|
|
Line 11: |
Line 11: |
| body{ | | body{ |
| background-attachment: fixed; | | background-attachment: fixed; |
− | background-image: url(https://static.igem.org/mediawiki/2015/f/f0/Tianjin_Notebook.jpg); | + | background-image: url(https://static.igem.org/mediawiki/2015/4/4b/Tianjin_team.jpg); |
| background-repeat: no-repeat; | | background-repeat: no-repeat; |
| background-position: 100% 100%; | | background-position: 100% 100%; |
| overflow: hidden; | | overflow: hidden; |
| background-size: 100% 100%; | | background-size: 100% 100%; |
− | margin:0px;
| |
| } | | } |
| #globalWrapper{ | | #globalWrapper{ |
Line 67: |
Line 66: |
| } | | } |
| #content-in{ | | #content-in{ |
− | padding-left:0px; | + | padding-left: 0px; |
− | | + | |
| } | | } |
| .p{ | | .p{ |
Line 78: |
Line 76: |
| color: #fff; | | color: #fff; |
| height: auto; | | height: auto; |
− | font-family: arial; | + | font-family: kalinga; |
| } | | } |
| .main-page .left .nav .navContent li a { | | .main-page .left .nav .navContent li a { |
− | display: block; | + | height:50px; |
| + | line-height:50px; |
| + | padding-up: 3px; |
| + | padding-bottom: 3px; |
| + | padding-left: 35px; |
| + | display: block; |
| color: #fff; | | color: #fff; |
− | line-height: 40px; | + | font-size: 16px; |
− | font-size: 20px;
| + | text-align: left; |
| font-family: arial; | | font-family: arial; |
| } | | } |
Line 92: |
Line 95: |
| background-color: rgba(255,255,255,0.7); | | background-color: rgba(255,255,255,0.7); |
| } | | } |
| + | .clear{clear:both;} |
| .clear{clear:both;} | | .clear{clear:both;} |
| .main-page{ | | .main-page{ |
Line 107: |
Line 111: |
| clip: rect(auto,auto,auto,auto); | | clip: rect(auto,auto,auto,auto); |
| margin: auto; | | margin: auto; |
− | font-family: arial; | + | font-family: kalinga; |
| } | | } |
| .main-page .nav-back{ | | .main-page .nav-back{ |
Line 117: |
Line 121: |
| right: 0px; | | right: 0px; |
| margin-right: 100px; | | margin-right: 100px; |
− | font-family: arial; | + | font-family: kalinga; |
| } | | } |
| .main-page .nav{ | | .main-page .nav{ |
Line 125: |
Line 129: |
| text-align: center; | | text-align: center; |
| font-size: 16px; | | font-size: 16px; |
− | font-family: arial; | + | font-family: kalinga; |
| color: #FFF; | | color: #FFF; |
| height: 58px; | | height: 58px; |
Line 134: |
Line 138: |
| line-height: 58px; | | line-height: 58px; |
| cursor: pointer; | | cursor: pointer; |
− | font-family: arial; | + | font-family: kalinga; |
| } | | } |
| .main-page .nav div:hover{ | | .main-page .nav div:hover{ |
Line 141: |
Line 145: |
| background-color: rgba(255,255,255,0.7); | | background-color: rgba(255,255,255,0.7); |
| color: #181126; | | color: #181126; |
− | font-family: arial; | + | font-family: kalinga; |
| } | | } |
| .main-page .nav div.on{ | | .main-page .nav div.on{ |
| filter: alpha(opacity=10); | | filter: alpha(opacity=10); |
| opacity: 0.9; | | opacity: 0.9; |
− | font-family: arial; | + | font-family: kalinga; |
| } | | } |
| .main-page .right{ | | .main-page .right{ |
Line 180: |
Line 184: |
| background-repeat: no-repeat; | | background-repeat: no-repeat; |
| background-position: center center; | | background-position: center center; |
− | background-color:rgba(255,255,255,0.85); | + | background-color:rgba(255,255,255,0.7); |
| } | | } |
| .main-page .content div{ | | .main-page .content div{ |
Line 186: |
Line 190: |
| height: 610px; | | height: 610px; |
| margin-bottom: 10px; | | margin-bottom: 10px; |
− | font-family: arial; | + | font-family: kalinga; |
| font-size: 22px; | | font-size: 22px; |
| + | |
| + | |
| + | |
| padding-left: 20px; | | padding-left: 20px; |
| color: #000; | | color: #000; |
Line 207: |
Line 214: |
| height: 30px; | | height: 30px; |
| text-align: center; | | text-align: center; |
− | font-size: 18px; | + | font-size: 19px; |
| color: #000; | | color: #000; |
| background-attachment: fixed; | | background-attachment: fixed; |
Line 214: |
Line 221: |
| text-decoration: none; | | text-decoration: none; |
| } | | } |
| + | span a{color: #765c96 !important;} |
| + | span a:hover {color: #ff0000 !important;} |
| table {background: transparent} | | table {background: transparent} |
| .d{ | | .d{ |
− | opacity:0.6; | + | opacity:0.7; |
| } | | } |
| </style> | | </style> |
Line 259: |
Line 268: |
| | | |
| </li> | | </li> |
− | <li id="b2"><a class="note" href="https://2015.igem.org/Team:Tianjin/Project">PROJECT</a> | + | <li id="b2" ><a class="note" href="https://2015.igem.org/Team:Tianjin/Project">PROJECT</a> |
| <ul id="a1" style="display: none;"> | | <ul id="a1" style="display: none;"> |
| <li style="width:0;"></li> | | <li style="width:0;"></li> |
Line 284: |
Line 293: |
| <li><a href="https://2015.igem.org/Team:Tianjin/Modeling?4">PROTEIN EXTRACTION</a></li> </ul> | | <li><a href="https://2015.igem.org/Team:Tianjin/Modeling?4">PROTEIN EXTRACTION</a></li> </ul> |
| </li> | | </li> |
− | <li id="b5"><a href="https://2015.igem.org/Team:Tianjin/Collaborations">COLLABORATIONS</a> | + | <li id="b5"><a href="https://2015.igem.org/Team:Tianjin/Collaborations">COLLABORATIONS</a> <ul id="a7" style="display: none;"> |
− | <ul id="a7" style="display: none;">
| + | |
| <li style="width: 0"></li> | | <li style="width: 0"></li> |
| <li><a href="https://2015.igem.org/Team:Tianjin/Collaborations?1">Tianjin for THU-A</a></li> | | <li><a href="https://2015.igem.org/Team:Tianjin/Collaborations?1">Tianjin for THU-A</a></li> |
| <li><a href="https://2015.igem.org/Team:Tianjin/Collaborations?2">THU-A for Tianjin</a></li> | | <li><a href="https://2015.igem.org/Team:Tianjin/Collaborations?2">THU-A for Tianjin</a></li> |
| <li><a href="https://2015.igem.org/Team:Tianjin/Collaborations?3">NKU for Tianjin</a></li> | | <li><a href="https://2015.igem.org/Team:Tianjin/Collaborations?3">NKU for Tianjin</a></li> |
− | </ul> | + | </ul> |
| + | |
| | | |
| </li> | | </li> |
Line 304: |
Line 313: |
| | | |
| </li> | | </li> |
− | <li class="current" id="b8"><a href="https://2015.igem.org/Team:Tianjin/Notebook">NOTEBOOK</a> | + | <li id="b8"><a href="https://2015.igem.org/Team:Tianjin/Notebook">NOTEBOOK</a> |
| + | |
| </li> | | </li> |
− | <li id="b9"><a href="https://2015.igem.org/Team:Tianjin/Team">TEAM</a> | + | <li class="current" id="b9"><a href="https://2015.igem.org/Team:Tianjin/Team">TEAM</a> |
| <ul id="a6" style="display: none;"> | | <ul id="a6" style="display: none;"> |
| <li style="width: 0px;"></li> | | <li style="width: 0px;"></li> |
Line 319: |
Line 329: |
| </div> | | </div> |
| </div> | | </div> |
− |
| |
− |
| |
| <div class="main-page"> | | <div class="main-page"> |
| | | |
Line 326: |
Line 334: |
| <div class="content-back" id="content-back1"></div> | | <div class="content-back" id="content-back1"></div> |
| <div class="content" id="content1"> | | <div class="content" id="content1"> |
− | <div id="content-in">
| + | <div id="content-in"> <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Wet lab: </span></strong> |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">Receive standard plasmid</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1. Gain standard plasmid</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2. Transformation: </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Result: After 16~24h overnight culturing, sJanus, sJanus-m and inJanus grow colonies about one microns in diameter, evenly distributed. But inJanus-m’ colonies are relatively rare and small. Try to going on to check out</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3. Strain reservation and plasmid extraction</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Results: Four tube plasmid concentration is about 100 ng/uL, suitable for next steps</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">4. Striction Digest </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">I choose Xba I and Pst enzyme </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5. Electrophoresis </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Results: We have strips of about 2000. We can basically ensure correct standard transformation </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">6, DNA gel extraction </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Results: Four tube plasmid concentration is 4.9, 6.0, 9.4, 6.2 ng/uL.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: "Calibri",sans-serif;">Prepare aimed protein DNA</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1. Design primers.<br>
| + | |
− | 2. PCR 50 uL system: </span>
| + | |
− | </p>
| + | |
− | <br>
| + | |
− | | + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">33uL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10Xbuffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5uL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTP</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5uL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Template</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1uL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1uL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="284">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.5+2.5u</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Put in PCR system, set up annealing temperature, recycle and start PCR.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3. Electrophoresis</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Calibri",sans-serif;">Results: Strips of a 200 is aimed proteins. At first time, we set,58,60,62</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: "Calibri",sans-serif;">,but we can’t get aimed band, just a very bright band much smaller than aimed DNA. We think its <a href="C://Users/Administrator/AppData/Local/Yodao/DeskDict/frame/20150812114545/javascript:void(0);"><span style="font-family: arial,helvetica,sans-serif; color: windowtext;">primer</span></a> <a href="C://Users/Administrator/AppData/Local/Yodao/DeskDict/frame/20150812114545/javascript:void(0);"><span style="font-family: arial,helvetica,sans-serif; color: windowtext;">dimer</span></a>, then we set 50,55,60</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: "Calibri",sans-serif;">at second time. We can get aimed DNA from 55-60</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: "Calibri",sans-serif;">.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">4. DAN extraction<br>
| + | |
− | 5. Restriction enzyme digestion<br>
| + | |
− | 6. Electrophoresis<br>
| + | |
− | 7. DAN extraction</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Use the same enzyme as one in aimed DNA.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Connection </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1. Connection<br>
| + | |
− | 2. Transformation<br>
| + | |
− | 3. Plasmid extraction The concentration is 60, 43, 70, 83 ng/mL<br>
| + | |
− | 4. Enzyme digestion <br>
| + | |
− | 5. Electrophoresis</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Result: I repeat 4 times. In first time there aren’t any 200 bond. I suspect it’s something wrong in enzyme digest. And then I use four pair of enzymes to cut it. There is just no 200 bond. At the fourth time, I choose to extend digestion time and smaller enzymes of XbaI and PstI. Then we have two stripes: about 200 and 2000 <a href="C://Users/Administrator/AppData/Local/Yodao/DeskDict/frame/20150812114545/javascript:void(0);"><span style="font-size: 19px; font-family: arial,helvetica,sans-serif; color: windowtext;">molecular</span></a> <a href="C://Users/Administrator/AppData/Local/Yodao/DeskDict/frame/20150812114545/javascript:void(0);"><span style="font-size: 19px; font-family: arial,helvetica,sans-serif; color: windowtext;">weight</span></a>.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">6. Sequencing:</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Almost correct except some wrong sequence in the front of the aimed proteins.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <br/>
| + | |
− | </p>
| + | |
− | </div>
| + | |
− | <div id="content-in"> | + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"><span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">17.05.15</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Transformation FsC-pSB1C3 with DH5α</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">19.05.15</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Inoculation of LB-media with DH5α_FsC-pSB1C3; Overnight incubation at 37°C</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">20.05.15</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Storage the overnight incubated bacteria at -80</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> with glycerin (final concentration is 20%)</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Miniprep of DH5α_FsC-pSB1C3 using the TIANgel Midi Purification Kit</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified plasmid:</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-align:left">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(1): 24.1 ng/µl <br>
| + | |
− | (2): 33.4 ng/µl <br>
| + | |
− | (3): 28.6 ng/µl</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">26.05.15</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR of FsC-pSB1C3 for amplification of FsC</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-indent:0">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">In a sterile 0.5ml microfuge tube, mix in the following order:</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="550">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td class="selectTdClass" style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">ddH<sub>2</sub>O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">68μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">10x Pfu buffer with MgSO<sub>4</sub></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">10μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">dNTP(2.5mM)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">8μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Primer F</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">5μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Primer R</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">5μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Template DNA</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">2μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Pfu DNA polymerase(2.5U/μL)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">2μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="290">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Total volume</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="259">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">100μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left:9px;text-indent:0">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Separate into four sterile 0.5ml microfuge tubes to make 25μL as final volume.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-indent:0">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">The primer F and R showed below:</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-indent:0">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">F: 5’-GAATTCGCGGCCGCTTCTAGATGCTGCCTACTTCTAACCCT-3’</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-indent:0">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">R: 5’-AGAACCTCCACCGCCAGAACCTCCTCCACCAGCAGAACCACGGAC-3’</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-indent:0">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR gradient is 56.4°C, 57.6°C, 60.9°C, 64.4°C.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">27.05.15</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Analysis of PCR products by agarose gel electrophoresis. No</span> <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">bands visible.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Possible reason is the template is not correct, so we extract plasmid again from DH5α.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Inoculation of LB-media with DH5α_FsC-pSB1C3; Overnight incubation at 37°C</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">28.05.15</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Storage the overnight incubated bacteria at -80</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> with glycerin (final concentration is 20%)</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Miniprep of DH5α_FsC-pSB1C3 using the TIANgel Midi Purification Kit </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified plasmid:</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left:9px;text-align:left">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(1): 38.4 ng/µl <br>
