Difference between revisions of "Team:TU Dresden/Project/Results/amplification"
Rooomiinaaa (Talk | contribs) (Created page with "{{:Team:TU_Dresden/Templates/Menu}} <html> <head> <style> #TueContent table img { width: 250px; display: block; margin-left: auto; margin-right: auto; padding-bo...") |
Rooomiinaaa (Talk | contribs) |
||
| Line 62: | Line 62: | ||
| + | <p style="line-height:1.8">More information about these primers can be found in the following document:</p> | ||
| + | |||
| + | <figure align="center"> | ||
| + | <embed src="https://static.igem.org/mediawiki/2015/1/1e/TU_Dresden_info_primers.pdf" width="800" height="450" type='application/pdf'> | ||
| + | </figure> | ||
</div> | </div> | ||
</html> | </html> | ||
Revision as of 12:55, 18 September 2015
Amplification of HER2 fragment
The amplification of the HER2 framgnet from the Biobrick plasmid pIDTSMART-KAN was performed using the following primers:
subcl_fwd
ATATATGCTAGCGCCGGCAACCAGGAGGTGA
subcl_rev
ATATATCTGCAGCGGCCGCTAGTATTA
More information about these primers can be found in the following document: