Difference between revisions of "Team:HSNU-TAIPEI"

Line 2: Line 2:
 
{{HSNU-TAIPEI/labnotes_css}}
 
{{HSNU-TAIPEI/labnotes_css}}
 
<html>
 
<html>
 +
<style>
 +
.home {
 +
    padding: 0;
 +
    margin: 0;
 +
    min-height: 1px;
 +
}
 +
 +
.home-bg {
 +
    width: 100%;
 +
    border: 1px solid #e4f3ff;
 +
}
 +
 +
.home-bg h2 {
 +
    position: absolute;
 +
    top: 10px;
 +
    left: 10px;
 +
    color: #fff;
 +
    text-shadow: 0 1px 2px #000;
 +
}
 +
 +
.home-bg img {
 +
    width: 100%;
 +
}
 +
 +
.three-link {
 +
    display: -webkit-box;
 +
display: -moz-box;
 +
display: -ms-flexbox;
 +
display: -webkit-flex;
 +
display: flex;
 +
                -webkit-box-flex-flow: row wrap;
 +
-moz-box-flex-flow: row wrap;
 +
-webkit-flex-flow: row wrap;
 +
-ms-flex-flow: row wrap;
 +
flex-flow: row wrap;
 +
}
 +
 +
.home-about,
 +
.three-link .home-bg {
 +
    width: 100%;
 +
}
 +
 +
.three-link img {
 +
    width: 100%;
 +
}
 +
 +
.backing-link {
 +
    position: absolute;
 +
    opacity: 0;
 +
    display: block;
 +
    width: 100%;
 +
    height: 100%;
 +
    z-index: 3;
 +
    margin: 0;
 +
    padding: 0;
 +
    top: 0;
 +
    left: 0;
 +
    bottom: auto;
 +
    right: auto;
 +
}
 +
 +
.home-about {
 +
    min-height: 200px;
 +
    background: tomato;
 +
    -webkit-box-order: -1;
 +
    -moz-order: -1;
 +
    -webkit-order: -1;
 +
    -ms-order: -1;
 +
    order: -1;
 +
}
 +
 +
 +
 +
/* SLIDER */
 +
 +
.slider-nav {
 +
    display: none;
 +
}
 +
 +
.slide {
 +
    backgrounod-repeat: no-repeat;
 +
    background-position: center center;
 +
    -webkit-background-size: cover;
 +
    -moz-background-size: cover;
 +
    -o-background-size: cover;
 +
    background-size: cover;
 +
    width: 100%;
 +
    height: 500px;
 +
}
 +
 +
@media screen and (min-width: 1025px) {
 +
 +
.slider {
 +
    height: 600px;
 +
    position: relative;
 +
}
 +
 +
.slide {
 +
    display: none;
 +
    position: absolute;
 +
    top: 0;
 +
    left: 0;
 +
    height: 100%;
 +
}
 +
 +
.active-slide {
 +
    display: block;
 +
}
 +
 +
 +
.slider-nav {
 +
    display: block;
 +
    text-align: center;
 +
    height: 60px;
 +
    position: absolute;
 +
    bottom: 0;
 +
    width: 100%;
 +
    z-index: 4;
 +
}
 +
 +
.arrow-prev {
 +
    display: inline-block;
 +
    margin-right: 5px;
 +
    vertical-align: top;
 +
}
 +
 +
.arrow-next {
 +
    display: inline-block;
 +
    margin-left: 5px;
 +
    vertical-align: top;
 +
}
 +
 +
.slider-dots {
 +
    list-style: none;
 +
    display: inline-block;
 +
    padding: 0;
 +
    margin: 15px 0 0;
 +
}
 +
 +
.slider-dots li {
 +
    color: #e4f3ff;
 +
    display: inline;
 +
    font-size: 30px;
 +
    margin-right: 5px;
 +
    text-shadow: 0 0 1px #000;
 +
}
 +
 +
.slider-dots li.active-dot {
 +
    color: #004175;
 +
}
 +
}
 +
 +
@media screen and (min-width: 1280px) {
 +
 +
.slider {
 +
    height: 720px;
 +
}
 +
 +
}
 +
</style>
 +
 
<div class="wrapper">
 
<div class="wrapper">
  
Line 90: Line 251:
 
</header>
 
</header>
  
−
+
<main>
−
                            <main>
+
<div class="mc-container home">
−
<div class="mc-container">
+
       
−
<h1>Lab Notes</h1>
+
  
 +
<div class="section three-link">
 +
                        <div class="home-bg">
 +
                            <a href="https://2015.igem.org/Team:HSNU-TAIPEI/projectoverview" class="backing-link"></a>
 +
                            <h2>Project</h2>
 +
                            <img src="https://static.igem.org/mediawiki/2015/thumb/8/8e/HSNU-TAIPEI_homeimage_1.jpg/800px-HSNU-TAIPEI_homeimage_1.jpg">
 +
                        </div>
 +
                        <div class="home-about">
 +
                        </div>
 +
                    </div>
  
−
            <div class="section note">
+
        <div class="section three-link">
−
              <h2 class="note-title">Activation of Culture</h2>
+
                        <div class="home-bg">
−
              <ul class="note-info">
+
                            <a href="https://2015.igem.org/Team:HSNU-TAIPEI/hp/overview" class="backing-link"></a>
−
                <li>Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen</li>
+
                            <h2>Human Practice</h2>
−
                <li>Place: Fu Jen University Food Science Department </li>
+
                            <img src="https://static.igem.org/mediawiki/2015/thumb/6/6c/HSNU-TAIPEI_homeimage_3.jpg/800px-HSNU-TAIPEI_homeimage_3.jpg">
−
                <li>Date: September 4th, 2015</li>
+
                         </div>
−
              </ul>
+
                        <div class="home-bg">
−
              <div class="note-content">
+
                            <a href="https://2015.igem.org/Team:HSNU-TAIPEI/achievement" class="backing-link"></a>
−
                <h3 class="note-subtitle">Material</h3>
+
                            <h2>Achievement</h2>
−
                <ol class="note-ordered-list">
+
                            <img src="https://static.igem.org/mediawiki/2015/thumb/8/8e/HSNU-TAIPEI_homeimage_1.jpg/800px-HSNU-TAIPEI_homeimage_1.jpg">
−
                  <li>E.coli(DH5&#945;、CmR J22102)</li>
+
                        </div>
−
                  <li>Tube</li>
+
                        <div class="home-bg">
−
                  <li>LB broth</li>
+
                            <a href="https://2015.igem.org/Team:HSNU-TAIPEI/parts" class="backing-link"></a>
−
                  <li>Inoculating loop</li>
+
                            <h2>Parts</h2>
−
                  <li>Alcohol Burner</li>
+
                            <img src="https://static.igem.org/mediawiki/2015/thumb/8/8e/HSNU-TAIPEI_homeimage_1.jpg/800px-HSNU-TAIPEI_homeimage_1.jpg">
−
                </ol>
+
                        </div>
−
                <h3 class="note-subtitle">Procedure</h3>
+
                    </div>
−
                <p class="note-caption">Step1:Draw 10mL LB broth with 5mL pipet into a tube (total4).</p>
+
       
−
                <p class="note-caption">Step2: Scrape a colony with an inoculating loop sterilized by alcohol burner. </p>
+
        <div class="section three-link">
−
                <p class="note-caption">Step3: Add the colony into the tube (two for each strain). </p>
+
                <div class="home-bg">
−
                <p class="note-caption">Step4:Keep it in 37&#8451; incubator.</p>
+
                        <a href="https://2015.igem.org/Team:HSNU-TAIPEI/product" class="backing-link"></a>
−
              </div>
+
                        <h2>Product</h2>
−
              <a class="expand-btn">Show More</a>
+
                        <img src="https://static.igem.org/mediawiki/2015/thumb/8/8e/HSNU-TAIPEI_homeimage_1.jpg/800px-HSNU-TAIPEI_homeimage_1.jpg">
−
            </div>
+
                </div>
−
 
