Difference between revisions of "Team:CHINA CD UESTC/Method"

Line 89: Line 89:
 
                             <h3>Q2: Where are the backbone vectors from?</h3>
 
                             <h3>Q2: Where are the backbone vectors from?</h3>
 
                             <p>
 
                             <p>
−
                                 All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aim to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (<i>mamW</i> + <i>RFP</i> + <i>laccase</i>) together.
+
                                 All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (<i>mamW</i> + <i>RFP</i> + <i>laccase</i>) together.
 
                             </p>
 
                             </p>
  
Line 96: Line 96:
 
                                 <img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
 
                                 <img src="https://static.igem.org/mediawiki/2015/b/b3/CHINA_CD_UESTC_METHOD02.png" width="60%">
 
                                 <p id="pic_illustration">
 
                                 <p id="pic_illustration">
−
                                 <strong>Figure 1.</strong> This vector backbone (pET28a) will be inserted mamAB</p>
+
                                 <strong>Figure 1.</strong> This vector backbone (pET28a) will be inserted <i>mamAB</i></p>
 
                             </div>
 
                             </div>
 
                             <div class="project_pic">
 
                             <div class="project_pic">
Line 120: Line 120:
 
                                 •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
 
                                 •ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
 
                                 <br>
 
                                 <br>
−
                                 Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between mamW, RFP and Laccase.
+
                                 Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: <a href="http://parts.igem.org/Part:BBa_K416001">BBa_K416001</a>): between <i>mamW</i>, <i>RFP</i> and <i>Laccase</i>.
 
                             </p>
 
                             </p>
 
                             <p>
 
                             <p>
Line 139: Line 139:
 
                             <p>
 
                             <p>
 
                                 <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%">
 
                                 <img class="surround_pic" src="https://static.igem.org/mediawiki/2015/f/f9/CHINA_CD_UESTC_METHOD07.png" width="30%" height="30%">
−
                                 •pET28a: <br>Considered  that it is the largest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of mamAB come true.
+
                                 •pET28a: <br>Considered  that it is the largest operon size (17kb), we divided <i>mamAB</i> operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of <i>mamAB</i> come true.
 
                             </p>
 
                             </p>
 
                         </div>
 
                         </div>

Revision as of 02:46, 17 September 2015

<!DOCTYPE html>

METHOD

  We present fundamental details on various methods such as vector design, domain linker selection and choose of restriction enzyme sites used in the experiment on this page. If you are willing to check or follow our work, you can scan the methods here. Any questions or advice are welcomed at any time.

If you want to check or follow our project, you can read this page to get the main information concerning our project. In addition, you will get more details about experiment from our protocols.

Q1: How to get target gene?

Four operons related to magnetosome synthesis (mamAB/mamGFDC/mamXY/mms6) and mamW: use the magnetotactic bacteria’s (Magnetospirillum gryphiswaldense MSR -1) genome as template to amplify.

Laccase gene and RFP: use the DNA fragments from 2015 Kit Plate2 provided by iGEM (Name: BBa_K863005, BBa_E1010) and amplify them through common PCR.


Q2: Where are the backbone vectors from?

All backbone vectors are purchased from Biotech Corp. They are pET28a, pCDFDuet-1 and pACYCDuet-1, the first two aims to carry gene clusters that realize magnetosome generating and the last one is for putting the genes (mamW + RFP + laccase) together.

Figure 1. This vector backbone (pET28a) will be inserted mamAB

Figure 2. This vector backbone (pCDFDuet-1) will be inserted mamGFDC+mms6+mamXY and mamGFDC+mms6

Figure 3. This vector backbone (pACYCDuet-1) will be inserted mamW+RFP+laccase, RFP+laccase and mamW+laccase

Q3: What kinds of linker we chose for linking between our protein domains?

We obtained the linker information through searching in the Registry of Standard Biological Parts, finally we used two kinds of linkers.

•ggtggaggaggctctggtggaggcggtagcggaggcggagggtcg
Same as the (Gly4Ser)3 Flexible Peptide Linker (Name: BBa_K416001): between mamW, RFP and Laccase.

•gcaggtagcggcagcggtagcggtagcggcagcgcg
Refer to 6aa [GS]x linker(Name: BBa_J18921): between mamW and RFP.

Q4: What kinds of enzymes did we use when we made target gene insert into vectors?

•pET28a:
Considered that it is the largest operon size (17kb), we divided mamAB operon into three parts. Then we used (ApaⅠ)(SapⅠ)(ArvⅡ)(NotⅠ) to make the insertion of mamAB come true.

•pCDFDuet-1:
The restriction sites flanking mamGFDC+mms6 on either side are (HindⅢ) and (XhoⅠ), flanking mamXY on either side are (XbaⅠ)and (PstⅠ)

•pACYCDuet-1:
The restriction sites flanking mamW + RFP + Laccase on either side are (PstⅠ) and (XhoⅠ).