| + | |
− | (2): 62.9 ng/µl </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR of FsC-pSB1C3 for amplification of FsC</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Improve the system of PCR:</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">System I:</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">ddH<sub>2</sub>O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">66μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">10x Pfu buffer with MgSO<sub>4</sub></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">10μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">dNTP(2.5mM)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">10μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Primer F</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">5μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Primer R</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">5μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Template DNA</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">2μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px; word-break: break-all;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">pfu DNA polymerase(2.5U/μL)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">2μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="331">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Total volume</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="203">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">100μL</span>
| + | |
− | </p>
| + | |
− |
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">System I:</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td class="selectTdClass" style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">ddH<sub>2</sub>O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">66μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">10x Pfu buffer with MgSO<sub>4</sub></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">10μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">dNTP(2.5mM)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">10μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">DMSO</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">6μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">Primer F</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">5μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">Primer R</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">5μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">Template DNA</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">2μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">pfu DNA polymerase(2.5U/μL)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">2μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">Total volume</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td class="selectTdClass" style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px">100μL</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align:center">
| + | |
− |
| + | |
| </p> | | </p> |
− | <p>
| |
− | <br/>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Improve the efficiency of PCR by decreasing annealing temperature. Annealing gradient is 50.1°C, 55.4°C, 60.6°C, 64.5°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">29.05.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/8/87/Tianjin_fsc_1.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 1.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>Trans2K</em> DNA Marker). a to d are PCR products of System I, Template DNA(1), annealing gradient in an increasing order. e to h are PCR products of System I, Template DNA(2), annealing gradient in an increasing order. i to l are PCR products of System II, Template DNA(1), annealing gradient in an increasing order. m to o are PCR products of System II, Template DNA(2), annealing gradient in an increasing order.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Only the PCR product of System II, Template DNA(1), annealing temperature is 50.1°C has band at 650bp. </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: 8.7ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR of PCR product for amplification of FsC</span>
| |
− | </p>
| |
− | <p style="margin-left:9px">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Use System II and decrease annealing temperature. Annealing gradient is 48.3°C, 49.1°C, 50.6°C, 52.4°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/8/81/Tianjin_fsc_2.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:34px;margin-bottom:16px;margin-left:25px;text-align: center;text-indent:15px">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 2.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>Trans2K</em> DNA Marker). a to d are PCR products of FsC.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: 65.5ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR for amplification of four types of Jauns (sJanus, sJanus-m, inJanus, inJanus-m)</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/6/6e/Tianjin_fsc_3.png" title=""/>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/0/08/Tianjin_fsc_4.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 3.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>DL2000</em> DNA Marker). a to d are PCR products of sJanus. e to h are PCR products of sJanus-m. i to k are PCR products of inJanus. l to o are PCR products of inJanus-m.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus: 30.2ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-m: 45.5ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus: 58.4ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus-m: 64.6ng/µl</span>
| |
− | </p>
| |
− |
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">15.06.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Restriction digest of pSB1C3 using XbaI and PstI</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">System I</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0">
| |
− | <tbody>
| |
− | <tr class="firstRow">
| |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">ddH<sub>2</sub>O</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">21µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Plasmid</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">3µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Green buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">3µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− |
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">XbaI</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">1.5µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">PstI</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">1.5µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif;color:black">Total volume</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">30µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="text-align:center">
| |
− |
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <br/>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">System II</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0">
| |
− | <tbody>
| |
− | <tr class="firstRow">
| |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">ddH<sub>2</sub>O</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">14µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Plasmid</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">10µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Green buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">3µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">XbaI</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">1.5µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:33px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="33" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">PstI</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="33" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">1.5µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">Total volume</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="277">
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif;color:black">30µl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="text-align: center;">
| |
− |
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Digest at 37°C for 2h.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of restriction digest by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/b/b3/Tianjin_fsc_5.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 4. </span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">The result of agarose gel electrophoresis. M is DNA marker (<em>Trans2K</em> DNA Marker). a is digest product in System I. b is digest product in System II. c is control which is not digested by XbaI and PstI.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">The bands are not in a right place. So we sequence FsC-pSB1C3. The result is no signal. Thus, we transform plasmid again with DH5αto get a correct plasmid.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">08.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Transformation FsC-pSB1C3 with DH5α</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">09.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Inoculation of LB-media with DH5α_FsC-pSB1C3; Overnight incubation at 37°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">10.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Storage the overnight incubated bacteria at -80</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> with glycerin (final concentration is 20%)</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Miniprep of DH5α_FsC-pSB1C3 using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified plasmid:</span>
| |
− | </p>
| |
− | <p style="text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(1): 118.4 ng/µl </span>
| |
− | </p>
| |
− | <p style="text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(2): 100.8 ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">11.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Restriction digest of pSB1C3 using XbaI and PstI for verification.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of restriction digest by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/7/75/Tianjin_fsc_6.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:34px;margin-bottom:10px;margin-left:25px;text-align:center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 5.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M1 is DNA marker (<em>Trans2K</em> DNA Marker). M2 is DNA marker (<em>Trans8K</em> DNA Marker).a is digest product of FsC-pSB1C3. </span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Overlap PCR of fragment FsC and four types Janus for amplification of fusion fragment</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Annealing gradient is 58.8°C, 61.1°C, 63.0°C and 64.3°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of Overlap PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin: 0px 15px 16px 25px; text-align: center;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/9/96/Tianjin_fsc_7.png" title=""/><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/c/cc/Tianjin_fsc_8.png.png" title=""/></span></strong></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/f/f8/Tianjin_fsc_9.png" title=""/>
| |
− | </p>
| |
− | <p style="margin: 0px 15px 16px 25px;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"></span></strong></span><br/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 6.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>Trans2K</em> DNA Marker). a to d are Overlap PCR products of FsC-sJanus. e to h are Overlap PCR products of FsC-sJanus-m. i to l are PCR Overlap products of FsC-inJanus. m to o are Overlap PCR products of FsC-inJanus-m. All the annealing gradient is in an decreasing order.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">12.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus: 92.4ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m: 67.4ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus: 80.5ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m: 75.3ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">14.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Verification of Overlap PCR</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> PCR of fusion fragment for verification fragment FsC and fragment Janus.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin: 0px 15px 16px 25px; text-align: center;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/ea/Tianjin_fsc_10.png" title=""/></span></strong></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/b/bd/Tianjin_fsc_11.png" title=""/>
| |
− | </p>
| |
− | <p style="margin: 0px 15px 16px 25px;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"></span></strong></span><br/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 7.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>Trans2K</em> DNA Marker). a to d are PCR products of FsC which use FsC-sJanus, FsC-sJanus-m, FsC-INJANUS, FsC-inJanus-m,as template respectively. e, g, i, k are PCR products of Janus which use FsC-SJANUS, FsC-sJanus-m, FsC-inJanus, FsC-inJanus-m as template respectively. f, h, j, l are PCR products of Janus which use sJanus, sJanus-m, inJanus, inJanus-m as template respectively.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment FsC and four types of Janus can amplify from fusion fragment which means Overlap PCR is successful.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">16.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR of four types fusion fragment for amplification of expression fragment</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">17.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin: 0px 15px 16px 25px; text-align: center;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/2/2d/Tianjin_fsc_12.png" title=""/></span></strong></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/ac/Tianjin_fsc_13.png" title=""/>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/2/2f/Tianjin_fsc_14.png" title=""/>
