Part:BBa_K1668010
plu1537-device
The part plu1537 device is composed of arabinose inducible promoter pBad BBa_I0500, toxin protein plu1537 coding sequence BBa_K1668007 and composite part mCherry BBa_K1668011.
We use the device to tandem express toxic protein Plu1537 and mCherry in DH5α BL 21 (DE3). The gene plu1537 is for termite control and mCherry is a reporter.
Characterization
OVERVIEW
We construct the device plu1537 to tandem express insecticidal toxic protein Plu1537 and reporter mCherry. The 14kDa insecticidal protein Plu1537 is used to kill termites in our project.
The exact mechanism of Plu1537 remains unclear. In a 2009 research, scientists first expressed the plu1537 and purified it with GST tag. Consequently, Plu1537 showed its insecticidal activity against two moth species (Galleria& Spodoptera) larvae via hemocoel injection instead of oral feeding.
We clone and standardize the gene into standard plasmid pSB1C3. After confirmation through enzyme digestion and whole sequencing, we transform the plasmid into E.coli BL21 (DE3) to achieve better expression level.
We observe that transformants have obviously turned red and identify the expected protein band in SDS-PAGE. According to in vivo test on termites, the toxic effect of Plu1537 is far more ideal than our expectation by oral feeding.
In conclusion, we have successfully cloned and expressed the plu1537 in DH5α BL 21(DE3). Toxic effects of oral feedings on termites are far better than that described in moth larvae research.
BACKGROUND
In 2009 research Expression and activity of a probable toxin from Photorhabdus Luminescens, toxin protein pit, which is 94% homologous with plu1537, is expressed in DH5α BL21(DE3). Engineered strain BL21 was both orally fed and injected in hemocoel to two kind of moth(Galleria mellonella & Spodoptera litura)(1). As a result, hemocoel injection is more effective than oral feeding. However, our experiment showed that oral feeding is also effectively.
Plu1537 shares 30% amino acid sequence similarity with a 13.6 kDa insecticidal crystal protein cry34Ab1 in Bacillus thuringiensis (figure 1), which belongs to bt toxin family.
Bt family may be the most famous insecticidal toxin up to now. It’s one of biological toxins first used for pest control. After years of study, bt family is becoming bigger and bigger. Basically, most proteins in bt family form pores in cell membrane to kill a cell, including cry34Ab1(2).
In 2014, the structure of cry34Ab1 was revealed and reported in PLOS ONE. As displayed in figure 1, the structure of cry34Ab1 is simpler, compared with other two toxins we used. However, cry34Ab1 (figure 2A) can only function with the assistant of cry35Ab1 (figure 2B)(2), which differentiate cry34 Ab1 from Plu1537, which is toxic without any other assistant.
Figure 1, the 3D structure of cry34Ab1. Copyright 2014, Worldwide Protein Data.
Figure 2, comparison between cry34Ab1 and cry35Ab1(2). Copyright 2014, Public Library of Science.
RESULTS
PLASMID CONSTRUCTION
5-μl samples of the single (L1) and double enzyme (L2) digestion products for plu1537-device were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. We use PstI for single digestion, XbaI and PstI for double digestion, then products were determined by AGE analysis. The DNA size standards were the DL5,000 DNA Marker (M2; TaKaRa, Cat#3428A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. It can be clearly seen the plu1537 is constructed into the pSB1C3 backbone (figure 3).
Figure 3 digestion confirmation of tcdA1-device in pSB1A2 backbone.
PLASMID SEQUENCING
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 2.5k part shows 100% agreement with the desired sequence.
TOXIN EXPRESSION
BACTERIA CULTURE
The solid or liquid culture medium is LB culture with 34ug/ml chloromycetin and 80mM arabinose.
Both the antibiotics and arabinose are added after the culture cools down to 60℃. 2%(w/v) of agar is added in solid medium.
It can be clearly seen that the recombinant turned red, indicating the expression of reporter mCherry(figure 4, 5). As mCherry is located behind target gene and shares a promoter with target gene, the target gene may be expressed to a great extent.
Figure 4 expression of reporter mCherry in LB solid medium with arabinose and chloromycetin.
Figure 5 expression of reporter mCherry in LB liqiud medium with arabinose and chloromycetin.
SDS-PAGE
5ul sample is loaded in a 10% SDS-PAGE separation gel. We use 250kDa marker Precision Plus Protein? Dual Color Standards #161-0374. Parameters can be seen in protocols.
According to the result of SDS-PAGE (figure 6), target protein (14kDa) is strongly expressed (line 4) compared with the negative control, native BL21 (DE3) strain without engineering (line 1).
Figure 6 SDS-PAGE results of four devices we constructed.
TERMITES in vivo EXPERIMENTS
Part:BBa_K1668009
plu0840-device
the part plu0840 device is composed of arabinose inducible promoter pBad BBa_I0500, toxin protein plu0840 coding sequence BBa_K1668006 and composite part mCherry BBa_K1668011.
We use the device to tandem express toxic protein Plu0840 and mCherry in DH5α BL 21(DE3). The toxin protein is used for termite control in our project and mCherry is a reporter.
Characterization
OVERVIEW
We construct the device plu0840 to tandem express insecticidal toxic protein Plu0840 and reporter mCherry. The 72kDa insecticidal toxic protein Plu0840 is used to kill termites in our project.
The exact mechanism of insecticidal toxin protein Plu0840 remains to be revealed. In a 2007 research, scientists first expressed a GST-plu1537 fusion protein in E.coli BL21(DE3) with pGEX-4T-1 vector. The results showed that Plu0840 had weak oral toxicity against two kinds of moth and inhibited their growth (S. litura and S. exigua)
We clone and standardize the gene into standard plasmid pSB1C3. After confirmation of digestion and sequencing, we transform the plasmid into E.coli BL21(DE3) to achieve better expression level.
We observe that transformants have obviously turned red and figure out the expected protein band in SDS-PAGE. According to in vivo experiments on termites, the toxin effect of Plu0840 is comparatively weak than Plu1537, which is consistent with the research before.
In conclusion, we have successfully cloned and expressed the Plu0840 toxic protein in DH5α BL 21(DE3). The Plu0840 is weak toxic to termites.
BACKGROUND
In 2009 research Cloning and expression analysis of a predicted toxin gene from Photorhabdus sp. HB78, plu0840 fused with GST is expressed in DH5α BL21(DE3). Engineered strain BL21 was both orally fed and injected in hemocoel to two kind of moth (S. litura and S.exigua)(1).
According to the result, on the one hand, oral feeding effectively inhibits the growth of larva while has only weak oral toxic effect. On the other hand, hemocoel injection showed negative results.
The research mentions that Plu0840 (figure 1) shares 55% sequence identity with an enterotoxin Ast from aeromonas hydrophila. Aaeromonas hydrophila, which is connected with gastroenteritis, may lead to altered fluid secretion in mouse. According to a 2002 research, enterotoxin Ast makes weak contributions to fluid secretion compared with two other genes (2) However, judging that TT01 is nontoxic to animals at all, we think Plu0840 may share little similarity with Ast.
Figure 1, the 3D structure of Plu0840. Copyright 2014, Worldwide Protein Data.
RESULTS
PLASMID CONSTRUCTION
5-μl samples of the single (L1) and double enzyme (L2) digestion products for plu0840-device were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. We use PstI for single digestion, XbaI and PstI for double digestion, then products were determined by AGE analysis. The DNA size standards were the DL5,000 DNA Marker (M2; TaKaRa, Cat#3428A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager.
It can be clearly seen the plu0840 is constructed into the pSB1C3 backbone (figure 2).
Figure 2 digestion confirmation of device plu0840 in Psb1c3 backbone.
PLASMID SEQUENCING
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 3.9k part shows 100% agreement with the desired sequence.
TOXIN EXPRESSION
BACTERIA CULTURE
The solid or liquid culture medium is LB culture with 34ug/ml chloromycetin and 80mM arabinose.
Both the antibiotics and arabinose are added after the culture cools down to 60℃. 2%(w/v) of agar is added in solid medium.
It can be clearly seen that the recombinant turned red, indicating the expression of reporter mCherry(figure 4, 5). As mCherry is located behind target gene and shares a promoter with target gene, the target gene may be expressed to a great extent.
Figure 3 expression of reporter mCherry in LB solid medium with arabinose and chloromycetin.
Figure 4 expression of reporter mCherry in LB liqiud medium with arabinose and chloromycetin.
SDS-PAGE
5ul sample is loaded in a 10% SDS-PAGE separation gel. We use 250kDa marker Precision Plus Protein? Dual Color Standards #161-0374. Parameters can be seen in protocols.
According to the result of SDS-PAGE (figure 5), target protein Plu0840 (72kDa) is strongly expressed (line 3) compared with the negative control, native BL21 (DE3) strain without engineering (line 1).
Figure 5 SDS-PAGE results of four devices we constructed.
TERMITES in vivo EXPERIMENTS
Part:BBa_K1668008
tcdA1 device
the part tcdA1 device is composed of arabinose inducible promoter pBad BBa_I0500, toxin protein tcdA1 coding sequnceBBa_K1668005 and composite part mCherry BBa_K1668011.
We use the device to tandem express toxic protein tcdA1 and mCherry. Toxic protein tcdA1 is a macro channel forming toxin used for termite control in our project and mCherry is a reporter.
Characterization
OVERVIEW
We construct the device tcdA1 to tandem express toxic protein tcdA1 and reporter mCherry. Toxic protein tcdA1 is used to kill termites in our project.
tcdA1, one of the biggest proteins in bacteria (285kDa), is first found in Photorhabdus luminescens. It forms channels and assists other toxins across the cell membrane(1). It belongs to tc toxic protein family, which is widely distributed among different gram-negative and gram-positive bacteria.
We clone and standardize the gene into standard plasmid pSB1C3. After confirmation of digestion and sequencing, we transform the plasmid into ''E.coli BL21(DE3)'' to achieve better expression level. Despite we observe that transformants have obviously turned red, we didn’t figure out the expected protein band in SDS-PAGE. Judging that the protein is considerably huge in bacteria, more improvements are needed.
BACKGROUND
tcdA1 is a pore-forming macro-protein, which can keep the ability to form a pore in a large pH range (from 4 to 11). To be noticed, at pH11, the pore-forming activity of tcdA1 is more than 100-fold greater than at pH6. As the midguts of most insects are alkaline, tc toxic proteins are effective by feeding on insects, including termites.
In 2013, the structure of tcdA1 was revealed by researchers and reported in nature(1). As displayed in figure1a&b, the tcdA1 is composed of three parts: N-terminal a-helical domain(brown), the central b-sheet domain(green) and the C-terminal pore-forming domain(yellow). The protein has two states: pre-pore state and pore state. The pore-forming domain (figure 1c) sticks out to form pore, changing into pore state (figure 2).
Moreover, the tcdA1 toxin helps other toxins to enter the cell membrane. Naturally in strain TT01, tcdA1 is expressed homologously with other toxins, for example, tcdB1 and tcc toxins. TcdA1 helps to transfer the latter into the cell to maximum the toxic effect(figure 3).
Figure 1, the 3D structure of tcdA1. Copyright 2013, Nature Publishing Group.
Figure 2, comparison between pre-pore state and pore state of tcdA1(2, 3). Copyright 2014, Nature Publishing Group
Figure 3 the function of tcdA1 in toxin transportation(1). Copyright 2013, Nature Publishing Group.
RESULTS
PLASMID CONSTRUCTION
5μl samples of the double enzyme digestion products for tcdA1-device were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. Sizes of the XbaI and PstI–cleaved assemblies were determined by AGE analysis. The DNA size standards were the DL5,000 DNA Marker (M2; TaKaRa, Cat#3428A) and 1kb DNA Ladder (Dye Plus)(M2; TaKaRa, Cat#3426A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager.
First we construct the tcdA1 device in pSB1A2. Our target fragments can be clearly seen in the right position (figure 4). As the fragment is a little big(7.2k), the efficiency is low when we change the backbone to pSB1C3 and the unwanted fragment is hard to explain(figure 5).
Figure 4 digestion confirmation of device tcdA1 in pSB1A2 backbone.
Figure 5 digestion confirmation of device tcdA1 in pSB1C3 backbone.
PLASMID SEQUENCING
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 9.7k part shows 100% agreement with the desired sequence.
TOXIN EXPRESSION
BACTERIA CULTURE
The solid or liquid culture medium is LB culture with 34ug/ml chloromycetin and 80mM arabinose.
Both the antibiotics and arabinose are added after the culture cools down to 60℃. 2%(w/v) of agar is added in solid medium.
It can be clearly seen that the recombinant turned red, indicating the expression of reporter mCherry. As mCherry is located behind target gene and shares a promoter with target gene, the target gene may be expressed to a great extent.
Figure 6 expression of reporter mCherry in LB solid medium with arabinose and chloromycetin.
Figure 7 expression of reporter mCherry in LB liqiud medium with arabinose and chloromycetin.
SDS-PAGE
5ul sample is loaded in a 10% SDS-PAGE separation gel. We use 250kDa marker Precision Plus Protein™ Dual Color Standards #161-0374. Parameters can be seen in protocols.
According to the result of SDS-PAGE, target protein(285kDa) is not eyeable(line 2) compared with the negative control, native BL21 (DE3) strain without engineering(line 1). However, the recombinant tcdA1 strain turns red, indicating that it expressed mCherry, which can be confirmed in SDS-PAGE.
There are two possible explanations to the results. One is that the expression level of macro protein like tcdA1 is extremely low, which is unrecognizable in SDS-PAGE. The other is that tcdA1 didn’t express out of unknown reason.
Figure 8 SDS-PAGE results of four devices we constructed.
TERMITES in vivo EXPERIMENTS
BBa_K1668001: metK
Overview
The part metK is the coding sequence of S-adenosylmethionine synthetase in Streptomyces avermitilis. It was found to stimulate the production of avermectins, one kind of pesticide.
This gene sequence could not function in E.coli. If you would like to express metK in Streptomyces avermitilis, remember to add ermEp(BBa_K1668004) as its promoter.
Background
metK is the gene encoding S-adenosylmethionine synthetase, which has been found in almost every organism. Its output catalyzes the formation of S-adenosylmethionine from methionine and ATP.
Function
In Streptomyces avermitilis, metK was found to stimulate the production of avermectins, a kind of pesticide. When wild-type S. avermitilis strain ATCC31267 was transformed with pYJ02 and pYJ03, two metK expression plasmids, avermectin production was increased about 2.0-fold and 5.5-fold compared with that in the control strains, respectively. (1)
Principle
As for the principle of improving the productivity, instead of changing cell growth or copy effect, metK stimulates the avermectin production by increasing the intracellular concentration of S-adenosylmethionine (SAM), an important intermediate product in avermectin production. However, there may be a maximum concentration of SAM for the production of avermectin in S. avermitilis, which means that SAM has no effect when its concentration achieve maximum.
Limitation
The results of experiments in research paper showed that different metK expression levels have different influence on avermectin production in various S. avermitilis strains. The gene expression levels of metK in two engineered strain, GB-165 and 76-05, were much higher than those in wild-type strain, whereas the avermectin productivity in these two strains have not been significantly improved.(1) It is probably because the high expression level of metK in engineered strains limited the improvement of avermectin productivity by overexpression of metK.
Protein
The 3D structure of S-adenosylmethionine synthetase is as follows. This enzyme catalyzes the formation of S-adenosylmethionine from methionine and ATP and is involved in step1 of the subpathway that synthesizes S-adenosyl-L-methionine from L-methionine.
Fig.1 the 3D structure of S-adenosylmethionine synthetase (Uniprot #: Q3HW35)
Construction
PCR
The metK gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.
By PCR with primers metK1 and metK2 shown below, we added the standard prefix and suffix at both ends of the metK sequence.
Seamless assembly
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
metK1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGTTCGGCTACGC
metK2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTACAGCCCCACA
Transformation and confirmation
After seamless assembly, standard plasmid pSB1C3 containing metK gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers.
The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
Plasmid map
Fig.2 The plasmid map of BBa_K1668001 metK
Results
Fig.2 The plasmid map of BBa_K1668001 metK
Gel electrophoretic analysis
In Fig.3 (A), it is indicated that metK (816bp) has been successfully amplified by PCR.
In Fig.3 (B), positive clones determined by bacteria solution PCR are indicated.
Fig.3 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B). (A) 5-μl samples of the PCR products for metK, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M1; Takara, Cat#3428A) and DL2,000 DNA Marker (M2; TaKaRa, Cat#3427A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.
DNA sequencing
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 816bp part shows 100% agreement with the desired sequence.
Reference
X. Zhao, Q. Wang, W. Guo, Y. Cai, C. Wang, S. Wang, S. Xiang, Y. Song, Overexpression of metK shows different effects on avermectin production in various Streptomyces avermitilis strains. World journal of microbiology & biotechnology 29, 1869-1875 (2013); published online EpubOct (10.1007/s11274-013-1350-0).
BBa_K1668002: frr
Overview
The part frr is the coding sequence of ribosome recycling factor (RRF) in Streptomyces avermitilis. It was found to promote cell growth and stimulate the production of avermectins, one kind of pesticide.
This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp (BBa_K1668004)(在前面括号里的字上添加超链接)as its promoter.
Background
Function
frr gene encodes the ribosome recycling factor (RRF), which is involved in the release of ribosomes from the translational post-termination complex for a new round of initiation. RRF may increase the efficiency of translation by recycling ribosomes from one round of translation to another. Avermectin yield was increased significantly by 3- to 3.7-fold in transformants 31267(pFRR-1139) and 31267(pFRRerm-1139), compared with that in the wild-type strains and both of the transformants contained multiple frr copies.(1) The avermectin productivity of each culture was quantitatively measured by HPLC analysis.
Principle
Research indicated that frr overexpression promoted cell growth as well as the expression of ave genes (including pathway-specific positive regulatory gene aveR for avermectin biosynthesis and ave structural genes), leading in turn to avermectin overproduction. Different from S-adenosylmethionine synthetase gene (metK), frr gene revealed a ‘‘copy number effect’’. That is to say, multiple copies of frr had a greater promoting effect on avermectin production than a single copy does. However, the detailed mechanism of frr enhancing antibiotic production remains to be clarified.
Limitation
Compared with the wild-type strain, the effect of frr on avermectin production in engineered strains 76-02-e and GB-165 was less obvious, probably because most of the negative stimulatory factors are downregulated and most of the positive factors are upregulated, resulting in relatively limited potential for further improvement of avermectin yield.(1)
Protein
The 3D structure of ribosome recycling factor is as above (Fig.1). This factor is responsible for the release of ribosomes from messenger RNA at the termination of protein biosynthesis. and may increase the efficiency of translation by recycling ribosomes from one round of translation to another.
Fig.1 The 3D structure of ribosome recycling factor
Construction
PCR
The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers frr1 and frr2 shown below, we added the standard prefix and suffix at both ends of the frr sequence.
Seamless assembly
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol(此处应有超链接到protocol页). By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
frr1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGCGCGGGTACGTC
frr2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTACATCAAGGTCGCC
Transformation and confirmation
After seamless assembly, standard plasmid pSB1C3 containing frr gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
Plasmid map
Fig.2 The plasmid map of BBa_K1668002 frr
Results
Fig.2 The plasmid map of BBa_K1668002 frr
Gel electrophoretic analysis
After overnight freeze-drying process, we got the final product CNCs in the end. (Figure 3)
In Fig.3 (A), it is indicated that frr (384bp) has been successfully amplified by PCR. In Fig.3 (B), positive clones determined by bacteria solution PCR are indicated.
Fig.3 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B). (A) 5-μl samples of the PCR products for frr, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M; Takara, Cat#3428A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.
DNA sequencing
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 384bp part shows 100% agreement with the desired sequence.
Reference
L. Li, J. Guo, Y. Wen, Z. Chen, Y. Song, J. Li, Overexpression of ribosome recycling factor causes increased production of avermectin in Streptomyces avermitilis strains. Journal of industrial microbiology & biotechnology 37, 673-679 (2010); published online EpubJul (10.1007/s10295-010-0710-0).
BBa_K1668001: orfX
Overview
The part orfX is a putative membrane-bound putative regulatory gene and its product is a putative membrane protein.
This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp(BBa_K1668004) as its promoter.