+
                <div class="home-bg">
−
 
+
                        <a href="https://2015.igem.org/Team:HSNU-TAIPEI/labnotes" class="backing-link"></a>
−
            <div class="section note">
+
                        <h2>Notebook</h2>
−
              <h2 class="note-title">Preprocess of Growth Curve</h2>
+
                        <img src="https://static.igem.org/mediawiki/2015/c/cd/HSNU-TAIPEI_homeimage_5.jpg">
−
              <ul class="note-info">
+
                </div>
−
                <li>Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen</li>
+
                <div class="home-bg">
−
                <li>Place: Fu Jen University Food Science Department </li>
+
                        <a href="https://2015.igem.org/Team:HSNU-TAIPEI/Team/members" class="backing-link"></a>
−
                <li>Date: September 3rd & 4th, 2015</li>
+
                        <h2>Team</h2>
−
              </ul>
+
                        <img src="https://static.igem.org/mediawiki/2015/d/d5/HSNU-TAIPEI_homeimage_2.jpg">
−
              <div class="note-content">
+
                </div>
−
                <h3 class="note-subtitle">Material</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>LB agar</li>
+
−
                  <li>0.85% saline</li>
+
−
                  <li>Tube</li>
+
−
                  <li>Dish</li>
+
−
                </ol>
+
−
                <h3 class="note-subtitle">Procedure</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>Solid medium
+
−
                    <p class="note-caption">Step1:Get certain weight of LB broth (25g/L) and agar (1.5%)</p>
+
−
                    <p class="note-caption">Step2: Add the powder into the serum bottle with a wash bottle.</p>
+
−
                    <p class="note-caption">Step3: Add certain amount of ddH<sub>2</sub>O into the serum bottle.</p>
+
−
                    <p class="note-caption">Step4:Dissolve the solution with a spinbar.</p>
+
−
                    <p class="note-caption">Step5:Sterilization for 1.5hr. </p>
+
−
                    <p class="note-caption">Step6:Distribute to each dish (10mL/dish).</p>
+
−
                  </li>
+
−
                  <li>Buffer solution
+
−
                    <p class="note-caption">Step1: Get certain weight of saline (0.85%)</p>
+
−
                    <p class="note-caption">Step2: Add the powder into the serum bottle with a wash bottle.</p>
+
−
                    <p class="note-caption">Step3: Add certain amount of ddH<sub>2</sub>O into the serum bottle.</p>
+
−
                    <p class="note-caption">Step4:Sterilization for 1.5hr.</p>
+
−
                    <p class="note-caption">Step5:Distribute to each tube (9mL/tube).</p>
+
−
                  </li>
+
−
                </ol>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">Pre-test of Gel Entrapment</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen</li>
+
−
                <li>Place: Fu Jen University Food Science Department </li>
+
−
                <li>Date: August 31th & September 1st 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <h3 class="note-subtitle">Purpose</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>Make sure if the procedure from others’ reference fits our experiment.</li>
+
−
                  <li>Compare the different effect of using syringe and pipet.</li>
+
−
                </ol>
+
−
                <h3 class="note-subtitle">Material</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>PVA(Polyvinyl alcohol)</li>
+
−
                  <li>SA(Alginate)</li>
+
−
                  <li>BA(Boric acid)</li>
+
−
                  <li>CaCl<sub>2</sub></li>
+
−
                  <li>Chitosan</li>
+
−
                  <li>Sodium citrate(Na<sub>3</sub>C<sub>6</sub>H<sub>5</sub>O<sub>7</sub>&#8226;2H<sub>2</sub>O)</li>
+
−
                  <li>Beaker</li>
+
−
                  <li>Syringe</li>
+
−
                  <li>Pipet</li>
+
−
                </ol>
+
−
                <h3 class="note-subtitle">Procedure</h3>
+
−
                <ul class="note-unordered-list">
+
−
                  <li>
+
−
                    <p class="note-caption">PVA-SA</p>
+
−
                    <p class="note-caption">Step1:  Pour some solution into beakers.</p>
+
−
                    <p class="note-caption">Step2: Draw certain amount of 8%PVA-1%SA and add it into 3%BA-1%CaCl<sub>2</sub>.</p>
+
−
                  </il>
+
−
                  <li>
+
−
                    <p class="note-caption">SA</p>
+
−
                    <p class="note-caption">Step1:  Pour some solution into beakers.</p>
+
−
                    <p class="note-caption">Step2: Draw certain amount of 3%SA and add it into 1%CaCl<sub>2</sub>.</p>
+
−
                  </il>
+
−
                  <li>
+
−
                    <p class="note-caption">ACA</p>
+
−
                    <p class="note-caption">Step1:  Pour some solution into beakers.</p>
+
−
                    <p class="note-caption">Step2: Draw certain amount of 1.5%SA and add it into 100mmol/LCaCl<sub>2</sub></p>
+
−
                    <p class="note-caption">Step3: Throw the microcapsule into 0.3%Chitosan.</p>
+
−
                    <p class="note-caption">Step4: Throw the microcapsule into 0.15%SA.</p>
+
−
                    <p class="note-caption">Step5: Use syringe to inject sodium citrate in the microcapsule.</p>
+
−
                  </il>
+
−
                </ul>
+
−
                <h3 class="note-subtitle">Result</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>
+
−
                    <p class="note-caption">Different method of entrapment</p>
+
−
                    <table class="note-table">
+
−
                      <td>PVA-SA</td>
+
−
                      <td>SA</td>
+
−
                      <td>ACA</td>
+
−
                      <tr>
+
−
                      <td>
+
−
                        <img src="https://static.igem.org/mediawiki/2015/e/eb/HSNU-TAIPEI-Product901-1.jpg">
+
−
                      </td>
+
−
                      <td>
+
−
                        <img src="https://static.igem.org/mediawiki/2015/8/84/HSNU-TAIPEI-Product901-2.jpg">
+
−
                      </td>
+
−
                      <td>
+
−
                        <img src="https://static.igem.org/mediawiki/2015/b/be/HSNU-TAIPEI-Product901-3.jpg">
+
−
                      </td>
+
−
                      <tr>
+
−
                      <td>White, Teardrop-shaped</td>
+
−
                      <td>colorless (bluish), sphere</td>
+
−
                      <td>Bluish, sphere</td>                 
+
−
                    </table>
+
−
                  </li>
+
−
                  <li>
+
−
                    <p class="note-caption">Step5 of ACA is infeasible, so we decide to delete this step.</p>
+
−
                  </li>
+
−
<li>
+
−
                    <p class="note-caption">Comparison of syringe and pipet:</p>
+
−
                    <table class="note-table">
+
−
                      <td>syringe</td>
+
−
                      <td>pipet</td>
+
−
                      <tr>
+
−
                      <td>
+
−
                        <img src="https://static.igem.org/mediawiki/2015/5/5d/HSNU-TAIPEI-Product901-4.jpg">
+
−
                      </td>
+
−
                      <td>
+
−
                         <img src="https://static.igem.org/mediawiki/2015/a/ab/HSNU-TAIPEI-Product901-5.jpg">
+
−
                      </td>
+
−
                      <tr>
+
−
                      <td>Consistent size, faster, without bubble</td>
+
−
                      <td>Vary in size, slow, with bubble</td>                 
+
−
                    </table>
+
−
                  </li>
+
−
                </ol>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
 
