Difference between revisions of "Team:Mingdao/Parts"
| Line 2,475: | Line 2,475: | ||
Muse.Utils.showWidgetsWhenReady();/* body */ | Muse.Utils.showWidgetsWhenReady();/* body */ | ||
Muse.Utils.transformMarkupToFixBrowserProblems();/* body */ | Muse.Utils.transformMarkupToFixBrowserProblems();/* body */ | ||
| − | } catch(e) { | + | } catch(e) { }}); |
</script> | </script> | ||
</body> | </body> | ||
</html> | </html> | ||
Revision as of 01:56, 18 September 2015
*
*
In our project, we cloned two genes, SR and SRPK from the materials kindly gave by Dr. Woan-Yuh Tarn at Academia Sinica in Taiwan. Phosphoserine and arginine (highest nitrogen contents among 20 amino acids) play important roles in fire retardance. We found a novel fire retardant protein, SR protein, through protein database mining. SR proteins are post-translationally phosphorylated by SR protein kinase (SRPK). We co-transformed E. coli BL21 with two vectors simultaneously to express phosphorylated SR proteins.
Serine/arginine-rich splicing factor 1 (SRSF1) is a protein found on chromosome 17 in humans. SRSF1 is also known as alternative splicing factor 1 (ASF1), pre-mRNA-splicing factor SF2 (SF2), which is involved in alternative splicing, mRNA nuclear export and translation. It contains two functional domains. One in the N-terminus is RNA recognition motifs which interact with RNA and splicing factors. The other in the C-terminus is rich in serine and arginine residues (SR domain) and regulate the protein activity through phosphorylation by SR protein kinase.
SRSF protein kinase 1 (SRPK1) is a serine/arginine-rich protein specific kinase, which phosphorylates SR proteins on serine residues in SR domain. It plays an important role in the regulation of SR protein activity. Disorders in SRPK1 may be observed in certain cancer cells.
We cloned the genes of SR and SRPK as well as the composite DNA fragments of Ptac-GST-SR and Pt7-SRPK-His onto the standard backbone of pSB1C3 biobrick.
SR/pSB1C3
Part No.: BBa_K1608000
We designed two primers to amplify the SR genes by PCR, followed by XbaI and PstI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation.
Primers:
1. SR-XbaI-F: 5'- AAAAGGTCTAGATGTCGGGAGGTGGTGTGATTCGTG -3'
2. SR-SpeI-PstI-R: 5'-AAGAAACTGCAGCGGCCGCTACTAGTATTATGTACGAGAGCGAGA -3'
PCR product size: ~785 bp
SRPK/pSB1C3
Part No.: BBa_K1608001
We designed two primers to amplify SRPK1 gene by PCR, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites on the sequence of SRPK1 gene. We’re trying to mutate them to fit the standard biobrick parts.
Primers:
1. SRPK1-EcoRI-XbaI-F: 5'- AAAAGAATTCGCGGCCGCTTCTAGATGGAGCGGAAAGTGCTTGCGCTCCAG -3'
2. SRPK1-SpeI-R: 5'- GGGGGGACTAGTATTAGGAGTTAAGCCAAGGGTG -3'
PCR product size: ~1995 bp
Plasmid map:
In order to express SR and SRPK gene more conveniently, we made two composite biobricks with promoter, RBS and a fusion tag.
GST-SR/pSB1C3
Part No.: BBa_K1608002
We designed two primers to amplify Ptac-GST-SR DNA fragment by PCR from SR/pGEX-2T, followed by XbaI and PstI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. The SR gene is fused with GST tag and driven by Ptac promoter along with a lac operator downstream.
Primers:
1. Ptac (pGEX)-XbaI-F: 5'- GAGGGGTCTAGAGTTTTTGCGCCGACATCATAAC -3'
2. SR-SpeI-PstI-R: 5'- AAGAAACTGCAGCGGCCGCTACTAGTATTATGTACGAGAGCGAGA -3'
PCR product size: ~1572 bp
Plasmid map:
In order to express SR and SRPK gene more conveniently, we made two composite biobricks with promoter, RBS and a fusion tag.
SRPK-His/pSB1C3
Part No.: BBa_K1608003
We designed two primers to amplify Pt7-SRPK1-His DNA fragment by PCR from SRPK/pET-29b, followed by EcoRI and SpeI digestion and ligated to pSB1C3. The plasmid DNA has been checked by colony PCR, restriction enzyme check and sequencing confirmation. However, there’re two PstI sites one XbaI site on the amplified sequence. We’re trying to mutate them to fit the standard biobrick parts. The SRPK1 gene is fused with 6XHis tag and driven by Pt7 promoter along with a lac operator downstream.
Primers:
1. Pt7(pET)-EcoRI-XbaI-F: 5'- AAAAAAGAATTCGCGGCCGCTTCTAGAGCACGATGCGTCCGGCGTA -3'
2. His (pET)-SpeI-R: 5'- AGGGAAACTAGTATCAGTGGTGGTGGTGGTGGT -3'
PCR product size: ~2294 bp
Plasmid map:
(1) PCR of SR, SRPK, Ptac-GST-SR and Pt7-SRPK-His
Lanes:
1. 1kb DNA marker
2. Pt7-SRPK-His: 2294 bp
3. Ptac-GST-SR: 1572 bp
4. SR: 785 bp
5. SRPK: 1995 bp
(2) Restriction enzyme digestion of inserts and vectors
Lanes:
1. 1kb DNA marker
2. Pt7-SRPK-His: EcoRI + SpeI → 2294 bp
3. SRPK: EcoRI + SpeI →1995 bp
4. pSB1C3: EcoRI + SpeI → 2047 + 1092 bp*
5. Ptac-GST-SR: XbaI + PstI→ 1572 bp
6. SR: XbaI + PstI → 785 bp
7. pSB1C3: XbaI + PstI → 2044 + 1095 bp*
*Bands shifted were caused by the fluorescent DNA loading dye. We confirmed with the specialist and sequenced the plasmid. The plasmids were correct but it bothers us for a long time. Just be very careful to use a ready-to-use fluorescent DNA loading dye.
(3)Colony PCR for SRPK/pSB1C3 and SR/pSB1C3
Left panel: Colony PCR with primers of SRPK1-EcoRI-XbaI-F and VR to check SRPK/pSB1C3 (2162 bp)
Right panel: Colony PCR with primers of SR-XbaI-F + VR to check SR/pSB1C3 (941 bp)
(4)Colony PCR for Ptac-GST-SR/pSB1C3 and Pt7-SRPK-His/pSB1C3
Lane 1 & 17: 1kb DNA marker
Lane 2-8: Colony PCR with primers of Ptac (pGEX)-XbaI-F and VR to check Ptac-GST-SR/pSB1C3 (1731 bp)
Lane 9-16: Colony PCR with primers of Pt7(pET)-EcoRI-XbaI-F and VR to check Pt7-SRPK-His/pSB1C3 (2452 bp)
(5) Restriction enzyme check for SRPK/pSB1C3, SR/pSB1C3 and Pt7-SRPK-His/pSB1C3
Left panel:
1. SRPK/pSB1C3: EcoRI → 4036 bp
2. SRPK/pSB1C3: PstI → 2747 + 1238 + 51 bp
3. 1kb DNA marker
4. SR/pSB1C3: XbaI → 2815 bp
5. SR/pSB1C3: EcoRI + PstI → 2029 + 786 bp
Right panel:
1. Pt7-SRPK-His/pSB1C3: EcoRI → 4326 bp
2. Pt7-SRPK-His/pSB1C3: PstI → 2980 + 1295 + 51 bp
3. 1kb DNA marker
(6) Restriction enzyme check for Ptac-GST-SR/pSB1C3
Lanes:
1. 1kb DNA marker
2. Ptac-GST-SR/pSB1C3: uncut
3. Ptac-GST-SR/pSB1C3: BamHI → 3614 bp
4. Ptac-GST-SR/pSB1C3: EcoRI + PstI → 1581 + 2033 bp
(7) Sequencing data with primers of VF2 and VR
a. SR/pSB1C3 (VF2 & VR)
b. SRPK/pSB1C3 (VF2 & VR)
c. Ptac-GST-SR/pSB1C3 (VF2 & VR)
d. Pt7-SRPK-His/pSB1C3 (VF2 & VR)
In order to express proteins abundantly and efficiently, we transferred the genes of SR and SRPK into two commercial expression vectors of pGEX-2T and pET-29b, respectively.
SR/pGEX-2T
We cloned SR gene with BamHI and XbaI onto pGEX-2T, in which the gene expression is fused with GST tag in the 5’ end and driven under Ptac promoter as well as regulated by lac operator. The pGEX-2T backbone contains lacI repressor gene, pBR322 replication origin and ampicillin resistance cassette (AmpR).
Plasmid map:
SRPK/pET-29b
We cloned SRPK gene with EcoRV and HindIII onto pET-29b, in which the gene expression is fused with 6XHis tag in the 3’ end and driven under Pt7 promoter as well as regulated by lac operator. The pET-29b backbone contains lacI repressor gene, ColE1 replication origin and kanamycin resistance cassette (KanR).
Plasmid map:
DATA
Protein Induction
We co-transformed SR/pGEX-2T and SRPK/pET-29b into E. coli BL21, which expresses T7 RNA polymerase under LacI repressor regulation. The bacteria were cultured in LB media supplemented with ampicillin and kanamycin. IPTG was added when the bacteria grew to OD600 value at 0.6-1.0. And the protein lysates were collected after 4 hours of IPTG induction. SDS-PAGE, Coomassie Blue Staining and Western Blotting were performed through the manufacturers’ instruction.
Coomassie Blue Staining
Lanes of lysates:
1. Control: pGEX-2T & pET-29b
2. SR: SR/pGEX-2T & pET-29b
3. SRPK: pGEX-2T & SRPK1/pET-29b
Result:
SR was expressed at the expected size of 53 kDa. and SRPK was expressed at the expected size of 93 kDa. In addition, free forms of GST were observed at 27 kDa in the lanes 1 & 3.
Western Blotting
(1) SRPK-His protein expression
(2) GST-SR protein expression
Result
GST-SR was detected by anti-GST antibody at the expected size of 53 kDa, as shown in the lanes 2 & 4. It is worth to note that the bands in lane 4 were shifted around 53 kDa, indicating protein modification of GST-SR possibly by SRPK kinase phosphorylation (SR and SRPK exist in the bacteria all together). Moreover, the free forms of GST around 27 kDa were also observed.
Summary
We cloned the genes encoding SR and SRPK to BioBricks (pSB1C3) and expression vectors (pGEX-2T and pET-29b). After protein induction by IPTG in E. coli BL21, the SR and SRPK as well as phosphorylated SR proteins were detected in SDS-PAGE with Coomassie Blue staining and Western Blotting by anti-His antibody and anti-GST antibody. The results showed that we successfully expressed phosphorylated SR proteins in E. coli bacteria by transformed with SR/pGEX-2T and SRPK/pET-29b.