Background
Function
The results of PCR analysis and the gene disruption experiments strongly suggest that either a considerably conserved sequence of orfX or a combination of orfX and other assisting genes exists in the high producers. And the orfX product appears to play an essential role in the production and regulation of avermectin in both the normal strain and the high producers. When wild-type S. avermitilis was transformed with a 8.0-kb DNA fragment containing the orfX gene, avermectin production increased approximately 3.5-fold.(1) However, the nature of the stimulatory effect of orfX is still unclear.
Principle
The orfX gene reveals a “copy number effect”. That is to say, multiple fragment copies can substantially increase avermectin production in S. avermitilis. Different from metK and frr gene, the DNA fragment containing orfX gene also increased avermectin bio-synthesis in various S. avermitilis strains, including the high-producing mutant strain ATCC 31780 and a semi-industrial strain L-9. (1)
Construction
PCR
The orfX gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers orfX1 and orfX2 shown below, we added the standard prefix and suffix at both ends of the metK sequence.
Seamless assembly
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in ourProtocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
orfX1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGGTGAGCGCCT
orfX2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTATCTGCGGTCC
Transformation and confirmation
After seamless assembly, standard plasmid pSB1C3 containing orfX gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
Plasmid map
Fig.1 The plasmid map of BBa_K1668003 orfX
Results
Fig.1 The plasmid map of BBa_K1668003 orfX
Gel electrophoretic analysis
In Fig.2 (A), it is indicated that orfX (942bp) has been successfully amplified by PCR.
In Fig.2 (B), positive clones determined by bacteria solution PCR are indicated.
Fig.2 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B). (A) 5-μl samples of the PCR products for orfX, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M1; Takara, Cat#3428A) and DL2,000 DNA Marker (M2; TaKaRa, Cat#3427A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.
DNA sequencing
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 942bp part shows 100% agreement with the desired sequence.
Reference
Y. S. Hwang, E. S. Kim, S. Biro, C. Y. Choi, Cloning and Analysis of a DNA Fragment Stimulating Avermectin Production in Various Streptomyces avermitilis Strains. Applied and environmental microbiology 69, 1263-1269 (2003)10.1128/aem.69.2.1263-1269.2003).
BBa_K1668001 ermEp
Overview
ermEp is a strong constitutive promoter in various S. avermitilis strains. It should be noticed that ermEp can only be expressed in S.avermitilis strains instead of Escherichia coli or any other chassis.
Background
The ermE promoter was originally characterised by cloning the entire putative promoter region upstream of the ermE gene of Saccharopolyspora erythraea in front of a kanamycin resistance gene (neo) in a replicative vector in Streptomyces lividans TK24.
The ermE promoter region contains two different promoters, ermEp1 and ermEp2. It was reported that a TGG deletion in the 35 region of the ermEp1 promoter resulted in a stronger variant called ermE* (ermEp2 and ermEp1 ΔTGG).(1) The promoter strength was indirectly assessed according to the enzymatic activity of the reporter protein GUS. The ermE and ermE* promoters were approximately 1.8 times stronger than the ermEp1 and ermEp1* promoters. However, no significant difference was detected between the strengths of the native ermE promoter and its variant ermE* or between the ermEp1 and the ermEp1* promoter.(2)
Construction
PCR
The ermEp gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers ermEp1 and ermEp2 shown below, we added the standard prefix and suffix at both ends of the metK sequence.
Seamless assembly
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol(此处应有超链接到protocol页). By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
ermEp1 (F, 5’-3’): ATTCGCGGCCGCTTCTAGAGGGCGGCTTGCGCC
ermEp2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATACCAACCGGCACGAT
Transformation and confirmation
After seamless assembly, standard plasmid pSB1C3 containing ermEp gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
Plasmid map
Fig.1 The plasmid map of BBa_K1668004 orfX
Results
Fig.1 The plasmid map of BBa_K1668004 orfX
Gel electrophoretic analysis
In Fig.2 (A), it is indicated that ermEp (155bp) has been successfully amplified by PCR. In Fig.2 (B), positive clones determined by bacteria solution PCR are indicated.
Fig.2 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B). (A) 5-μl samples of the PCR products for ermEp, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M; Takara, Cat#3428A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.