+
−
<div class="section note">
+
−
  <h2 class="note-title">Four-phase Streaking method</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen</li>
+
−
      <li>Place: Fu Jen University Food Science Department </li>
+
−
      <li>Date: August 31th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Purpose</h3>
+
−
    <p class="note-caption">Plate streaking is an important and essential technique in molecular biology. Streaking allows the selection of a single colony from an original mixture of colonies. It also allows for the selection of one single colony from an original plate to be grown up as many colonies on a new plate.</p>
+
−
    <h3 class="note-subtitle">Material</h3>
+
−
    <ol class="note-ordered-list">
+
−
      <li>E.coli(DH5&#945;)</li>
+
−
      <li>Solid medium(LB agar)</li>
+
−
      <li>Inoculating loop</li>
+
−
      <li>Alcohol Burner</li>
+
−
    </ol>
+
−
    <h3 class="note-subtitle">Procedure</h3>
+
−
        <p class="note-caption">Step1: Sterilize the inoculating loop on an alcohol burner flame and allow it to cool for a few seconds.</p>
+
−
        <p class="note-caption">Step2: Using the loop, streak the first section of the plate using tight sweeping lines that stay within that section.</p>
+
−
        <p class="note-caption">Step3: Sterilize the loop and allow it to cool in the air for 15 seconds. Touch the loop to an unused edge of the agar surface to cool it completely before continuing.</p>
+
−
        <p class="note-caption">Step4: Pull the loop through the previous streak one or two times to re-inoculate the loop with cells.</p>
+
−
        <p class="note-caption">Step5: Streak section 2 of the plate, avoiding section 1 after the first 1-2 streaks and trying not to overlap the streaks.</p>
+
−
        <p class="note-caption">Step6: Repeat Step3,4,5 for two more times. </p>
+
−
        <img src="https://static.igem.org/mediawiki/2015/e/e2/HSNU-TAIPEI-Product831.jpg"width="30%">
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Plasmid Extraction </h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: August 27th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We extract the plasmid of B0015</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
  <h2 class="note-title">Activation of Culture</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen, Chen Szu-Hua, Chang Yu-Ting</li>
+
−
      <li>Place: Fu Jen University Food Science Department </li>
+
−
      <li>Date: August 24th & 25th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Material</h3>
+
−
    <ol class="note-ordered-list">
+
−
      <li>PVA(Polyvinyl alcohol)</li>
+
−
      <li>SA(Alginate)</li>
+
−
      <li>BA(Boric acid)</li>
+
−
      <li>CaCl<sub>2</sub></li>
+
−
      <li>Chitosan</li>
+
−
      <li>Sodium citrate(Na<sub>3</sub>C<sub>6</sub>H<sub>5</sub>O<sub>7</sub>&#8226;2H<sub>2</sub>O)</li>
+
−
      <li>Electronic balance</li>
+
−
      <li>Spatulas</li>
+
−
      <li>Beaker</li>
+
−
      <li>ddH<sub>2</sub>O</li>
+
−
      <li>Volumetric flask</li>
+
−
      <li>Mixing rod</li>
+
−
      <li>Hotplate</li>
+
−
      <li>Serum bottle</li>
+
−
    </ol>
+
−
    <h3 class="note-subtitle">Procedure</h3>
+
−
        <p class="note-caption">Step1: Get certain weight of chemicals with spatulas by an electronic balance.</p>
+
−
        <p class="note-caption">Step2: Use a volumetric flask to prepare a certain concentration of solution.</p>
+
−
        <p class="note-caption">Step3: Dissolve the solution with a stirring rod. (if not dissolving, use the hotplate until the solution becomes clear)</p>
+
−
        <img src="https://static.igem.org/mediawiki/2015/f/fa/HSNU-TAIPEI-Product-1.jpg"width="30%">
+
−
        <img src="https://static.igem.org/mediawiki/2015/d/dc/HSNU-TAIPEI-Product-2.jpg"width="30%">
+
−
        <img src="https://static.igem.org/mediawiki/2015/b/b4/HSNU-TAIPEI-Product-3.jpg" width="30%">
+
−
    <h3 class="note-subtitle">Result</h3>
+
−
        <img src="https://static.igem.org/mediawiki/2015/8/8e/HSNU-TAIPEI-Product-4.jpg" width="50%">
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Send the DNA sequencing</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: August 20th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <h3 class="note-subtitle">Procedure</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>Add 223.3 &#956;l and 291.1 &#956;l water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes </li>
+
−
                  <li>Diluted the two primer 10-fold to a concentration of 10&#956;M for use</li>
+
−
                  <li>
+
−
                    <table class="note-table">
+
−
                      <td>1&#956;g of the plasmid (220ng/&#956;l)</td>
+
−
                      <td>4.5(&#956;l)</td>
+
−
                      <tr>
+
−
                      <td>ddH<sub>2</sub>O</td>
+
−
                      <td>5.5(&#956;l)</td>
+
−
                      <tr>
+
−
                      <td>Total</td>
+
−
                      <td>10(&#956;)l</td>
+
−
                      <tr>
+
−
                      <td>Primer</td>
+
−
                      <td>2(&#956;l)</td>
+
−
                      <tr>
+
−
                      <td></td>
+
−
                      <td>12(&#956;)l</td>
+
−
                    </table>
+
−
                  </li>
+
−
                  <li>Send the DNA sequencing</li>
+
−
                </ol>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/14/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 14th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We successfully draw out the plasmid from E.coli.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/13/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 13th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We pick up the single column and incubate it.</p>
+
−
                <img src="https://static.igem.org/mediawiki/2015/9/9b/HSNU-TAIPEI-Cadmium813.jpg" width="50%">
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
+
−
  <div class="section note">
+
−
      <h2 class="note-title">Transformation</h2>
+
−
      <ul class="note-info">
+
−
        <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
        <li>Place: Academia Sinica</li>
+
−
        <li>Date: August 12th, 2015</li>
+
−
      </ul>
+
−
    <div class="note-content">
+
−
  <p class="note-caption">We transform J22106 this time.</p>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/12/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 12th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We get another RBS B0032 and transform it.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Send the second DNA sequencing</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: August 11th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <h3 class="note-subtitle">Procedure</h3>
+
−
                <ol class="note-ordered-list">
+
−
                  <li>Add 223.3 &#956;l and 291.1 &#956;l water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes </li>
+
−
                  <li>Diluted the two primer 10-fold to a concentration of 10&#956;M for use</li>
+
−
                  <li>
+
−
                    <table class="note-table">
+
−
                      <td>1&#956;g of the plasmid (220ng/&#956;l)</td>
+
−
                      <td>4.5(&#956;l)</td>
+
−
                      <tr>
+
−
                      <td>ddH<sub>2</sub>O</td>
+
−
                      <td>5.5(&#956;l)</td>
+
−
                      <tr>
+
−
                      <td>Total</td>
+
−
                      <td>10(&#956;)l</td>
+
−
                      <tr>
+
−
                      <td>Primer</td>
+
−
                      <td>2(&#956;l)</td>
+
−
                      <tr>
+
−
                      <td></td>
+
−
                      <td>12(&#956;)l</td>
+
−
                    </table>
+
−
                  </li>
+
−
                  <li>Send the DNA sequencing</li>
+
−
                </ol>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/11/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 11th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">The transforming is failed.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/10/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 10th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We get the part B0034 and transform it.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/6/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 6th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">Use the enzyme to check the part length correct or not one more time and determine that we success.</p>
+
−
                <img src="https://static.igem.org/mediawiki/2015/c/c0/HSNU-TAIPEI-Cadmium806.jpg" width="50%">
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">8/5/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: August 5th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">Use the enzyme to check the part length correct or not.</p>
+
−
                <img src="https://static.igem.org/mediawiki/2015/6/62/HSNU-TAIPEI-Cadmium805-1.jpg" width="50%">
+
−
                <img src="https://static.igem.org/mediawiki/2015/7/7e/HSNU-TAIPEI-Cadmium805-2.jpg" width="50%">
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Confirm the first DNA sequencing and Order the primer of second DNA sequencing</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: August 4th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">the primer of second DNA sequencing</p>
+
−
                <p class="note-caption">TACAGAGTTCTTGAAGTGGTGGCC</p>
+
−
                <p class="note-caption">TTTAAAGAAAAAGGGCAGGGTGGT</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">8/4/2015 Cadmium</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
<li>Place: NTNU</li>
+
−
<li>Date: August 4th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<p class="note-caption">We successfully draw out the plasmid.</p>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Plasmid Extraction </h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: July 30th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We extract the plasmid of B0034 and J23119 and test their concentration</p>
+
−
                <table class="note-table">
+
−
                  <td> </td>
+
−
                  <td>B0034</td>
+
−
                  <td> J23119</td>
+
−
                  <tr>
+
−
                  <td>concentration</td>
+
−
                  <td>208 ng/&#956;l </td>
+
−
                  <td>220 ng/&#956;l </td>
+
−
                </table>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/29/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 29th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We fell to draw out the plasmid.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Transformation</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: July 28th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We transform J23119 this time.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/28/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 28th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We incubate our E.coli.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/27/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 27th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We purify the gel , ligate the part, and transform into the E.coli.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/24/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 24th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We use gel electrophoresis to cut our part. Than we purify our gel.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/23/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 23rd, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We draw out the plasmid from single column by plasmid mini kit.</p>
+
−
                <p class="note-caption">And start to use restriction enzyme to cut the part E1010 and B0015.</p>
+
−
                <img src="https://static.igem.org/mediawiki/2015/f/ff/HSNU-TAIPEI-Cadmium723.jpg" width="50%">
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/22/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 22nd, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We draw out the plasmid from single column by plasmid mini kit but failed.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/21/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 21st, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We get the part B0015.</p>
+
−
                <p class="note-caption">Draw out the plasmid from single column by plasmid mini kit.</p>
+
−
                <p class="note-caption">We are going to do the combine the part in time but our plasmid disappeared.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/17/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 17th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">Using gel electrophoresis again and check the part have problem.</p>
+
−
                <img src="https://static.igem.org/mediawiki/2015/8/8d/HSNU-TAIPEI-Cadmium717.jpg" width="50%">
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/16/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 16th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We use gel electrophoresis to cut our part, and check the part length and determine that the part B0030 which we have has a mistake.</p>
+
−
                <img src="https://static.igem.org/mediawiki/2015/2/29/HSNU-TAIPEI-Cadmium716.jpg" width="50%">
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/15/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 15th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">Draw out the plasmid from single column by plasmid mini kit{E0040,B0030,E1010,K896008}</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/14/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 14th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We pick single column, and incubate in another tube.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
              <h2 class="note-title">7/13/2015 Cadmium</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
                <li>Place: NTNU</li>
+
−
                <li>Date: July 13th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">We get “k89608” part and transform it.</p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Transformation</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
                <li>Place: Academia Sinica</li>
+
−
                <li>Date: July,2nd, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
                <p class="note-caption">Because  transformation we did on 6/11 was fail, this week, we did transformation again. </p>
+
−
                <p class="note-caption">In order to find the cause, we did two control group. One is J23102 the other is the kit provided.
+
−
And we transform B0034 this time. </p>
+
−
              </div>
+
−
              <a class="expand-btn">Show More</a>
+
−
            </div>
+
−
 
