.png" width="30%" height="30%"> | ||
| − | •pCDFDuet-1: <br>The restriction | + | •pCDFDuet-1: <br>The restriction sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamXY on either side are (XbaⅠ)and (PstⅠ) |
</p></div> | </p></div> | ||
<div class="surround_cont"> | <div class="surround_cont"> | ||
| Line 178: | Line 178: | ||
<p> | <p> | ||
<img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%"> | <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/5/54/CHINA_CD_UESTC_METHOD09.png" width="30%" height="30%"> | ||
| − | •pACYCDuet-1: <br>The restriction | + | •pACYCDuet-1: <br>The restriction sites flanking Laccase + mamW + RFP on either side are (PstⅠ) and (XhoⅠ). |
</p> | </p> | ||
</div> | </div> | ||
Revision as of 09:20, 13 September 2015
<!DOCTYPE html>
METHOD
We present fundamental details on various methods such as vectors design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page, if you are willing to check or follow our work, you can scan the methods here. Any questions or advice to us are acceptable at any time.
If you want to check or follow our project, you can read the METHOD page to get main information concerning our project. In addition, you will get more details about experiment from our protocols.
Q1: How to get target gene?
Four operons related to magnetosome synthesis(mamAB/mamGFDC/mamXY/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify.
Laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (BBa_K863005, BBa_E1010) and amplify them through common PCR.
Q2: Where are the backbone vectors from?
All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aim to carry gene clusters that realize magnetosome generating and the last one is for putting together the genes of mamW + RFP + laccase.
Q3: What kinds of linker we chose for linking between our protein domains?
We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers.
•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: BBa_K416001): between mamW, RFP and Laccase.
•gcaggtagcggcagcggtagcggtagcggcagcgcg
Refer to 6aa [GS]x linker(Name: BBa_J18921): between mamW and RFP.
Q4: What kinds of enzymes we used when we made target gene insert into vectors?
•pET28a:
For consideration of the longest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to come true the insertion of mamAB.
•pCDFDuet-1:
The restriction sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamXY on either side are (XbaⅠ)and (PstⅠ)
•pACYCDuet-1:
The restriction sites flanking Laccase + mamW + RFP on either side are (PstⅠ) and (XhoⅠ).