| |
− | </p>
| |
− | <p style="margin: 0px 15px 16px 25px;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"></span></strong></span><br/>
| |
− | </p><p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 8.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>DL2000</em> DNA Marker). a1 to a4 are PCR products of FsC expression fragment. b1 to b4 are PCR products of FsC-sJanus expression fragment. c1 to c4 are PCR products of FsC -sJanus-m expression fragment. d1 to d4 are PCR products of FsC-inJanus expression fragment. e1 to e4 are PCR products of FsC-inJanus-m expression fragment.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC: 84.6ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus: 78.3ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m: 43.8ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus: 61.6ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m: 48.9ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">18.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Transformation plasmid pET-28a with Trans1-T1</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">19.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Inoculation of LB-media with Trans1-T1_ pET-28a; Overnight incubation at 37°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Storage the overnight incubated bacteria at -80</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> with glycerin (final concentration is 20%)</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Miniprep of Trans1-T1_ pET-28a using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified plasmid:</span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(1): 146.7 ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(2): 139.5ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">20.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Restriction digest of plasmid pET-28a, FsC expression fragment, FsC-sJanus-m expression fragment, FsC-inJanus-m expression fragment using XhoI and EcoRI</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of restriction digest by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-right:15px;text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/1/18/Tianjin_fsc_15.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 9.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M1 is DNA marker (<em>Trans8K </em>DNA Marker). M2 is DNA marker (<em>DL2000</em> DNA Marker). a is restriction digest product of pET-28a. b is restriction digest product of FsC expression fragment. c is restriction digest product of FsC-sJanus-m expression fragment. d is restriction digest product of FsC-inJanus-m expression fragment.</span></span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Ligation of the digested genes (FsC expression fragment, FsC-sJanus-m expression fragment, FsC-inJanus-m expression fragment) into pET-28a.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Transformation ligation products with DH5α</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">22.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Inoculation of LB-media with DH5α_ FsC_pET-28a, DH5α_ FsC-sJanus-m_pET-28a, DH5α_ FsC-inJanus-m_pET-28a; Overnight incubation at 37°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Storage the overnight incubated bacteria at -80</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> with glycerin (final concentration is 20%)</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·<span style="font-family: arial,helvetica,sans-serif; letter-spacing: 0px;">Miniprep of DH5</span></span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; letter-spacing: 0px;">α_ FsC_pET-28a, DH5α_ FsC-sJanus-m_pET-28a, DH5α_ FsC-inJanus-m_pET-28a</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> using the TIANgel Midi Purification Kit</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified plasmid:</span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC_pET-28a (1): 108.4 ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC_pET-28a (2): 138.7ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m_pET-28a (1): 96.8 ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m _pET-28a (2): 114.5ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m _pET-28a (1): 103.7 ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m _pET-28a (2): 125.5ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Verification of ligation product by restriction digest.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of restriction digest by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-right:15px;text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/4/41/Tianjin_fsc_16.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 10.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M1 is DNA marker (<em>DL2000</em> DNA Marker). M2 is DNA marker (<em>Trans8K </em>DNA Marker). a1 is restriction digest product of FsC-inJanus-m _pET-28a (2). a2 is restriction digest product of FsC-inJanus-m _pET-28a (1). b1 is restriction digest product of FsC-sJanus-m _pET-28a (2). b2 is restriction digest product of FsC-sJanus-m_pET-28a (1). c1 is restriction digest product of FsC _pET-28a (2). c2 is restriction digest product of FsC _pET-28a (1).</span></span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Except FsC-inJanus-m _pET-28a (1), all the ligation products are correct through restriction digest. Sequencing DNA of these three kinds recombinant plasmid.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">23.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">The templates of Janus have been confused through the result of sequencing DNA. sJanus-m is confused with SJANUS. inJanus is confused with inJanus-m and eventually we only get FsC-sJanus. We restart from PCR of other three types of Janus.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">31.07.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR for amplification of three types of Janus (sJanus-m, inJanus, inJanus-m)</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">01.08.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-m: 57.5ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">INJANUS: 89.4ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus-m: 77.6ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Overlap PCR of fragment FsC and four types Janus for amplification of fusion fragment</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of Overlap PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/4/4e/Tianjin_fsc_17.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 11.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>DL2000</em> DNA Marker). a1 to a4 are Overlap PCR products of FsC-sJanus-m. b1 to b4 are Overlap PCR products of FsC-INJANUS. c1 to c4 are PCR Overlap products of FsC-inJanus-m.</span></span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">No bands in the b1 to b4 which means the Overlap PCR of FsC-INJANUS are failed. </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Verification of Overlap PCR</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> PCR of fusion fragment for verification fragment FsC and fragment Janus.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">02.08.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/3/3e/Tianjin_fsc_18.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 12.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>Trans2K</em> DNA Marker). a and c are PCR products of FsC which use FsC-sJanus-m, FsC-inJanus-m as template respectively. b and d are PCR products of Janus which uses FsC-sJanus-m, FsC-inJanus-m as template respectively. </span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment FsC and two types of Janus can amplify from fusion fragment which means Overlap PCR is successful.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR of two types fusion fragment for amplification of expression fragment</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of PCR products by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-right:15px;text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/c/c1/Tianjin_fsc_19.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 13.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M is DNA marker (<em>DL2000</em> DNA Marker). a1 to a4 are PCR products of FsC -sJanus-m expression fragment. b1 to b4 are PCR products of FsC-inJanus-m expression fragment. </span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified PCR product: </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m:73.6ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m: 66.4ng/µl</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Restriction digest of pET-28a, FsC-sJanus-m expression fragment, FsC-inJanus-m expression fragment using XhoI and EcoRI</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of restriction digest by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-right:15px;text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/8/8f/Tianjin_fsc_20.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 14.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M1 is DNA marker (<em>Trans8K </em>DNA Marker). M2 is DNA marker (<em>DL2000</em> DNA Marker). a is restriction digest product of pET-28a. b is restriction digest product of FsC-sJanus-m expression fragment. d is restriction digest product of FsC-inJanus-m expression fragment.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·PCR product purification using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Ligation of the digested genes (FsC-sJanus-m expression fragment, FsC-inJanus-m expression fragment) into pET-28a.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Transformation ligation products with DH5α</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">03.08.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Inoculation of LB-media with DH5α_ FsC-sJanus-m_pET-28a, DH5α_ FsC-inJanus-m_pET-28a; Overnight incubation at 37°C</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">04.08.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Storage the overnight incubated bacteria at -80</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> with glycerin (final concentration is 20%)</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">·Miniprep of DH5α_ FsC-sJanus-m_pET-28a, DH5α_ FsC-inJanus-m_pET-28a using the TIANgel Midi Purification Kit</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Nanodrop measurements of the purified plasmid:</span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m_pET-28a (1): 87.4ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-sJanus-m _pET-28a (2): 95.9ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m _pET-28a (1): 125.6ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-left:19px;text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">FsC-inJanus-m _pET-28a (2): 103.4ng/µl </span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Verification of ligation product by restriction digest.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Analysis of restriction digest by agarose gel electrophoresis.</span>
| |
− | </p>
| |
− | <p style="margin-right:15px;text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/0/04/Tianjin_fsc_21.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 15.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> The result of agarose gel electrophoresis. M1 is DNA marker (<em>DL2000</em> DNA Marker). M2 is DNA marker (<em>Trans8K </em>DNA Marker). a is restriction digest product of FsC-sJanus-m_pET-28a (1). b is restriction digest product of FsC-sJanus-m _pET-28a (2). c is restriction digest product of FsC-inJanus-m _pET-28a (1). d is restriction digest product of FsC-inJanus-m_pET-28a (2).</span></span>
| |
− | </p>
| |
− | <p style="margin-top:0;margin-right:15px;margin-bottom:16px;margin-left:25px;text-align: center">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Two ligation products (FsC-sJanus-m_pET-28a (1), FsC-inJanus-m _pET-28a (2)) are correct through restriction digest. Sequencing DNA of these two kinds recombinant plasmid.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">05.08.15</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">The results of sequencing DNA are correct.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">07.08.15</span></strong></span>
| |
− | </p>
| |
− | <p style="text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">·Transformation FsC _pET-28a, FsC-sJanus_pET-28a, FsC-sJanus-m_pET-28a with BL21.</span>
| |
− | </p>
| |
− | <p style="text-align:left">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <br/>
| |
− | </p>
| |
− | </div>
| |
− | <div id="content-in">
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We mixed 200ng of the <strong>target gene sequence-Thc_Cut1</strong>, which is synthesized by IDT Company, with 50ul ddH20, making the final concentration up to 4ng/μl. And then, we divided them into five eppendorf tubes equally. We confirmed the right of sequence of Thc_Cut1 by PCR.</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/d/de/Tianjin_Thc_Cut1.png" title=""/></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">We made sure that 58.8</span><span style="font-size: 19px; line-height: 25%; font-family: "微软雅黑",sans-serif;">℃</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;"> is suitable for amplifying by the PCR of Thc_Cut1 which we have done. Next, <strong>we amplified the gene of Thc_Cut1, sJanus and its mutant sJanus-m by PCR</strong>. In this process, we didn’t do pre-experiment because of the experience of other groups. The temperature of PCR ranges from 55 centigrade to 65 centigrade. The following pictures of gel show that we got the target sequence successfully. (This is the standardized part.)</span></span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><br/></span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/0/0f/Tianjin_Thc_Cut13.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/9/98/Tianjin_Thc_Cut15.png" title=""/>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"></span><br/>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Today, we got the primers of <strong>inJanus and its mutant inJanus-m</strong>. In the experiment, we constructed a gradient of temperature, ranging from 55.7 centigrade to 63.0 centigrade to search for the best condition. The picture of them show that all of them is suitable, but the temperature of 56.9 is the best. And then, we make the target sequence recycled. (This is the standardized part.)</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/4/4d/Tianjin_Thc_Cut17.png" title=""/><img alt="demo.jpg" src="https://2015.igem.org/File:Tianjin_Thc_Cut19.png" title=""/></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">We linked the Thc_Cut1 with sJanus in the third step of overlap.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;"> The following picture shows the reagents we used and the exact amount we added in this system. The condition is the same to the process of our getting the gene of Thc_Cut1- sJanus-m. Using the method of PAGE, we found our target gene sequence and make them recycled.</span></span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Overlap system (100μl)</span>