+
−
            <div class="section note">
+
−
              <h2 class="note-title">Plasmid Purification</h2>
+
−
              <ul class="note-info">
+
−
                <li>Researcher: Shen Yu-Chun, Chen Sheng-Yuan</li>
+
−
                <li>Place: NTUCM</li>
+
−
                <li>Date: June 18th, 2015</li>
+
−
              </ul>
+
−
              <div class="note-content">
+
−
              <h3 class="note-subtitle">Material:</h3>
+
−
              <ol class="note-ordered-list">
+
−
                <li>70 % Ethanol</li>
+
−
                <li>Isopropanol </li>
+
−
                <li>50 ml centrifuge tubes</li>
+
−
                <li>Plasmid DNA Midi Kit</li>
+
−
                <li>pSB1C3-BBa_B0030 in DH5&#945;</li>
+
−
                <li>pSB1C3-BBa_E1010 in DH5&#945;</li>
+
−
                <li>pSB1A2-BBa_E0040 in DH5&#945;</li>
+
−
                <li>pSB1A2-BBa_B0010 in DH5&#945;</li>
+
−
              </ol>
+
−
              <h3 class="note-subtitle">Notes: </h3>
+
−
              <ol class="note-ordered-list">
+
−
                <li>Add RNase A to PL1 Buffer and store at 4&#8451;</li>
+
−
                <li>Warm PL2 Buffer in a 37&#8451; waterbath</li>
+
−
                <li>Use 100~150 ml of bacterial culture for Midi Kit</li>
+
−
              </ol>
+
−
              <h3 class="note-subtitle">Protocol:</h3>
+
−
              <ol class="note-ordered-list">
+
−
                <li>Flick a PM Column 2~3 times, then place the PM Column on a conical flask.</li>
+
−
                <li>Equilibrate the PM Column by applying 5 ml of PL4 Buffer by gravity flow</li>
+
−
                <li>Harvest the bacterial culture 100 ml by centrifuge at 6000 x g for 10 mins</li>
+
−
                <li>Add 5 ml of PL1 Buffer to resuspend the cell pellet by vortexing or pipetting</li>
+
−
                <li>Add 5 ml of PL2 Buffer and mix gently by inverting the tube 10 times. <strong>DO NOT VORTEX!!!</strong></li>
+
−
                <li>Place for 10 mins at room temperature until lysate clears </li>
+
−
                <li>Add 5 ml of PL3 Buffer and mix immediately by inverting the tube 10 times. <strong>DO NOT VORTEX!!!</strong></li>
+
−
                <li>Centrifuge at 15000g for 20 minutes or filtered with a filter paper</li>
+
−
                <li>Apply the supernatant from step 8. to the equilibrated PM Column and allow it to flow by gravity flow.</li>
+
−
                <li>Wash the PM Column by using PL5 Buffer 15 ml and allow the column empty by gravity flow. </li>
+
−
                <li>Discard the filtrate. </li>
+
−
                <li>Place PM Column in a clean centrifuge and apply 10 ml of PL6 Buffer to elute DNA by gravity flow</li>
+
−
                <li>Using eluates from step 12. Add 7.5 ml of room temperature isopropanol. Vortex well and let the mixture sit for 2 minutes. </li>
+
−
                <li>Centrifuge at 12500 x g for 30 minutes.</li>
+
−
                <li>Remove the supernatant, then add 3 ml of 70% ethanol to wash.</li>
+
−
                <li>Centrifuge at 12500 x g for 5 minutes, then dry ethanol at room temperature. </li>
+
−
                <li>Apply 0.2 ml of TE Buffer to resuspend DNA.</li>
+
−
              </ol>
+
−
            </div>
+
−
            <a class="expand-btn">Show More</a>
+
−
          </div>
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">6/18/2015 Cadmium</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
<li>Place: NTNU</li>
+
−
<li>Date: June 18th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<p class="note-caption">We get “B0030, E0040, E1010”part,and transform them.</p>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">6/15/2015 Cadmium</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
<li>Place: NTNU</li>
+
−
<li>Date: June 15th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<p class="note-caption">We do the ligation, and then transform the plasmid into E.coli</p>
+
−
<p class="note-caption">Mixing with LB broth, we smear the solid on the plate.</p>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">6/14/2015 Cadmium</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Chang I, Chi Ying-Cheng</li>
+
−
<li>Place: NTNU</li>
+
−
<li>Date: June 14th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<p class="note-caption">This is our first time do the experience.</p>
+
−
<p class="note-caption">We are going to use the restriction enzyme to cut the sample part {E GFP} and add a part by ligation.</p>
+
−
<p class="note-caption">So first, we use enzyme to cut the plasmid, and use gel electrophoresis to cut our part.</p>
+
−
<p class="note-caption">Than we purify our gel.</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/7/72/HSNU-TAIPEI-Cadmium614.jpg" width="50%">
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">Transformation</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Shen Yu-Chun, Chen Sheng-Yuan</li>
+
−
      <li>Place: NTUCM</li>
+
−
      <li>Date: June 11th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Material:</h3>
+
−
    <ol class="note-ordered-list">
+
−
      <li>E.coli  DH5&#945; (ps: E.coli should be kept on the ice at all time)</li>
+
−
      <li>Plasmid : pSB1A2-BBa_E0040(Ampicillin-resistant)          GFP</li>
+
−
      <li>Plasmid : pSB1C3-BBa_B0010(Chloramphenicol-resistant)    Terminator</li>
+
−
      <li>Plasmid : pSB1C3-BBa_B0030(Chloramphenicol-resistant)    RBS</li>
+
−
      <li>Plasmid : pSB1C3-BBa_E1010(Chloramphenicol-resistant)    RFP</li>
+
−
      <li>LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )</li>
+
−
      <li>LB plate(LB broth + 1% agar)</li>
+
−
      <li>Antibiotics : Ampicillin & Chloramphenicol (100&#956;g/mL for each)</li>
+
−
    </ol>
+
−
    <h3 class="note-subtitle">Protocol:</h3>
+
−
    <ol class="note-ordered-list">
+
−
      <li>Add 0.5&#956;L of plasmid into 100μL of E.coli and mix by tapping the tube.(ps: the quantity of plasmid is dependent on bacterial competency)</li>
+
−
      <li>Put the tube on the ice for 20~30mins.</li>
+
−
      <li>Remove from the ice and put the tube to the 42&#8451; hot bath for 45 sec.</li>
+
−
      <li>After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.</li>
+
−
      <li>Add 500 &#956;L of LB broth into the tube and incubate for 30~60 mins at 37&#8451;</li>
+
−
      <li>Take out the tube and put into 6000 rpm centrifuge for 5 mins.</li>
+
−
      <li>Remove supertant and remain about 100&#956;L of LB to resuspend</li>
+
−
      <li>Spread onto LB plate containing the appropriate antibiotic</li>
+
−
      <li>Incubate overnight for 12~16 hrs at 37&#8451;.</li>
+
−
    </ol>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">Transformation</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
      <li>Place: Academia Sinica</li>
+
−
      <li>Date: June 11th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <p class="note-caption">This week, we did transformation.</p>
+
−
    <p class="note-caption">We transform B0034, B0015, I765001, I732005.</p>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">Ag<sup>+</sup> adsorb on Au-NPs affect with different heavy metal ( Cu, Hg ) </h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Lin Sheng, Chu Wei-Min</li>
+
−
<li>Place: NTU Chemistry</li>
+
−
<li>Date: June 4th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<h3 class="note-subtitle">Procedure</h3>
+
−
<ol class="note-ordered-list">
+
−
<li>total:400 &#956;L</li>
+
−
<li>material:
+
−
<ul class="note-unordered-list">
+
−
<li>13nm Au-NPs 15mM,Cu 1mM100&#956;M10&#956;M</li>
+
−
<li>Hg 1mM100&#956;M10&#956;M,pH7 Tris-Borate buffer 100mM</li>
+
−
<li>AR 100&#956;M,H<sub>2</sub>O<sub>2</sub> 1mM</li>
+
−
</ul>
+
−
</li>
+
−
<li>Caclulate:
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Cu<sup>2+</sub></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Ag<sup>+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">AR</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">H<sub>2</sub>O<sub>2</sub></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>50mM&#8594;5mM</td> 
+
−
<td></td> 
+
−
<td>15mM&#8594;750&#956;M</td> 
+
−
<td>100&#956;M&#8594;10&#956;M</td> 
+
−
<td></td>
+
−
<td>100&#956;M&#8594;10&#956;M</td>
+
−
<td>1mM&#8594;100&#956;M</td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>180&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>180&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>180&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
</table>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Hg<sup>+</sub></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Ag<sup>+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">AR</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">H<sub>2</sub>O<sub>2</sub></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>50mM&#8594;5mM</td> 
+
−
<td></td> 
+
−
<td>15mM&#8594;750&#956;M</td> 
+
−
<td>100&#956;M&#8594;10&#956;M</td> 
+
−
<td></td>
+
−
<td>100&#956;M&#8594;10&#956;M</td>
+
−
<td>1mM&#8594;100&#956;M</td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>180&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>180&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>180&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
</table>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Cu<sup>2+</sub></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Ag<sup>+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">AR</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">H<sub>2</sub>O<sub>2</sub></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>50mM&#8594;5mM</td> 
+
−
<td></td> 
+
−
<td>15mM&#8594;750&#956;M</td> 
+
−
<td>100&#956;M&#8594;10&#956;M</td> 
+
−
<td></td>
+
−
<td>100&#956;M&#8594;10&#956;M</td>
+
−
<td>1mM&#8594;100&#956;M</td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>260&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
</table>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Hg<sup>+</sub></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Ag<sup>+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">AR</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">H<sub>2</sub>O<sub>2</sub></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>50mM&#8594;5mM</td> 
+
−
<td></td> 
+
−
<td>15mM&#8594;750&#956;M</td> 
+
−
<td>100&#956;M&#8594;10&#956;M</td> 
+
−
<td></td>
+
−
<td>100&#956;M&#8594;10&#956;M</td>
+
−
<td>1mM&#8594;100&#956;M</td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>260&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>40&#956;L</td> 
+
−
<td>220&#956;L</td> 
+
−
<td>20&#956;L</td> 
+
−
<td>0&#956;L</td> 
+
−
<td>40&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
<td>40&#956;L</td> 
+
−
<td>40&#956;L</td> 
+
−
</table>
+
−
 
+
−
</li>
+
−
<li>
+
−
<p class="note-caption">Result:</p>
+
−
<p class="note-caption">We put all the result into fluorescent reader.</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/4/4f/HSNU-TAIPEI-GC604.png">
+
−
<p class="note-caption">The horizontal axis:1 means control, 2 means 100&#956;M, 3 means 10&#956;M, 4 means 1&#956;M.And series1 represent no Ag<sup>+</sup> adsorb on Au-NPs,series2 stand for the experiment with Ag<sup>+</sup> adsorb on Au-NPs which had time mistake(there are one hour shock between adding M<sup>n+</sup> and AR), and the third series is the correct one with Ag<sup>+</sup> adsorb on Au-NPs.</p>
+
−
</li>
+
−
</ol>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">Au-NPs affect with different heavy metal (Cu, Pb, Hg,Zn)</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Lin Sheng, Chu Wei-Min</li>
+
−
<li>Place: NTU Chemistry</li>
+
−
<li>Date: May 28th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<h3 class="note-subtitle">Procedure</h3>
+
−
<ol class="note-ordered-list">
+
−
<li>total:500 &#956;L</li>
+
−
<li>material:
+
−
<ul class="note-unordered-list">
+
−
<li>3nm Au-NPs 1.5mM,Cu 10mM1mM100&#956;M10&#956;M</li>
+
−
<li>Cd 10mM1mM100&#956;M10&#956;M,Hg 10mM1mM100&#956;M10&#956;M</li>
+
−
<li>Zn10mM1mM100&#956;M10&#956;M,pH7 Pb buffer 100mM</li>
+
−
</ul>
+
−
</li>
+
−
<li>
+
−
<p class="note-caption">Caclulate:</p>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Cu</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>100mM&#8594;10mM</td> 
+
−
<td></td> 
+
−
<td>1.5mM&#8594;3&#956;M</td> 
+
−
<td>0.1x</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>350&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>0</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1mM</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10mM&#8594;1mM)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
</table>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Cd</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>100mM&#8594;10mM</td> 
+
−
<td></td> 
+
−
<td>1.5mM&#8594;3&#956;M</td> 
+
−
<td>0.1x</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>350&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>0</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1mM</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10mM&#8594;1mM)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
</table>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Hg</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>100mM&#8594;10mM</td> 
+
−
<td></td> 
+
−
<td>1.5mM&#8594;3&#956;M</td> 
+
−
<td>0.1x</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>350&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>0</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1mM</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10mM&#8594;1mM)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
</table>
+
−
<table class="note-table">
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Zn</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">buffer </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">DI water </span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Au-NPs</span></td>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">M<sup>n+</sup></span></td>
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">target </span></td>
+
−
<td>100mM&#8594;10mM</td> 
+
−
<td></td> 
+
−
<td>1.5mM&#8594;3&#956;M</td> 
+
−
<td>0.1x</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">Control </span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>350&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>0</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1mM</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10mM&#8594;1mM)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">100&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(1mM&#8594;100&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">10&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(100&#956;M&#8594;10&#956;M)</td> 
+
−
<tr>
+
−
<td bgcolor="#0072E3"><span style="color:#FFFFFF;">1&#956;M</span></td>
+
−
<td>50&#956;L</td> 
+
−
<td>300&#956;L</td> 
+
−
<td>100&#956;L</td> 
+
−
<td>50&#956;L(10&#956;M&#8594;1&#956;M)</td> 
+
−
</table>
+
−
</li>
+
−
<li>
+
−
<p class="note-caption">Result:</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/d/df/HSNU-TAIPEI-GC528-1.png">
+
−
<p class="note-caption">H1~H4 Hg1mM~1&#956;M</p>
+
−
<p class="note-caption">H4~H8 Cd1mM~1&#956;M</p> 
+
−
<img src="https://static.igem.org/mediawiki/2015/9/91/HSNU-TAIPEI-GC528-2.png">
+
−
<p class="note-caption">G1~G4 Cu1mM~1&#956;M</p>
+
−
<p class="note-caption">G5~G8 Zn1mM~1&#956;M</p> 
+
−
<img src="https://static.igem.org/mediawiki/2015/4/4b/HSNU-TAIPEI-GC528-Zn.png">
+
−
<img src="https://static.igem.org/mediawiki/2015/0/06/HSNU-TAIPEI-GC528-Hg.png">
+
−
<img src="https://static.igem.org/mediawiki/2015/2/28/HSNU-TAIPEI-GC528-Cd.png">
+
−
<img src="https://static.igem.org/mediawiki/2015/d/db/HSNU-TAIPEI-GC528-Cu.png">
+
−
</li>
+
−
</ol>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">TRANSFORMATION</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
+
−
      <li>Place: TMU lab </li>
+
−
      <li>Date: May 28th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Materials</h3>
+
−
    <ul class="note-unordered-list">
+
−
      <li>Resuspended DNA (B0015, E0240, E0840, E0420, E0430, I13001, J23119, B1006)</li>
+
−
      <li>Competent cells (20&#956;l DH5&#945;  per transformation)</li>
+
−
      <li>Ice (in ice container) </li>
+
−
      <li>2ml tube</li>
+
−
      <li>42&#8451; water bath</li>
+
−
      <li>Petri dishes with LB agar and appropriate antibiotic</li>
+
−
      <li>Spreader</li>
+
−
      <li>37&#8451; incubator</li>
+
−
      <li>SOC Media (180&#956;l per transformation)</li>
+
−
      <li>Pipettman</li>
+
−
      <li>Centrifuge </li>
+
−
    </ul>
+
−
    <h3 class="note-subtitle">Procedure</h3>
+
−
    <ol class="note-ordered-list">
+
−
    <li>Start thawing the competent cells on ice.</li>
+
−
    <li>Add 20 &#956;L of thawed competent cells into pre-chilled 2ml tube, labelled for your control. </li>
+
−
    <li>Add 1 &#956;L of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.</li>
+
−
    <li>Close tubes and incubate the cells on ice for 30 minutes.</li>
+
−
    <li>Heat shock the cells by immersion in a pre-heated water bath at 42&#8451; for 60 seconds.</li>
+
−
    <li>Incubate the cells on ice for 2 minutes for recover.</li>
+
−
    <li>Add 180 &#956;L of SOC Media(without antibiotic) and then incubate the cells at 37&#8451; for 1 hour while the tubes are shaking(200~250 rpm).</li>
+
−
    <li>Centrifuge the cells at 2000 rpm for 2 minutes.</li>
+
−
    <li>Remove 100 &#956;L of the supernatant by the pipettmen.</li>
+
−
    <li>For the control, label two petri dishes with LB agar and the appropriate antibiotic(chloramphenicol). Plate 100 &#956;l of the transformation onto the dishes, and spread.</li>
+
−
    <li>Incubate the plates at 37&#8451; for 12-16 hours, making sure the agar side of the plate is up.</li>
+
−
    <li>Store the plate in 4 &#8451;.</li>
+
−
    </ol>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">TRANSFORMATION</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
+
−
      <li>Place: TMU lab </li>
+
−
      <li>Date: May 21th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Materials</h3>
+
−
    <ul class="note-unordered-list">
+
−
      <li>Resuspended DNA (Resuspend well in 10&#956;l dH<sub>2</sub>0, pipette up and down several times, let sit for a few minutes)</li>
+
−
      <li>Competent cells (100&#956;l DH5&#945;  per transformation)</li>
+
−
      <li>Ice (in ice container) </li>
+
−
      <li>2ml tube (1 per transformation)</li>
+
−
      <li>42&#8451; water bath</li>
+
−
      <li>Petri dishes with LB agar and appropriate antibiotic (1 per transformation)</li>
+
−
      <li>Spreader  (2 per transformation)</li>
+
−
      <li>37&#8451; incubator</li>
+
−
      <li>LB broth (900&#956;l per transformation)</li>
+
−
      <li>Pipettman</li>
+
−
      <li>Centrifuge </li>
+
−
    </ul>
+
−
    <h3 class="note-subtitle">Procedure</h3>
+
−
    <ol class="note-ordered-list">
+
−
    <li>Start thawing the competent cells on ice.</li>
+
−
    <li>Add 100 &#956;L of thawed competent cells into pre-chilled 2ml tube, labelled for your control. </li>
+
−
    <li>Add 1 &#956;L of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.</li>
+
−
    <li>Close tubes and incubate the cells on ice for 30 minutes.</li>
+
−
    <li>Heat shock the cells by immersion in a pre-heated water bath at 42&#8451; for 60 seconds.</li>
+
−
    <li>Incubate the cells on ice for 2 minutes for recover.</li>
+
−
    <li>Add 900 &#956;L  of LB broth(without antibiotic) and thenincubate the cells at 37&#8451; for 1 hour while the tubes are shaking(200~250 rpm).</li>
+
−
    <li>Centrifuge the cells at 2000 rpm for 2 minutes.</li>
+
−
    <li>Remove 800 &#956;L of the supernatant by the pipettmen.</li>
+
−
    <li>For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 150 &#956;l of the transformation onto the dishes, and spread.</li>
+
−
    <li>Incubate the plates at 37&#8451; for 12-16 hours, making sure the agar side of the plate is up.</li>
+
−
    <li>After picking colonies, store the plate in 4 &#8451;.</li>
+
−
    </ol>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">TRANSFORMATION</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
+
−
      <li>Place: TMU lab </li>
+
−
      <li>Date: May 7th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Materials</h3>
+
−
    <ul class="note-unordered-list">
+
−
      <li>Resuspended DNA (Resuspend well in 10&#956;l ddH<sub>2</sub>0, pipette up and down several times, let sit for a few minutes)</li>
+
−
      <li>Competent cells (100&#956;l DH5&#945;  per transformation)</li>
+
−
      <li>Ice (in ice container) </li>
+
−
      <li>2ml tube (1 per transformation)</li>
+
−
      <li>42&#8451; water bath</li>
+
−
      <li>Petri dishes with LB agar and appropriate antibiotic (1 per transformation)</li>
+
−
      <li>Spreader  (1 per transformation)</li>
+
−
      <li>37&#8451; incubator</li>
+
−
      <li>LB broth (900&#956;l per transformation)</li>
+
−
      <li>Pipettman</li>
+
−
      <li>Centrifuge </li>
+
−
    </ul>
+
−
    <h3 class="note-subtitle">Procedure</h3>
+
−
    <ol class="note-ordered-list">
+
−
    <li>Start thawing the competent cells on ice.</li>
+
−
    <li>Add 100 &#956;L of thawed competent cells into pre-chilled 2ml tube, labelled for your control. </li>
+
−
    <li>Add 1 &#956;L of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.</li>
+
−
    <li>Close tubes and incubate the cells on ice for 30 minutes.</li>
+
−
    <li>Heat shock the cells by immersion in a pre-heated water bath at 42&#8451; for 60 seconds.</li>
+
−
    <li>Incubate the cells on ice for 2 minutes for recover.</li>
+
−
    <li>Add 900 &#956;L  of LB broth(without antibiotic) and thenincubate the cells at 37&#8451; for 1 hour while the tubes are shaking(200~250 rpm).</li>
+
−
    <li>Centrifuge the cells at 2000 rpm for 2 minutes.</li>
+
−
    <li>Remove 800 &#956;L of the supernatant by the pipettmen.</li>
+
−
    <li>For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 &#956;l of the transformation onto the dishes, and spread.</li>
+
−
    <li>Incubate the plates at 37&#8451; for 12-16 hours, making sure the agar side of the plate is up, and then store the plate in 4 &#8451;.</li>
+
−
    </ol>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
      <div class="section note">
+
−
<h2 class="note-title">First-Strand cDNA Synthesis Using M-MLV RT</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
<li>Place: Academia Sinica</li>
+
−
<li>Date: April 30th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<h3 class="note-subtitle">Material</h3>
+
−
<ol class="note-ordered-list">
+
−
<li>randon primer 1&#13205;</li>
+
−
<li>2MUG RNA F10 1.95&#13205;</li>
+
−
<li>2MUG RNA m1 1.95&#13205;</li>
+
−
<li>10mM dNTP 1&#13205;</li>
+
−
<li>ddH<sub>2</sub>O</li>
+
−
<li>5&#215; FSB 4&#13205;</li>
+
−
<li>0.1M DTT 2&#13205;</li>
+
−
<li>RNase out 1&#13205;</li>
+
−
<li>M-MLV RT 1&#13205;</li>
+
−
<li>eppendorf</li>
+
−
</ol>
+
−
<h3 class="note-subtitle">Procedure</h3>
+
−
<p class="note-caption">A 20-&#13205; reaction volume can be used for 1 ng-5MUG of total RNA or 1-500 ng of mRNA.</p>
+
−
<ol class="note-ordered-list">
+
−
<li>Add the following components to a nuclease-free microcentrifuge tube:
+
−
<ul class="note-unordered-list">
+
−
<li>1&#13205; oligo(dT)<sub>12-18</sub>(500μg/ml), or 50-250 ng random primers, or 2pmole gene -specific primer</li>
+
−
<li>1 ng to 5MUG total RNA or 1 ng to 500ng of mRNA</li>
+
−
<li>1&#13205; 10 mM dNTP Mix(10 mM each dATP,dGTP,dCTP and dTTP at neutral pH)</li>
+
−
<li>Sterile, distilled water to 12&#13205;</li>
+
−
</ul>
+
−
</li>
+
−
<li>Heat mixture to 65&#8451; for 5 min an quick chill on ice. Collect the contents of the tube by brief centrifugation and add:
+
−
<ul class="note-unordered-list">
+
−
<li>4&#13205; 5X First-Strand Buffer</li>
+
−
<li>2&#13205; 0.1 M DTT</li>
+
−
<li>1&#13205; RNaseOUTTM Recombinant Ribonuclease Inhibitor (40 units/&#13205;)</li>
+
−
</ul>
+
−
<p class="note-caption">(Note: When using less than 50 ng of starting RNA, the addition of RNaseOUTTM is essential.)</p>
+
−
</li>
+
−
<li>Mix contents of the tube gently and incubate at 37&#8451; for 2 min.</li>
+
−
<li>Add 1&#13205;(200 units) of M-MLV RT,a and mix by pipetting gently up and down. If using random primers, incubate tube at 25&#8451; for 10 min.</li>
+
−
<li>Incubate 50 min at 37&#8451;.</li>
+
−
<li>Inactivate the reaction by heating at 70&#8451; for 15 min.</li>
+
−
</ol>
+
−
<h3 class="note-subtitle">Result</h3>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">TRANSFORMATION</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
+
−
      <li>Place: TMU lab </li>
+
−
      <li>Date: April 30th, 2015</li>
+
−
  </ul>
+
−
  <div class="note-content">
+
−
    <h3 class="note-subtitle">Materials</h3>
+
−
    <ul class="note-unordered-list">
+
−
      <li>Resuspended DNA (J04450)</li>
+
−
      <li>Competent cells (100&#956;l DH5&#945;  per transformation)</li>
+
−
      <li>Ice (in ice container) </li>
+
−
      <li>2ml tube</li>
+
−
      <li>42&#8451; water bath</li>
+
−
      <li>Petri dishes with LB agar and appropriate antibiotic</li>
+
−
      <li>Spreader</li>
+
−
      <li>37&#8451; incubator</li>
+
−
      <li>LB broth (900&#956;l per transformation)</li>
+
−
      <li>Pipettman</li>
+
−
      <li>Centrifuge </li>
+
−
    </ul>
+
−
    <h3 class="note-subtitle">Procedure</h3>
+
−
    <ol class="note-ordered-list">
+
−
    <li>Start thawing the competent cells on ice.</li>
+
−
    <li>Add 100 &#956;L of thawed competent cells into pre-chilled 2ml tube, labelled for your control. </li>
+
−
    <li>Add 2 &#956;L of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.</li>
+
−
    <li>Close tubes and incubate the cells on ice for 30 minutes.</li>
+
−
    <li>Heat shock the cells by immersion in a pre-heated water bath at 42&#8451; for 60 seconds.</li>
+
−
    <li>Incubate the cells on ice for 2 minutes for recover.</li>
+
−
    <li>Add 900 &#956;L  of LB broth(without antibiotic) and thenincubate the cells at 37&#8451; for 1 hour while the tubes are shaking(200~250 rpm).</li>
+
−
    <li>Centrifuge the cells at 2000 rpm for 2 minutes.</li>
+
−
    <li>Remove 800 &#956;L of the supernatant by the pipettmen.</li>
+
−
    <li>For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 100 &#956;l and 100 &#956;l of the transformation onto the dishes, and spread.</li>
+
−
    <li>Incubate the plates at 37&#8451; for 12-16 hours, making sure the agar side of the plate is up.</li>
+
−
    <li>After picking colonies, store the plate in 4 &#8451;.</li>
+
−
    </ol>
+
−
  </div>
+
−
  <a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
<div class="section note">
+
−
<h2 class="note-title">Plasmid Purification & Gel electrophoresis</h2>
+
−
<ul class="note-info">
+
−
<li>Researcher: Shen Yu-Chun, Chen Sheng-Yuan</li>
+
−
<li>Place: NTUCM</li>
+
−
<li>Date: April 30th, 2015</li>
+
−
</ul>
+
−
<div class="note-content">
+
−
<h3 class="note-subtitle">Material:</h3>
+
−
<ol class="note-ordered-list">
+
−
<li>Resuspension Buffer S1</li>
+
−
<li>Lysis Buffer S2</li>
+
−
<li>Neutralization Buffer S3</li>
+
−
<li>Equilibration Buffer N2</li>
+
−
<li>Wash Buffer N3</li>
+
−
<li>
+
−
<p class="note-caption">Elution Buffer N5</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/b/be/HSNU-TAIPEI-Cu430-1.jpg" width="50%">
+
−
</li>
+
−
<li>Overnight bacteria</li>
+
−
<li>Room-temperature isopropanol</li>
+
−
<li>1% agarose</li>
+
−
<li>TE buffer (using at Gel electrophoresis)</li>
+
−
</ol>
+
−
<h3 class="note-subtitle">Protocol:(Plasmid Purification)</h3>
+
−
<ol class="note-ordered-list">
+
−
<li>
+
−
<p class="note-caption">Harvest bacteria from an LB culture by centrifugation at 6000 rpm for 10 mins at 4&#8451;</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/f/fa/HSNU-TAIPEI-Cu430-2.jpg" width="30%">
+
−
</li>
+
−
<li>
+
−
<p class="note-caption">Resuspend the pellet of bacterial cells in Buffer S1.</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/9/9c/HSNU-TAIPEI-Cu430-3.jpg" width="30%">
+
−
</li>
+
−
<li>Add Buffer S2 the suspension .Mix by inverting the tube for 6~8 times. Incubate the mixture at 18~25&#8451; for 2~3 mins.</li>
+
−
<li>Add Buffer S3 (pre-cooled at 4&#8451; ) to the suspension. Immediately mix the lysate by inverting the flask 6~8 times.</li>
+
−
<li>Equilibrate a Column with Buffer N2</li>
+
−
<li>
+
−
<p class="note-caption">Place the folded filter in a funnel of appropriate size. Wet the filter with a few drop of Buffer N2 and load the bacterial lysate onto the wet filter.</p>
+
−
<img src="https://static.igem.org/mediawiki/2015/e/e9/HSNU-TAIPEI-Cu430-4.jpg" width="30%">
+
−
</li>
+
−
<li>Load the cleared lysate from 6 onto the column. Allow the column to empty by gravity flow.</li>
+
−
<li>Wash the column with Buffer N3.</li>
+
−
<li>Elute the plasmid DNA with Buffer N5.</li>
+
−
<li>Add room-temperature isopropanol to precipitate the eluted plasmid DNA. Mix carefully and centrifuge at 12000 g for 30 mins at 4&#8451;. Carefully discard the supertant.</li>
+
−
<li>Add room-temperature 70% ethanol to the pellet. Vortex briefly and centrifuge at 12000 g for 10 min at 18~25&#8451;.</li>
+
−
<li>Carefully remove ethantol from the tube with a pipette tip. Allow the pellet to dry at 18~25&#8451; no iess than the indicated time.</li>
+
−
</ol>
+
−
</div>
+
−
<a class="expand-btn">Show More</a>
+
−
</div>
+
−
 