DNA sequencing
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 155bp part shows 100% agreement with the desired sequence.
Reference
1. T. Siegl, B. Tokovenko, M. Myronovskyi, A. Luzhetskyy, Design, construction and characterisation of a synthetic promoter library for fine-tuned gene expression in actinomycetes. Metabolic engineering 19, 98-106 (2013); published online EpubSep (10.1016/j.ymben.2013.07.006).
2. M. J. Bibb, J. White, J. M. Ward, G. R. Janssen, The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site. Molecular microbiology 14, 533-545 (1994); published online EpubNov (
Then, after centrifugation, we prepared the CNC Suspension. We used red laser pointer to irradiate DI water and the CNC Suspension, respectively, and only the CNCs forms the Tyndall effect, which proved the existence of CNCs conveniently. (Figure 2)
Figure 2 CNC suspension
Freeze-drying to get final product
After overnight freeze-drying process, we got the final product CNCs in the end. (Figure 3)
Figure 3 Solid CNCs
Thermal Gravimetric Analyzer (TGA)
TGA was carried out to observe the thermal characteristics of the CNCs (Figure 4). Evaporation of water led to the first stage of gradual weight loss. The onset temperature which CNCs began to degrade was around 223 ℃. The most obvious weight loss occurred at 393 ℃ while the literature value is 313 ℃[1], indicating the high thermal stability of CNCs we made.
Figure 4 TGA analysis of CNCs
TEM and SEM observation
The pure CNC will crystallize in aqueous solutions and thus forming a square shape (Figure 5), which can be a standard to recognize whether bacteria are embedded in the CNC.
Figure 5 TEM images of CNCs
In the Figure 6a, 6b taken under TEM, it’s obvious that the fibers of CNC are attached to the surface of E.coli, which reveals that the CNCs have successfully wrapped E.coli. Meanwhile the profile of CNCs has been displayed in Figure 6c, its sphere is extremely smooth while that of CNCs with E.coli is relatively rough. The red arrow of Figure 6d clearly indicates the location of E.coli.
Figure 6 TEM and SEM observation with E.coli
In same process, we observed the embedding situation of Streptomycete as well. In the Figure 7b, different from the pure Streptomycete which has smooth fibers (Figure 7a), the embedding in CNCs results in Streptomycete’s surface having abundant granular substance (CNCs). On the other hand, the size of Streptomycete colony were extremely expanded after the embedding in CNCs (Figure 7c, 7d), which further revealed the success of embedding.
Figure 7 TEM and SEM observation with Streptomycete
The images of Figure 8 show the growth of the CNC fibers. During the freeze-drying process, water infiltrated into the CNCs microspheres and formed multiple hydrogen bonds with CNCs, which caused the formation of mischcrystal under low temperature and had a structure of three-dimensional network. Water sublimated during freeze-drying so the porous CNCs skeleton was left. Therefore, we observed that the fibers formed by CNCs became more and more coiled while more and more slimy matters were adhered to the surface of the fibers with the increasing amount of bacteria. These proved the bacteria were embedded into the CNC fibers and had an indirect influence on the features of CNC fibers.
Figure 8 CNC fibers with E.coli
Dynamic Light Scattering (DLS)
The Figure 9 reveals the embedding situation of E.coli with CNCs. E represents the pure E.coli. 4 h-CNC-E represent the microsphere of E.coli with CNCs. CNC is the microsphere with E.coli which has been stored in 4 ℃ for 20 days, and we guess the E.coli are dead and the CNC shell collapsed inward.
Figure 9 Dynamic Light Scattering of E, CNC and 4 h-CNC-E
The Figure 9 indicates that 4 h-CNC-E occurs obviously self-assembly in general. The average particle sizes of each kind of compound are shown on the Table 1.
Through simple subtraction, we can get the thickness of CNC on the surface of E.coli:
Thickness = (1513.8 – 1317.1)/2 = 0.9835 nm
Reference
1 Zhou, J. et al. Synthesis of multifunctional cellulose nanocrystals for lectin recognition and bacterial imaging. Biomacromolecules 16, 1426-1432, doi:10.1021/acs.biomac.5b00227 (2015).