| |
− | </p>
| |
− | <table align="center" height="199" cellpadding="0" cellspacing="0" width="541">
| |
− | <tbody>
| |
− | <tr class="firstRow" style=";height:20px">
| |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" height="20" valign="top" width="304">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10×Buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="20" valign="top" width="143">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:21px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="304">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="143">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:20px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="20" valign="top" width="304">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Thc_Thc_Cut1 standardized fragment</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px; word-break: break-all;" height="20" valign="top" width="143">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">5μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:21px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="304">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Hydrophobin standardized fragment</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="143">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">5μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:20px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="20" valign="top" width="304">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="20" valign="top" width="143">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:20px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="20" valign="top" width="304">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="20" valign="top" width="143">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">69μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">After the process of pre-PCR, we put the forward and reverse primer to this system, each for 4μl, and then continued the PCR as usual.</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><br/></span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/1/11/Tianjin_Thc_Cut111.png" title=""/></span>
| |
− | </p>
| |
− | <p style="line-height: 1.5em; text-align: center;">
| |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/c/cd/Tianjin_Thc_Cut113.png" title=""/><span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">We confirmed that the final gene sequence is right by PCR. In this process, we use the target sequence we got in above steps as the template DNA. And then, we added the primer and the reverse of <strong>Thc_Cut1, sJanus and sJanus-m </strong>in the PCR system. Using method of PAGE, we can confirmed that these two gene have been linked together correctly. The following picture shows the reagents we used and the exact amount we added in this system.</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">PCR system</span><span style="font-size: 19px; line-height: 25%; font-family: 宋体;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">10μl</span><span style="font-size: 19px; line-height: 25%; font-family: 宋体;">)</span></span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0">
| |
− | <tbody>
| |
− | <tr class="firstRow" style=";height:22px">
| |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" height="22" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10×Buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="22" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:23px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="23" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="23" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:22px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="22" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Forward primer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">0.4μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:23px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="23" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Reverse primer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="23" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">0.4μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:22px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="22" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Overlap fragment</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">0.4μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:23px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="23" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="23" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">0.2μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:22px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="22" valign="top" width="199">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="132">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">6.6μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> </span>
| |
− | </p>
| |
− | <p style="line-height: 1.5em; text-align: center;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/3/3c/Tianjin_Thc_Cut115.png" title=""/><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/6/6e/Tianjin_Thc_Cut116.png" title=""/></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">We used enzymes of XbaI and PstI to digest the product PCR and plasmid, and restored them in the -20 centigrade.</span></strong></span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">restriction enzyme digestion system (30μl)</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0" width="553">
| |
− | <tbody>
| |
− | <tr class="firstRow" style=";height:21px">
| |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" height="21" valign="top" width="144">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="139">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10μl</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="171">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">ddH2o</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="100">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">16μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:22px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="22" valign="top" width="144">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10×Buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="139">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">3μl</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="171">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10×Buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="100">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">3μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:21px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="144">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Xba1</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="139">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1.5μl</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="171">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Xba1</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="100">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1μl</span>
| |
− | </p>
| |
− | </td>
| |
− |
| |
− | </tr>
| |
− | <tr style=";height:22px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="22" valign="top" width="144">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Pst1</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="139">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1.5μl</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="171">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">Pst1</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="22" valign="top" width="100">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:21px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="21" valign="top" width="144">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">DNA(plasmid)</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="139">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">14μl</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="171">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">DNA(PCR fragment)</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="21" valign="top" width="100">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;"> </span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">We used T4 DNA ligase to connect the gene coding Thc_Cut1- sJanus with the plasmid of pSB1C3.</span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;"> In this experiment, the amount of product is about 5 times of plasmid.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> The following picture shows the reagents we used and the exact amount we added in the system of connection.</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">connection system</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0">
| |
− | <tbody>
| |
− | <tr class="firstRow" style=";height:1px">
| |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">10×Buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">2 μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:1px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">T4 ligase</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">1 μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:1px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">plasmid</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">X μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr style=";height:1px">
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">fragment</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="1" valign="top" width="195">
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">5x μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;"> </span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">There are bacterial colony in the selective medium containing chloramphenicol. We selected three of them everyone, added into the tubes containing LB. And then, we incubated them in the shaker at the temperature of 37 centigrade overnight.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> When incubated overnight, we measured OD to judge whether the cells could be used to <strong>extract plasmid</strong>. We selected the suitable ones, and extracted the plasmid. And then, we used enzymes of Xba1 and Pst1 to digest some of them. The total volume of enzyme digest is 10μl. Using the method of PAGE, we know that the plasmid connected with Thc_Cut1- sJanus-m may be right. We sent our sample to company, using the technique of Solexa to check it.</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/ab/Tianjin_Thc_Cut118.png" title=""/></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">We used the standardized gene as the template DNA to amplify the <strong>gene of expression</strong>. In this process, we also got the sequence of Thc_Cut1 which can be transferred and secret. The following picture of gel shows that we have got our target sequence successfully. The temperature of PCR is 60 centigrade.</span>
| |
− | </p>
| |
− | <p style="text-align: center; line-height: 1.5em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/6/6e/Tianjin_Thc_Cut121.png" title=""/></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;">We added 5μl of the bacterial containing the plasmid of pET28a(+) to 5mL of LB, which contains 5μl of ampicillin. And then, we incubated them at the shaker overnight.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> We exacted the plasmid and used enzymes of EcoR1 and Xho1 to digest it. In this process, the total volume of this system is 20μl. We also did the same to the target sequence and the total volume is 30μl. After finishing above all, we used gel electrophoresis to test and make the gene recycled.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: arial,helvetica,sans-serif;"> <strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">We connected the gene coding Thc_Cut1, Thc_Cut1- sJanus, Thc_Cut1- sJanus-m, Thc_Cut1- inJanus and Thc_Cut1- inJanus-m with plasmid of pET28a(+). </span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px; line-height: 25%;">The reagents and amount we used are same to above. The total volume of this system is 20μl. Finally, we transferred them into competent cells and incubated overnight.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> When incubated overnight, there are bacterial colonies in the selective medium contain ampicillin. We selected two of them and added into LB. Finally, we incubated them overnight. In this process, we can judge whether the plasmids we constructed are right by enzyme digesting.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; line-height: 25%; font-family: arial,helvetica,sans-serif;"> When incubated overnight, we measured OD to judge whether the cells could be used to <strong>extract plasmid</strong>. We selected the suitable ones, and extracted the plasmid. And then, we used enzymes of EcoR1 and Xho1 to digest some of them. The total volume of enzyme digest is 10μl. Using the method of PAGE, we know that the plasmid connected with Thc_Cut1 and Thc_Cut1- sJanus-m may be right. We sent our sample to company, using the technique of Solexa to check them.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <br/>
| |
− | </p>
| |
− | </div>
| |
− |
| |
− | <div id="content-in">
| |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">5.27 Get the PCR products of four basic parts.</span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Molecular cloning & Protein expression: </span></strong> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/2/20/Tianjin_LC1.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 1.</span></strong><span style="font-family: "Arial",sans-serif;"> We got the PCR products of injanus, sjanus and sjanus-m. However, for some unknown reason, we didn’t get the PCR products of injanus-m. Although we had set temperature gradient as figure 1 showed.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.11 overlap PCR </span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Ketong Shao, Jiashu Liu, Chenmao Wang, Yuwei Zhang, Junjie Yu, Yang Wang, Xuan Han, Yuchen Li, Haofeng Wang, Junjie Zong, Jinxin Hu, Qing Zhao, Dongqi Bao. |
| + | <br>More detailed attribution about each part could be found in <a href="https://2015.igem.org/Team:Tianjin/Parts?1">Team Parts. </a></span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Neo-Protein Design:</span></strong> |
| </p> | | </p> |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/b/ba/Tianjin_LC2.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 2.</span></strong><span style="font-family: "Arial",sans-serif;"> In order to get the final parts which used to express protein. We did overlap PCR to get LC-sjanus, LC-injanus-m and LC-injanus-m. The detailed protocols can be seen as follow.</span></span>
| |
− | </p>
| |
− | <p class="MsoListParagraph" style="margin-left: 24px; text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">PCR system</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">(</span><span style="font-size:19px;font-family:'Arial',sans-serif">100μl</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">)</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| |
− | <tbody>
| |