+
−
 
+
−
 
+
−
          <div class="section note">
+
−
  <h2 class="note-title">First-Strand cDNA Synthesis Using M-MLV RT</h2>
+
−
  <ul class="note-info">
+
−
      <li>Researcher: Chang Ko-Yu, Chu Yi-Chia</li>
+
−
      <li>Place: Academia Sinica</li>
+
−
      <li>Date: April 30th, 2015</li>
+
−
    </ul>
+
−
    <div class="note-content">
+
−
      <h3 class="note-subtitle">Preparing Samples</h3>
+
−
      <p class="note-caption">Homogenizing samples</p>
+
−
      <ul class="note-unordered-list">
+
−
        <li>Determine your sample type, and perform homogenization at room temperature according to the table below. The sample volume should not exceed 10% of the volume of TRIzol Reagent used for homogenization. Be sure to use the indicated amount of TRIzol Reagent, because an insufficient volume can result in DNA contamination of isolated RNA.</li>
+
−
      </ul>
+
−
    <table class="note-table">
+
−
<thead>
+
−
<tr>
+
−
<th>Sample Type</th>
+
−
      <th>Action</th>
+
−
</tr>
+
−
</thead>
+
−
<tbody>
+
−
<tr>
+
−
<td>Tissues</td>
+
−
      <td>
+
−
        <ol class="note-ordered-list">
+
−
          <li>Add 1mL TRIzol Reagent per 50-100 mg of tissue sample. </li>
+
−
          <li>Homogenize sample using a glass-Teflon or power homogenizer.</li>
+
−
        </ol>
+
−
        <ul class="note-unordered-list">
+
−
        <li>Note: Process or freeze tissue samples immediately upon collection.</li>
+
−
        </ul>
+
−
      </td>
+
−
</tr>
+
−
</tbody>
+
−
    </table>
+
−
      <h3 class="note-subtitle">RNA Isolation Procedurec</h3>
+
−
      <p class="note-caption">Always use the appropriate precautions to avoid RNase contamination when preparing and handling RNA.</p>
+
−
      <h3 class="note-subtitle">RNA precipitation</h3>
+
−
    <ol class="note-ordered-list">
+
−
        <li>(Optional) When precipitating RNA from small sample quantities (&#60;10<sup>6</sup> cells or &#60; 10 mg tissue), add 5-10&#956;g of RNase-free glycogen as a carrier to the aqueous phase.
+
−
          <ul class="note-unordered-list">
+
−
            <li>Note: Glycogen is co-precipitated with the RNA,but does not inhibit first-strand synthesis at concentrations &le;4mg/mL,and does not inhibit PCR.</li>
+
−
          </ul>
+
−
        </li>
+
−
        <li>Add 0.5mL of 100% isopropanol to the aqueous phase, per 1mL of TRIzol Reagent used for homogenization.</li>
+
−
        <li>Incubate at room temperature for 10 minutes.</li>
+
−
        <li>Centrifuge at 12,000 × g for 10 minutes at 4&#8451;.
+
−
          <ul class="note-unordered-list">
+
−
            <li>Note: The RNA is often invisible prior to centrifugation, and forms a gel-like pellet on the side and bottom of the tube.</li>
+
−
          </ul>
+
−
        </li>
+
−
        <li>Proceed to RNA wash.</li>
+
−
    </ol>
+
−
      <h3 class="note-subtitle">Proceed to RNA wash.</h3>
+
−
      <ol class="note-ordered-list">
+
−
        <li>Remove the supernatant from the tube,leaving only the RNA pellet.</li>
+
−
        <li>Wash the pellet,with 1mL of 75% ethanol per 1mL of TRIzol Reagent used in the initial homogenization.
+
−
          <ul class="note-unordered-list">
+
−
            <li>Note: The RNA can be stored in 75% ethanol at least 1 year at-20&#8451;, or at least 1 week at 4&#8451;.</li>
+
−
          </ul>
+
−
        </li>
+
−
        <li>Vortex the sample briefly,then centrifuge the tube at 7500 × g for 5 minutes at 4&#8451;.Discard the wash.</li>
+
−
        <li>Vacuum or air dry the RNA pellet for 5-10 minutes. Do not dry the pellet by vacuum centrifuge.
+
−
          <ul class="note-unordered-list"
+
−
            <li>Note: Do not allow the RNA to dry completely,because  the  pellet  can  lose  solubility.Partially dissolved RNA samples have an A<sub>260/280</sub> ratio<1.6.</li>
+
−
          </ul>
+
−
        </li>
+
−
        <li>Proceed to RNA resuspension.</li>
+
−
      </ol>
+
−
          <h3 class="noye-subtitle">RNA resuspension</h3>
+
−
          <ol class="note-ordered-list">
+
−
            <li>Resuspend the RNA pellet in RNase-free water or 0.5% SDS solution(20-50&#13205;) by passing the solution up and down several times through a pipette tip.
+
−
              <ul class="note-unordered-list">
+
−
                <li>Note: Do not dissolve the RNA in 0.5% SDS if it is to be used in subsequent enzymatic reactions.</li>
+
−
              </ul>
+
−
            </li>
+
−
            <li>Incubate in a water bath or heat block set at 55-60&#8451; for 10-15 minutes.</li>
+
−
            <li>Proceed to downstream application, or store at -70&#8451;.</li>
+
−
          </ol>
+
 