− | <tr class="firstRow">
| |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="146">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Buffer</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">10μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">dNTPS</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">LC fragment</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">3μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">sJanus fragment</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">3μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Pfu enzyme</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">2μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">ddH2O</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| |
− | <p class="MsoListParagraph" style="text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">70μl</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p class="MsoListParagraph" style="margin-left: 24px; text-align: center; text-indent: 0px;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Add two kinds of primer (2μl) after 5 cycle.</span>
| |
− | </p>
| |
− | <p class="MsoListParagraph" style="margin-left: 24px; text-align: center; text-indent: 10px;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif">5 cycles</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| |
− | <tbody>
| |
− | <tr class="firstRow">
| |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">95</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">5min</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">95</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">30s</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">1</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">:</span><span style="font-size: 19px;font-family:'Arial',sans-serif">58.8</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">2</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">:</span><span style="font-size: 19px;font-family:'Arial',sans-serif">61.1</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">3</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">:</span><span style="font-size: 19px;font-family:'Arial',sans-serif">64.3</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">30s</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">72</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">2min30s</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">72</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">10min</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">4</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Forever</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"> 35 cycles</span>
| |
− | </p>
| |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| |
− | <tbody>
| |
− | <tr class="firstRow">
| |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">95</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">5min</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">95</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">30s</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">1</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">:</span><span style="font-size: 19px;font-family:'Arial',sans-serif">58.8</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">2</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">:</span><span style="font-size: 19px;font-family:'Arial',sans-serif">61.1</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">3</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">:</span><span style="font-size: 19px;font-family:'Arial',sans-serif">64.3</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">30s</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">72</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">2min30s</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">72</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">10min</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | <tr>
| |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">4</span><span style="font-size:19px;font-family:宋体">℃</span>
| |
− | </p>
| |
− | </td>
| |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| |
− | <p class="MsoListParagraph" style="text-align:left;text-indent:0">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Forever</span>
| |
− | </p>
| |
− | </td>
| |
− | </tr>
| |
− | </tbody>
| |
− | </table>
| |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Overlap PCR of LC-sjanus( used in PSB1C3)</span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Our instructor Zefang Wang gives us great help in its design.</span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Super Protein Chip: </span></strong> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/0/0a/Tianjin_LC3.png" title=""/></span>
| + | |
− | </p> | + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 3.</span></strong><span style="font-family: "Arial",sans-serif;"> We tried to do overlap PCR of LC-sjanus used in PSB1C3 first. Then we used this as template DNA to PCR LC-sjanus used in expression.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">In this step, we got very light<strong> </strong><a href="http://www.iciba.com/electrophoresis_strip"><span style="color:windowtext;text-underline:none">electrophoresis strip</span></a> the length of which is about 1200 bp.</span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Heng Chi, Bowen Han, Xuemei Dong, Yuchen Li, Junjie Zong.</span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.12 PCR of LC-sjanus used in expression</span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Stimulated Plastic Degradation: </span></strong> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Junjie Yu, Xuan Han, Jiashu Liu, Qing Zhao.</span> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/6/6f/Tianjin_LC4.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 4.</span></strong><span style="font-family: "Arial",sans-serif;"> Failed. We didn’t get the product. The reason may be that the specificity of the primers was not high.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.13 Restriction digest of LC-injanus, LC-injanus-m and LC-sjanus using EcoR1 and Xhol1</span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Protein Extraction Kit: </span></strong> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Chenmao Wang, Yuwei Zhang, Jinxin Hu, Yang Wang, Haofeng Wang.</span> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/3/31/Tianjin_LC5.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 5.</span></strong><span style="font-family: "Arial",sans-serif;"> Restriction digest of LC-injanus, LC-injanus-m and LC-sjanus using EcoR1 and Xhol1.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.15 verify our PCR products</span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Specially, Dongqi Bao and Ketong Shao didn't belong to a specific group, but they took part in and took charge of all of them. </span> |
| </p> | | </p> |
| + | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"><span style="font-size:19px;font-family:Arial;,sans-serif">All experiments unless specified are all designed and conducted by our team members independently. For those people who gave us precious advice and guidance, we express our great appreciation in <a href="https://2015.igem.org/Team:Tianjin/Team?4">Acknowledgment</a></span></p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Modeling:</span></strong> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/e8/Tianjin_LC6.png" title=""/></span>
| + | |
− | </p> | + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 6.</span></strong><span style="font-family: "Arial",sans-serif;"> In order to prove that the parts we got used in expression is correct, we used LC-injanus, LC-injanus-m, LC-sjanus and LC-sjanus-m as templates to pcr LC and other four basic parts: injanus, injanus-m, sjanus, sjanus-m. The result was partially successful. It is very clear in this figure that all parts have LC, but LC-injanus and LC-injanus-m do not have their other part. It may because that our PCR system 10μis too small.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.16 verify our parts again</span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Protein Extraction: </span></strong> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Hua Wang.</span> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/ee/Tianjin_LC7.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 7.</span></strong><span style="font-family: "Arial",sans-serif;"> This figure shows clearly that LC-sjanus-m, LC-injanus and LC-injanus-m are all correct.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.17 Overlap PCR LC-sJanus (compared with other group adding DMSO )</span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Adsorption:</span></strong> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"> </span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Zexiang Chen.</span> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/1/11/Tianjin_LC8.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 8.</span></strong><span style="font-family: "Arial",sans-serif;"> Failed. We can not see any differences.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.18 change primers</span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Plastic Degradation</span></strong><span style="font-size:19px;font-family: Arial;,sans-serif">:</span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Xiangyu Yin.</span> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/a8/Tianjin_LC9.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 9.</span></strong><span style="font-family: "Arial",sans-serif;"> We changed primers to do overlap pcr but failed.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.22 LC-sJanus overlap pcr </span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">They also took part in wiki editing.</span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Human Practice:</span></strong> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-family: "Arial",sans-serif; font-size: 16px;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/af/Tianjin_LC10.png" title=""/></span>
| + | |
− | </p> | + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 10.</span></strong><span style="font-family: "Arial",sans-serif;"> We changed our pcr system from 50μ to 25μ, and changed cycle times from 5 to 10.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.23 <span style="color:#333333">Colony PCR of LC-sjanus-m and LC-injanus-m after transformation.</span></span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Yige Peng, Xuemei Dong.</span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong> | + | <strong><span style="font-size:19px;font-family:Arial;,sans-serif">Wiki&Design:</span></strong> |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/2/2c/Tianjin_LC11.png" title=""/></span>
| + | |
− | </p> | + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 11.</span></strong><span style="font-family: "Arial",sans-serif;"> Colony PCR. Finally four lanes had light<strong> </strong><a href="http://www.baidu.com/link?url=23XzuSgc2wvhIDfbrjLWydn1bwdnbgpQ0cKa5qY6SxUJpiTJM2AfThHjig1TklZ-icTnXeOtcJzdm_EI5CMCP94DTam_lLp0BPnjgzrB8oQgzS0cAZQiTQUtM3TABY1a" target="_blank"><span style="color: windowtext;">electrophoresis strip</span></a>s. But after enzyme digestion showed that they were all false positive.</span></span>
| + | |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">7.24 <span style="color:#333333">enzyme digestion of LC-sjanus-m and LC-injanus-m after transformation.</span></span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Shubin Li, Qing Zhao, Yifan Zhang, Dongqi Bao.</span> |
| </p> | | </p> |
| <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> | | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;"> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span> | + | <span style="font-size:19px;font-family:Arial;,sans-serif">Specially, Dongqi Bao took charge of modeling, human practice and wiki&design.</span> |
| </p> | | </p> |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/3/35/Tianjin_LC12.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <strong><span style="font-size:16px;font-family:'Arial',sans-serif">Figure 12.</span></strong><span style="font-size:16px;font-family:'Arial',sans-serif"> Failed.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif;color:#333333">Verification</span><span style="font-size:19px;font-family:'Arial',sans-serif"> PCR products of LC-sjanus.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/d/dc/Tianjin_LC13.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 13.</span></strong><span style="font-family: "Arial",sans-serif;"> We verified the correction of LC-sjanus pcr products. The result showed that it was correct.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Amplification PCR of LC-sjanus</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/eb/Tianjin_LC14.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 14.</span></strong><span style="font-family: "Arial",sans-serif;"> We successfully amplified LC-sjanus although the <a href="http://www.baidu.com/link?url=23XzuSgc2wvhIDfbrjLWydn1bwdnbgpQ0cKa5qY6SxUJpiTJM2AfThHjig1TklZ-icTnXeOtcJzdm_EI5CMCP94DTam_lLp0BPnjgzrB8oQgzS0cAZQiTQUtM3TABY1a" target="_blank"><span style="color: windowtext;">electrophoresis strip</span></a>s were light.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 19px; font-family: "Arial",sans-serif;">7.28 Enzyme digest LC-sjanus <br/></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size: 16px; font-family: "Arial",sans-serif;"></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/b/b5/Tianjin_LC15.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 15.</span></strong><span style="font-family: "Arial",sans-serif;"> LC- janus after Enzyme digestion using EcoR1 and Xhol1.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"> 7.29 PCR of <span style="color:#333333">Standardized fragment </span></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/4/48/Tianjin_LC16.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 16.</span></strong><span style="font-family: "Arial",sans-serif;"> We succeeded to get LC-injanus and LC-injanus-m but failed to get LC-sjanus.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif;color:#333333">enzyme digestion of LC-sjanus-m and LC-injanus-m after transformation</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/eb/Tianjin_LC17.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 17.</span></strong><span style="font-family: "Arial",sans-serif;"> Succeeded</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.1 <span style="color:#333333">enzyme digestion of LC-sjanus after transformation into PET-28a</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-family: "Arial",sans-serif; font-size: 16px;"></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/7/79/Tianjin_LC18.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 18.</span></strong><span style="font-family: "Arial",sans-serif;"> Failed. The reason may be the ratio of plasmid and LC-sjanus was not suitable. So we considered to change the ratio from 1:5 to 1:10.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.03 Overlap PCR of LC-sjanus(Standardized fragment)</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/3/3c/Tianjin_LC19.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 19.</span></strong><span style="font-family: "Arial",sans-serif;"> It was clear that we failed.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.04 enzyme digestion of standardized fragment using Xba1 and Pst1.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/2/20/Tianjin_LC20.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 20.</span></strong><span style="font-family: "Arial",sans-serif;"> Enzyme digestion of standardized fragment and PSB1C3.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">enzyme digestion after transforming LC-sjanus and LC-injanus into PET-28a.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">We tried many times but all failed. We can’t find the reason.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">In follow figures, our parts should be about 1200bp length if we had.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.05</span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/6/67/Tianjin_LC21.png" title=""/></span>
| |
− | </p>
| |
− | <p style=" text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 21</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.06</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <em><span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/f/fb/Tianjin_LC22.png" title=""/></span></em>
| |
− | </p>
| |
− | <p style=" text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 22</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.08</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/aa/Tianjin_LC23.png" title=""/></span>
| |
− | </p>
| |
− | <p style=" text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 23</span></strong></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.16 enzyme digestion after transforming LC-sjanus-m into PSB1C3.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/f/ff/Tianjin_LC24.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 24. </span></strong><span style="font-family: "Arial",sans-serif;">Succeeded. And the after DNA Sequencing results showed it was correct. The standardization of LC-sjanus-m was completed.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">enzyme digestion after transforming LC-sjanus into PET-28a.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/1/1f/Tianjin_LC25.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-indent: 58px; text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 25. </span></strong><span style="font-family: "Arial",sans-serif;">Failed</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.18 enzyme digestion after Single colony of LC-sjanus again.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/0/0e/Tianjin_LC26.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 26. </span></strong><span style="font-family: "Arial",sans-serif;">Failed. Because of lack of fragment and failing many times, we decided to stop any work of LC-sjanus.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">8.20 enzyme digestion after transforming LC-injanus and LC-injanus-m into PSB1C3.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/b/ba/Tianjin_LC27.png" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 27. </span></strong><span style="font-family: "Arial",sans-serif;">succeeded. But the third lane of LC-injanus may lost the part of injanus. This situation also can be seen in other cloning group. It may due to the mispairing of fragment and plasmid or nonspecific binding when doing PCR.</span></span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">Summary: We managed to complete the standardization of LC-sjanus-m, LC-injanus and LC-injanus-m except LC-sjanus. And we finally decided to give up LC-sjanus.</span>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif">Protein expression</span></strong>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif">LC using</span></strong><span style="font-size:19px;font-family:'Arial',sans-serif"> N</span><strong><span style="font-size:19px;font-family:'Arial',sans-serif">-terminal 6Xhis tag</span></strong>
| |
− | </p>
| |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif"></span></strong>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img src="https://static.igem.org/mediawiki/2015/a/a0/Tianjin_LC28.png" alt="demo.jpg" width="600" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align: center;">
| |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/9/94/Tianjin_LC29.png" width="600" title=""/></span>
| |
− | </p>
| |
− | <p style="text-align:center">
| |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 1 and figure 2. </span></strong><span style="font-family: "Arial",sans-serif;">A is broth before inducing<br>
| |
− | B is broth after inducing<br>
| |
− | C is the Precipitation of broken bacteria<br>
| |
− | D is the liquid flowing through the Ni column<br>
| |
− | E is medium in the column<br>
| |
− | F is the MCAC 20 flowing through the Ni column<br>
| |
− | G is the medium in the column after being washed by MCAC 20<br>
| |
− | H is the MCAC 30 flowing through the Ni column<br>
| |
− | I is the medium in the column after being washed by MCAC 30<br>
| |
− | J is the MCAC 50 flowing through the Ni column
| |
− | <br>
| |
− | K is the medium in the column after being washed by MCAC 50<br>
| |
− | L is the MCAC 100 flowing through the Ni column
| |
| | | |
− | <br> | + | <p> |
− | N is the medium in the column after being washed by MCAC 100
| + | <br/> |
− | | + | |
− | <br> | + | |
− | O is the MCAC 200 flowing through the Ni column
| + | |
− | <br>
| + | |
− | | + | |
− | | + | |
− | P is the medium in the column after being washed by MCAC 200<br>
| + | |
− | | + | |
− | Q is the MCAC 500 flowing through the Ni column<br>
| + | |
− | | + | |
− | R is the medium in the column after being washed by MCAC 500<br>
| + | |
− | S is the protein sample washed down by MCAC 100<br>
| + | |
− | T is the protein sample washed down by MCAC 200</span>
| + | |
| </p> | | </p> |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | </div> |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">If we successfully expressed LC, it should be about 36KDa. It is clear that LC was not expressed with N-terminal 6xhis tag, so we decided to change expression plasmid which expresses protein with N</span> <span style="font-size:19px;font-family:'Arial',sans-serif;color:#333333">–</span><span style="font-size:19px;font-family:'Arial',sans-serif">terminal GST.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-family: "Arial",sans-serif; font-size: 16px;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/2/26/Tianjin_LC30.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 3. </span></strong><span style="font-family: "Arial",sans-serif;">A is broth before inducing<br>
| + | |
− | B is broth after inducing<br>
| + | |
− | C is supernatant after centrifugation<br>
| + | |
− | D is the Precipitation of broken bacteria<br>
| + | |
− | E is the medium in the column after being washed by 1xPBS<br>
| + | |
− | F is the medium in the column after being handled by Prescission Protease<br>
| + | |
− | G is the protein sample</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">If we successfully expressed LC, it should be about 60KDa for being fused with GST. And in lane D, we had an obvious stripe in a similar position, which means that LC was all expressed as inclusion body. Due to this, we decided to give up the expression of LC.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <strong><span style="font-size:19px;font-family:'Arial',sans-serif">LC-sjanus-m using</span></strong><span style="font-size:19px;font-family:'Arial',sans-serif"> N</span><strong><span style="font-size:19px;font-family:'Arial',sans-serif">-terminal 6Xhis tag</span></strong>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size:19px;font-family:'Arial',sans-serif"></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img src="https://static.igem.org/mediawiki/2015/5/5a/Tianjin_LC35.png" alt="demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px;font-family:'Arial',sans-serif"><img src="https://static.igem.org/mediawiki/2015/b/bf/Tianjin_LC36.png" alt="demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size: 16px;"><strong><span style="font-family: "Arial",sans-serif;">Figure 1 and figure 2. </span></strong><span style="font-family: "Arial",sans-serif;">A is broth before inducing<br>
| + | |
− | B is broth after inducing<br>
| + | |
− | C is the Precipitation of broken bacteria<br>
| + | |
− | D is the liquid flowing through the Ni column
| + | |
− | <br>
| + | |
− | E is medium in the column<br>
| + | |
− | F is the MCAC 20 flowing through the Ni column
| + | |
− | <br>
| + | |
− | G is the medium in the column after being washed by MCAC 20<br>
| + | |
− | | + | |
− | H is the MCAC 30 flowing through the Ni column <br>
| + | |
− | I is the medium in the column after being washed by MCAC 30<br>
| + | |
− | J is the MCAC 50 flowing through the Ni column<br>
| + | |
− | K is the medium in the column after being washed by MCAC 50<br>
| + | |
− | L is the MCAC 100 flowing through the Ni column<br>
| + | |
− | | + | |
− | N is the medium in the column after being washed by MCAC 100
| + | |
− | <br>
| + | |
− | O is the MCAC 200 flowing through the Ni column
| + | |
− | <br>
| + | |
− | P is the medium in the column after being washed by MCAC 200<br>
| + | |
− | Q is the MCAC 500 flowing through the Ni column
| + | |
− | <br>
| + | |
− | R is the medium in the column after being washed by MCAC 500<br>
| + | |
− | S is the protein sample washed down by MCAC 100
| + | |
− | <br>
| + | |
− | T is the protein sample washed down by MCAC 200</span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">If we successfully expressed LC-sjanus-m, it should be about 44KDa. It is clear that LC-sjanus-m was not expressed with N-terminal 6xhis tag. </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <span style="font-size:19px;font-family:'Arial',sans-serif">After we failed to express LC with GST, we stopped all expression work about LC. We hope other teams in the future can find way to manage it</span>
| + | |
− | </p>
| + | |
− | </div>
| + | |
− | | + | |
− | <div id="content-in">
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">Saturday.6.6.2015</span></strong><strong><span style="font-size: 19px;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on PSB1C3</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer: Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP-linker</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Xba1-GFP: 5’-GCTCTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTC</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">GFP-linker: 5’-AGAACCACCACCACCAGAACCACCACCACCTTTGTATAGTTCATC</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">linker-</span><span style="font-size:19px;font-family: 'Arial Unicode MS',sans-serif"> sJanus</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif"> primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">sJanus</span><span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif"> -Pst1 primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">sJanus-m pET28a(+)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align:center">
| + | |
− | <span style="font-size:19px;font-family:'Arial Unicode MS',sans-serif">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <br/>
| + | |
− | </p>
| + | |
− | <p style="text-align: center;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">55</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">58</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">60</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; color: windowtext; border: 1px none windowtext; padding: 0px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP on 55, 58, 60 centigrade worked well.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/9/99/Tianjin_GFP1.jpg" title=""/>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><br/></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 750bp approximately.)</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration: 51.7 ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Monday,7.13.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker-sJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker-sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- sJanus primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus -Pst1 primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus pET28a(+)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2:55℃</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3:58℃</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">60</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus on all centigrades worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/1/13/Tianjin_GFP2.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:70.2ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Monday,7.13.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-m</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker- sJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SJANUS-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- sJanus primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus -Pst1 primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-m pET28a(+)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">55</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">58</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">60</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-m on all centigrades worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:70.6ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Monday,7.13.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker- inJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- inJanus: 5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">INJANUS-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP_F primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP_R primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP pSB1C3</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:50.1</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:53.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:56.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4:58.5</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus didn’t work well. The electrophoretic bands towing phenomenon is obvious.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><br/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">analyse</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> We suspect is caused by low temperature. So we raise the temperature to conduct the PCR later.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: </span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Tuesday,7.14.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker- inJanus</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- inJanus:</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker- inJanus</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">-Pst1 primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">pET28a(+)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:59.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:65.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:67.0</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:43.5ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">: Tuesday,7.14.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">PCR on pET28a(+)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">linker-inJanus-m</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker-inJanus-m:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTCTACCACTGGC</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">linker-inJanus-m primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">-Pst1 primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus-m pET28a(+)</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:59.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:65.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:67.0</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m on these three centigrades worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> <img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:55.0ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SOE PCR</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SOE PCR stands for <em>Splicing by Overlapp Extension PCR</em>. It is a standard overlapp extension procedure, enabling the assembly of genes wihtout performing any cloning, digesting or ligation inbetween. All you need to do ist running PCRs with specific primers. If gene A is the upstream part and gene B has to be assembled downstream of gene A, primer lo of gene A should have an overlapp of around 20 nucleotides complementary to the first 20 nucleotides of gene B. Primer up of gene B should haven a complementary overlapp of 20 nucleotides to the end of gene A.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP- sJanus</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">temperature: 53, 55, 56, and 58 centigrade.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | | + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">GFP fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">69μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Add two kinds of primer (1μl) after 5 cycle.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus for SOE</span> <span style="font-size: 19px; font-family: arial;,sans-serif;">PCR with PSB1C3 worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:32.2ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SOE PCR</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP-sJanus-m</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus -Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">temperature</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> 53, 55, 56, and 58 centigrade.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">GFP fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-m fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">69μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Add two kinds of primer (1μl) after 5 cycle.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-m for SOE</span> <span style="font-size: 19px; font-family: arial;,sans-serif;">PCR with PSB1C3 worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration: 30.5ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SOE PCR</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP- sJanus</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;"> temperature</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> 55, 56.3 ,57.8 and 58.9 centigrade.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | | + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">GFP fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | | + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">69μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Add two kinds of primer (1μl) after 5 cycle.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">55</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56.3</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">57.8</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">58.9</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus for SOE PCR with PSB1C3 worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:31.1ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date</span></strong><strong><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Wednesday,7.15.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">SOE PCR</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP-inJanus</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">Xba1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-Pst1</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;"> temperature</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;"> 55, 56.3 ,57.8 and 58.9 centigrade.</span></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">GFP fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">inJanus-m fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">69μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Add two kinds of primer (1μl) after 5 cycle.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">55</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56.3</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">57.8</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">58.9</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"> <span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">-</span><span style="font-size: 19px; font-family: arial;,sans-serif;">inJanus-m for SOE</span> <span style="font-size: 19px; font-family: arial;,sans-serif;">PCR with PSB1C3 worked</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration:50.3ng/μL</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"> <strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Thursday,7.16.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">restriction enzyme digestion</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">After qualitative agarose gel electrophpresis, all the target sequence are 1000bp approximately.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fragment concentration: sJanus is 6.9ng/μL, sJanus-m is 15.3ng/μL, inJanus is 4.6ng/μL, inJanus-m is 7.0ng/μL.</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Friday,7.17.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We used T4 DNA ligase to connect them at the temperature of 22 centigrade about an hour. </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Transformed the expression vectors we had already connected into the <em>Escherichia coli </em>DH5α, then incubated the bacteria for 12h (37</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: arial;,sans-serif;">).</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Date:Saturday,7.18.2015</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Enzymes cut each, but they did not work.</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 8000bp, and following is 8000, 5000, 3000,1500,1000and 500bp from up and down, our target sequence is about 1000bp approximately. But the bands in this figure are all about 5000bp, so we suspect that the fragments are not connected to plasmid.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Analyse</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The fragments are not connected to plasmid.</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Sunday,7.19.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We chose another DH5α and trans</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">formed again.</span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Monday,7.20.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Enzyme cut, </span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Tuesday,7.21.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We design another kind of primer and reverse which contain EcoRI and XhoI site. We have got the standard GFP-sJanus and GFP-sJanus-m fragments, and we got the target fragments used to construct the expression vector by PCR.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">gene of interst</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">EcoR1-GFP-sJanus -Xho1</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">EcoR1-GFP-sJanus-m-Xho1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">primer</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">EcoR1-GFP</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">sJanus-Xho1</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">EcoR1-GFP: 5’-CGGAATTCATGCGTAAAGGAGAAGAACTT</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-Xho1: 5’-CCGCTCGAGTCAAGCACCGACGGCC</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">PCR system</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">50μl</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">EcoR1-GFP primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus-Xho1 primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Xba1-GFP-sJanus -Pst1/ Xba1-GFP-sJanus-m-Pst1</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">cycle</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0" width="269">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid black; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: black black black -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">1:55.4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">2:56.6</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">3:57.8</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4:60.3</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color black black; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" align="center" valign="middle" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color black black -moz-use-text-color; padding: 0px 7px;" align="center" valign="middle" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">qualitative agarose gel electrophpresis</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">:</span><span style="font-size: 19px; font-family: arial;,sans-serif;">fragments on these four centigrades all worked well.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="/server/ueditor/upload/image/demo.jpg" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">(</span><span style="font-size: 19px; font-family: arial;,sans-serif;">The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">Electrophoresis</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">of the</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">PCR</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">products</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">was</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;"> </span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext; border: 1px none windowtext; padding: 0px;">identified</span><span style="font-size: 19px; font-family: arial;,sans-serif; color: windowtext;">, and <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">finally</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">PCR</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">product</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">was purified by</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">gel</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">extraction</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">kit</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">to</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">prepare for</span> <span style="font-family: arial,helvetica,sans-serif; border: 1px none windowtext; padding: 0px;">digestion</span>.</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Fragment concentration:EcoR1-GFP-sJanus -Xho1:55.0ng/μL</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">EcoR1-GFP-sJanus-m-Xho1:60ng/μL</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date: Saturday,8.1.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">We used enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We used T4 DNA ligase to connect them at the temperature of 22 centigrade for about one hour. Then we transformed the expression vectors we had already connected into the <em>Escherichia coli </em>DH5α, then incubated the bacteria for 12h (37</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: arial;,sans-serif;">)</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">It has been confirmed that these sequences we get are right when detecting them in company.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px; font-family: arial;,sans-serif;">Date:Monday,8.10.2015</span></strong><strong><span style="font-size: 19px; font-family: arial;,sans-serif;"></span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-size: 19px; font-family: arial;,sans-serif;">Transformed the expression vectors(concentration:140.3ng/μL</span><span style="font-size: 19px; font-family: "Arial Unicode MS",sans-serif;">、</span><span style="font-size: 19px; font-family: arial;,sans-serif;">121.4ng/μL) we had already built before (pET28a(+)) into the <em>Escherichia coli </em>BL21, then incubated the bacteria for 12h (37</span><span style="font-size: 19px; font-family: 宋体;">℃</span><span style="font-size: 19px; font-family: arial;,sans-serif;">).</span></span>
| + | |
− | </p>
| + | |
− | </div>
| + | |
− | | + | |
− | | + | |
− | <div id="content-in">