        </div>
 
        </div>
−
        <a class="expand-btn">Show More</a>
 
−
      </div>
 
−
 
−
<div class="section note">
 
−
<h2 class="note-title">Transformation</h2>
 
−
<ul class="note-info">
 
−
<li>Researcher: Shen Yu-Chun, Chen Sheng-Yuan</li>
 
−
<li>Place: NTUCM</li>
 
−
<li>Date: April 13th, 2015</li>
 
−
</ul>
 
−
<div class="note-content">
 
−
<h3 class="note-subtitle">Material:</h3>
 
−
<ol class="note-ordered-list">
 
−
<li>E.coli  DH5&#945; (ps: E.coli should be kept on the ice at all time)</li>
 
−
<li>Plasmid pBR322(Ampicillin-resistant)</li>
 
−
<li>LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )</li>
 
−
<li>LB plate(LB broth + 1% agar)</li>
 
−
<li>Antibiotics : Ampicillin(100&#956;g/mL)</li>
 
−
</ol>
 
−
<h3 class="note-subtitle">Protocol:</h3>
 
−
<ol class="note-ordered-list">
 
−
<li>Add 5&#956;L of DNA into 100&#956;L of E.coli and mix by tapping the tube.    (ps: the quantity of DNA is dependent on bacterial competency)</li>
 
−
<li>
 
−
<p class="note-caption">Put the tube on the ice for 20~30mins.</p>
 
−
<img src="https://static.igem.org/mediawiki/2015/c/cc/HSNU-TAIPEI-Cu413-1.jpg" width="30%">
 
−
</li>
 
−
<li>
 
−
<p class="note-caption">Remove from the ice and put the tube to the 42&#8451; hot bath for 45 sec.</p>
 
−
<img src="https://static.igem.org/mediawiki/2015/8/89/HSNU-TAIPEI-Cu413-2.jpg" width="30%">
 
−
</li>
 
−
<li>
 
−
<p class="note-caption">After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.</p>
 
−
<img src="https://static.igem.org/mediawiki/2015/a/ad/HSNU-TAIPEI-Cu413-4.jpg">
 
−
</li>
 
−
<li>Add 500 &#956;L of LB broth into the tube and incubate for 30~60 mins at  37&#8451;</li>
 
−
<li>Take out the tube and put into 6000 rpm centrifuge for 5 mins</li>
 
−
<li>Remove supertant and remain about 100&#956;L of LB to resuspend</li>
 
−
<li>Spread onto LB plate containing the appropriate antibiotic</li>
 
−
<li>
 
−
<p class="note-caption">Incubate overnight for 12~16 hrs at 37&#8451; and you will see so many colonies on the LB plate!!!(A colony is a white dot on the picture below)</p>
 
−
<img src="https://static.igem.org/mediawiki/2015/7/76/HSNU-TAIPEI-Cu413-3.jpg" width="50%">
 
−
</li>
 
−
</ol>
 
−
</div>
 
−
<a class="expand-btn">Show More</a>
 
−
</div>
 
−
 
−
 
−
          <div class="section note">
 
−
  <h2 class="note-title">Ligation</h2>
 
−
  <ul class="note-info">
 
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
 
−
      <li>Place: TMU lab</li>
 
−
      <li>Date: March 26th, 2015</li>
 
−
  </ul>
 
−
  <div class="note-content">
 
−
    <h3 class="note-subtitle"></h3>
 
−
    <ol class="note-ordered-list">
 
−
    <li>To an autoclaved, 1.5ml microcentrifuge tube, add the following:
 
−
      <table class="note-table">
 
−
      <td> </td>
 
−
      <td>For Cohesive Ends</td>
 
−
      <tr>
 
−
      <td>5X Ligase Reaction </td>
 
−
      <td>4 &#956;l</td>
 
−
      <tr>
 
−
      <td>Vector D</td>
 
−
      <td>3 to 30 fmol</td>
 
−
      <tr>
 
−
      <td>Insert D</td>
 
−
      <td>9 to 90 fmol </td>
 
−
      <tr>
 
−
      <td>T4 DNA Ligase (</td>
 
−
      <td>1 unit (in 1 &#956;l)</td>
 
−
      <tr>
 
−
      <td>Autoclaved distilled </td>
 
−
      <td>to 20 &#956;l</td>
 
−
      </table>
 
−
    </li>
 
−
    <li>Mix gently. Centrifuge briefly the contents to the bottom of the tube.</li>
 
−
    <li>Incubate at room temperature for 5 min.</li>
 
−
    <li>Use 2 &#956;l of the ligation reaction to transform 100 &#956;l of competent cells.</li>
 
−
    </ol>
 
−
  </div>
 
−
  <a class="expand-btn">Show More</a>
 
−
</div>
 
−
 
−
          <div class="section note">
 
−
<h2 class="note-title">3/19/2015</h2>
 
−
  <ul class="note-info">
 
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
 
−
      <li>Place: TMU</li>
 
−
      <li>Date: Match 19th, 2015</li>
 
−
  </ul>
 
−
  <div class="note-content">
 
−
    <p class="note-caption">Add restriction enzyme (EcoRI / SpeI)</p>
 
−
    <p class="note-caption">Total:40ul</p>
 
−
    <p class="note-caption">Plasmid DNA:500ng (77.7ng/ul, 500/77.7≒6.5ul)</p>
 
−
    <table class="note-table">
 
−
      <tr>
 
−
        <td>ddH2O</td>
 
−
        <td>22.5ul</td>
 
−
　    </tr>
 
−
      <tr>
 
−
        <td>10Xbfr(EcoRI)</td>
 
−
        <td>4ul</td>
 
−
　    </tr>
 
−
      <tr>
 
−
        <td>10XBSA</td>
 
−
        <td>4ul</td>
 
−
　    </tr>
 
−
      <tr>
 
−
        <td>Plasmid DNA</td>
 
−
        <td>6.5ul</td>
 
−
　    </tr>
 
−
      <tr>
 
−
        <td>EcoRI</td>
 
−
        <td>1.5ul</td>
 
−
　    </tr>
 
−
      <tr>
 
−
        <td>SpeI</td>
 
−
        <td>1.5ul</td>
 
−
　    </tr>
 
−
      <tr>
 
−
        <td>Total</td>
 
−
        <td>40ul</td>
 
−
　    </tr>
 
−
    </table>
 
−
  </div>
 
−
  <a class="expand-btn">Show More</a>
 
−
</div>
 
−
 
−
          <div class="section note">
 
−
  <h2 class="note-title">TRANSFORMATION</h2>
 
−
  <ul class="note-info">
 
−
      <li>Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung</li>
 
−
      <li>Place: Taipei Medical University</li>
 
−
      <li>Date: March 12th, 2015</li>
 
−
  </ul>
 
−
  <div class="note-content">
 
−
    <h3 class="note-subtitle">Materials</h3>
 
−
    <ul class="note-unordered-list">
 
−
      <li>Resuspended DNA (Resuspend well in 10&#956;l dH<sub>2</sub>0, pipette up and down several times, let sit for a few minutes)</li>
 
−
      <li>Competent cells (100&#956;l DH5&#945;  per transformation) </li>
 
−
      <li>Ice (in ice container) </li>
 
−
      <li>2ml tube (1 per transformation)</li>
 
−
      <li>42&#8451; water bath</li>
 
−
      <li>Petri dishes with LB agar and appropriate antibiotic (2 per transformation)</li>
 
−
      <li>Spreader (2 per transformation) </li>
 
−
      <li>37&#8451; incubator</li>
 
−
      <li>10pg/&#956;l RFP Control (pSB1C3 w/ BBa_J23102) </li>
 
−
      <li>LB broth (900&#956;l per transformation)</li>
 
−
      <li>Pipettman</li>
 
−
      <li>Centrifuge</li>
 
−
    </ul>
 
−
    <h3 class="note-subtitle">Procedure</h3>
 
−
    <ol class="note-ordered-list">
 
−
      <li>Start thawing the competent cells on ice. </li>
 
−
      <li>Add 100 &#956;L of thawed competent cells into pre-chilled 2ml tube, labelled for your control. </li>
 
−
      <li>Add 1 &#956;L of the DNA with RFP Control to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.</li>
 
−
      <li>Close tubes and incubate the cells on ice for 30 minutes.</li>
 
−
      <li>Heat shock the cells by immersion in a pre-heated water bath at 42&#8451; for 60 seconds.</li>
 
−
      <li>Incubate the cells on ice for 3 minutes for recover.</li>
 
−
      <li>Add 900 &#956;L of LB broth(without antibiotic) and thenincubate the cells at 37&#8451; for 1 hour while the tubes are shaking(200~250 rpm).</li>
 
−
      <li>Centrifuge the cells at 2000 rpm for 2 minutes.</li>
 
−
      <li>Remove 800 &#956;L of the supernatant by the pipettmen. </li>
 
−
      <li>For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 &#956;l and 150 &#956;l of the transformation onto the dishes, and spread.</li>
 
−
      <li>Incubate the plates at 37&#8451; for 12-16 hours, making sure the agar side of the plate is up.</li>
 
−
      <li>After picking colonies, store the plate in 4 &#8451;.</li>
 
−
    </ol>
 
−
  </div>
 
−
  <a class="expand-btn">Show More</a>
 
−
</div>
 
−
 
−
 
 
</div>
 
</div>
 
</main>
 
</main>

Revision as of 14:19, 13 September 2015

Project

Human Practice

Achievement

Parts

Product

Notebook

Team