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-size: 19px;">1.Get the gene of BFP</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.1 In order to get the fusion protein, we use overlap PCR to construct the fragment(BFP- sJanus & BFP-sJanus-m).We get the gene of BFP by the standard plasmid from iGEM. Then we use PCR to amplify it. The primer we design is as follow:</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">F:5’- GAATTCGCGGCCGCTTCTAGATGAGCGAACTGATCAAAGAG-3’</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(EcoRI and XbaI site are contained). </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">R:5’- GTGGTGGTGGTCTTGGTGGTGGTGGATTCAGTTTATGACCCAGCTT-3’</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(linker-GGGGSGGGGS is contained)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We get the target sequence by PCR at the temperature of 55 ,60 and 65 centigrade.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.2 detail of the experiment</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: 宋体;">:(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50μl</span><span style="font-size: 19px; font-family: 宋体;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | | + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP_F primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP_R primer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP PSB1C3</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">34.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">55</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">60</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: "微软雅黑",sans-serif;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2.Get the gene of BFP- sJanus & BFP-sJanus-m</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.1We get the gene of BFP- sJanus & BFP-sJanus-m by the plasmid pET28a(+) extracting from DH5α. And then we amplify it by PCR. The primer we design is as follow:</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">F:5’-ACCACCAAGACCACCACCACCAAGAAGCAACGGCAACGGCAAT-3’</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">(linker-GGGGSGGGGS is contained)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">R:5’-CTGCAGGCGGCCGCTACTAGTATCAAGCACCGACGGCGG-3’</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">( SpeI, NotI, and PstI site are contained)</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We get the target sequence by PCR at the temperature of 55, 60 and 65 centigrade.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.2 Details of experiment</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: 宋体;">:(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50μl</span><span style="font-size: 19px; font-family: 宋体;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">P_F</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">P_R</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus PET28a</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">33.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">55</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">60</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2.3 Results</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/d/d8/Tianjin_BFP_1.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 14px; text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">Figure 1 </span></strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">The maximum of marker is 2000bp, and the centigrade of 60 is not suitable for the system because there is a track behind it. Our target is about 250bp approximately</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">We get the target fragment in the end. All temperature were suitable for the PCR cycle.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3.Overlap PCR</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3.1 We use the technique of overlap PCR to get our target sequence. In this experiment, we add BFP and sJanus & sJanus-m which we get in two steps and the BFP’s primer we design and sJanus & sJanus-m’s reverse in the system of PCR. We get the target sequence at the temperature of 55, 60 and 65 centigrade.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3.2 Detail of the experiment</span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">PCR system</span><span style="font-size: 19px; font-family: 宋体;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">100μl</span><span style="font-size: 19px; font-family: 宋体;">)</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">dNTPS</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">BFP fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">sJanus fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Pfu enzyme</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="146">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">69μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> <br/></span>
| + | |
− | </p>
| + | |
− | <p style="margin-left: 24px; text-align: left; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Add two kinds of primer (1μl) after 5 cycle.</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">95</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">1</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">50</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">2</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">56</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">3</span><span style="font-size: 19px; font-family: 宋体;">:</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">65</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">30s</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">72</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">10min</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="136">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4</span><span style="font-size: 19px; font-family: 宋体;">℃</span></span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="132">
| + | |
− | <p style="text-align: center; text-indent: 0px; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Forever</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">3.3 Results</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/a/af/Tianjin_BFP_2.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align:left">
| + | |
− | <span style="position: absolute; z-index: 251692032; margin-left: 196px; margin-top: 41px; width: 35px; height: 11px; font-family: arial,helvetica,sans-serif;"><br/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Figure 2</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"><img alt="demo.jpg" src="https://static.igem.org/mediawiki/2015/e/e9/Tianjin_BFP_3.png" title=""/></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Figure 3. The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately. We failed at first attempt. But as we change the temperature we use in PCR cycle. We finally get the target fragment. </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">As we can see from the picture, there are two bands in every channel. One is about 1000bp and another is about 300bp. We do not know the reason of this. But after doing the confirmatory experiment, we are sure the 1000bp band is the target band we want (BFP- sJanus & BFP-sJanus M). We did not get the fragment at first attempt. We change the temperature in PCR cycle. </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><strong><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">4. Construct the plasmid</span></strong></span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">4.1 We design another kind of primer and reverse which contain EcoRI and Hind III site. The condition to amplify it by PCR is same as above all. We choose pET28a(+) as our expression vector. And then, we use enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We use T4 DNA ligase to connect them at the temperature of 22 centigrade. We insert the plasmid into competent DH5α. It has been confirmed that these sequences we get are right when detecting them in company. </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">4.2 detail of the experiment</span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Digest (60μl) 1h</span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow" style=";height:19px">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" height="19" valign="top" width="141">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">ddH2O</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="137">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">31μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr style=";height:19px">
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">6μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr style=";height:19px">
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fd1</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr style=";height:19px">
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Fd2</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">1.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr style=";height:19px">
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" height="19" valign="top" width="141">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">DNA</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" height="19" valign="top" width="137">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">20μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-family: arial,helvetica,sans-serif;"><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">T4 DNA ligase to connect</span><span style="font-size: 19px; font-family: 宋体;">(</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;">20μl</span><span style="font-size: 19px; font-family: 宋体;">)</span><span style="font-family: arial,helvetica,sans-serif; font-size: 19px;"> 1h</span></span>
| + | |
− | </p>
| + | |
− | <table align="center" cellpadding="0" cellspacing="0">
| + | |
− | <tbody>
| + | |
− | <tr class="firstRow">
| + | |
− | <td style="border: 1px solid windowtext; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">Buffer</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: 1px 1px 1px medium; border-style: solid solid solid none; border-color: windowtext windowtext windowtext -moz-use-text-color; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="100">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">2μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">T4 DNA ligase</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="100">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">0.5μl</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">plasmid</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="100">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">X</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | <tr>
| + | |
− | <td style="border-width: medium 1px 1px; border-style: none solid solid; border-color: -moz-use-text-color windowtext windowtext; -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; padding: 0px 7px;" valign="top" width="123">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">fragment</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | <td style="border-width: medium 1px 1px medium; border-style: none solid solid none; border-color: -moz-use-text-color windowtext windowtext -moz-use-text-color; padding: 0px 7px;" valign="top" width="100">
| + | |
− | <p style="text-align: center; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;">5X</span>
| + | |
− | </p>
| + | |
− | </td>
| + | |
− | </tr>
| + | |
− | </tbody>
| + | |
− | </table>
| + | |
− | <p style="text-align: left; line-height: 1.5em;">
| + | |
− | <span style="font-size: 19px; font-family: arial,helvetica,sans-serif;"> </span>
| + | |
− | </p>
| + | |
− | <p style="margin-top: 0px; margin-bottom: 16px; margin-left: 9px; text-align: left; line-height: 1.2em;">
| + | |
− | <br/>
| + | |
− | </p>
| + | |
− | </div>
| + | |
− | <div id="content-in">
| + | |
− | | + | |
− | </div>
| + | |
| </div> | | </div> |
| </div> | | </div> |
Line 6,288: |
Line 421: |
| <div class="nav-back"></div> | | <div class="nav-back"></div> |
| <div class="nav"> | | <div class="nav"> |
− | <div id="div1" class="on"><img id="fximg1" src="https://static.igem.org/mediawiki/2015/e/e3/Tianjin_black1Janus.png"></div>
| + | <div id="div1"><img id="fximg3" src="https://static.igem.org/mediawiki/2015/3/3b/Tianjin_black26.png"></div> |
− | <div id="div2"><img id="fximg2" src="https://static.igem.org/mediawiki/2015/7/7b/Tianjin_black2FsC.png"></div>
| + | </div> |
− |
| + | |
− | <div id="div3"><img id="fximg3" src="https://static.igem.org/mediawiki/2015/5/52/Tianjin_black3Thc_Cut1.png"></div>
| + | |
− | | + | |
− | <div id="div4"><img id="fximg4" src="https://static.igem.org/mediawiki/2015/0/0f/Tianjin_black4LC.png"></div>
| + | |
− | | + | |
− | <div id="div5"><img id="fximg5" src="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_black5GFP.png"></div>
| + | |
− | | + | |
− | <div id="div6"><img id="fximg6" src="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black6BFP.png"></div>
| + | |
− | | + | |
− | <div id="div7"><img id="fximg7" src="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black7RFP.png"></div>
| + | |
− | | + | |
− | </div>
| + | |
| </div> | | </div> |
| | | |
− | <script type="text/javascript" src="https://2015.igem.org/Template:Tianjin/js/jquery-min?
| + | <script type="text/javascript" src="https://2015.igem.org/Template:Tianjin/js/jquery-min? |
| action=raw&ctype=text/javascript"></script> | | action=raw&ctype=text/javascript"></script> |
| <script type="text/javascript"> | | <script type="text/javascript"> |
Line 6,321: |
Line 442: |
| }) | | }) |
| var p=new Array(); | | var p=new Array(); |
− | p[0]="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_white1Janus.png";//白右 | + | p[0]="https://static.igem.org/mediawiki/2015/7/70/Tianjin_white24.png";//白右 |
− | p[1]="https://static.igem.org/mediawiki/2015/1/1a/Tianjin_white2FsC.png"; | + | p[1]="https://static.igem.org/mediawiki/2015/c/c7/Tianjin_white25.png"; |
− | p[2]="https://static.igem.org/mediawiki/2015/3/38/Tianjin_white3Thc_Cut1.png"; | + | p[2]="https://static.igem.org/mediawiki/2015/d/de/Tianjin_white26.png"; |
− | p[3]="https://static.igem.org/mediawiki/2015/d/da/Tianjin_white4LC.png"; | + | p[3]="https://static.igem.org/mediawiki/2015/4/44/Tianjin_white27.png"; |
− | p[4]="https://static.igem.org/mediawiki/2015/6/6b/Tianjin_white5GFP.png"; | + | p[4]="https://static.igem.org/mediawiki/2015/0/07/Tianjin_black24.png"; |
− | p[5]="https://static.igem.org/mediawiki/2015/a/af/Tianjin_white6BFP.png"; | + | p[5]="https://static.igem.org/mediawiki/2015/d/d4/Tianjin_black25.png"; |
− | p[6]="https://static.igem.org/mediawiki/2015/f/f3/Tianjin_white7RFP.png";
| + | p[6]="https://static.igem.org/mediawiki/2015/3/3b/Tianjin_black26.png"; |
− | p[7]="https://static.igem.org/mediawiki/2015/e/e3/Tianjin_black1Janus.png";//白右 | + | p[7]="https://static.igem.org/mediawiki/2015/1/14/Tianjin_black27.png"; |
− | p[8]="https://static.igem.org/mediawiki/2015/7/7b/Tianjin_black2FsC.png";
| + | |
− | p[9]="https://static.igem.org/mediawiki/2015/5/52/Tianjin_black3Thc_Cut1.png";
| + | |
− | p[10]="https://static.igem.org/mediawiki/2015/0/0f/Tianjin_black4LC.png";
| + | |
− | p[11]="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_black5GFP.png";
| + | |
− | p[12]="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black6BFP.png";
| + | |
− | p[13]="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black7RFP.png";
| + | |
| var index=0; | | var index=0; |
| var a=$('.nav div').length; | | var a=$('.nav div').length; |
Line 6,390: |
Line 506: |
| } | | } |
| var $img=$(di).children(); | | var $img=$(di).children(); |
− | p[0][0]="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_white1Janus.png";//白下 | + | p[0][0]="https://static.igem.org/mediawiki/2015/7/70/Tianjin_white24.png";//白下 |
− | p[0][1]="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_white1Janus.png";//白右 | + | p[0][1]="https://static.igem.org/mediawiki/2015/7/70/Tianjin_white24.png";//白右 |
− | p[0][2]="https://static.igem.org/mediawiki/2015/e/e3/Tianjin_black1Janus.png";//黑右 | + | p[0][2]="https://static.igem.org/mediawiki/2015/0/07/Tianjin_black24.png";//黑右 |
− | p[0][3]="https://static.igem.org/mediawiki/2015/e/e3/Tianjin_black1Janus.png";//黑下 | + | p[0][3]="https://static.igem.org/mediawiki/2015/0/07/Tianjin_black24.png";//黑下 |
− | p[1][0]="https://static.igem.org/mediawiki/2015/1/1a/Tianjin_white2FsC.png"; | + | p[1][0]="https://static.igem.org/mediawiki/2015/c/c7/Tianjin_white25.png"; |
− | p[1][1]="https://static.igem.org/mediawiki/2015/1/1a/Tianjin_white2FsC.png"; | + | p[1][1]="https://static.igem.org/mediawiki/2015/c/c7/Tianjin_white25.png"; |
− | p[1][2]="https://static.igem.org/mediawiki/2015/7/7b/Tianjin_black2FsC.png"; | + | p[1][2]="https://static.igem.org/mediawiki/2015/d/d4/Tianjin_black25.png"; |
− | p[1][3]="https://static.igem.org/mediawiki/2015/7/7b/Tianjin_black2FsC.png"; | + | p[1][3]="https://static.igem.org/mediawiki/2015/d/d4/Tianjin_black25.png"; |
− | p[2][0]="https://static.igem.org/mediawiki/2015/3/38/Tianjin_white3Thc_Cut1.png"; | + | p[2][0]="https://static.igem.org/mediawiki/2015/d/de/Tianjin_white26.png"; |
− | p[2][1]="https://static.igem.org/mediawiki/2015/3/38/Tianjin_white3Thc_Cut1.png"; | + | p[2][1]="https://static.igem.org/mediawiki/2015/d/de/Tianjin_white26.png"; |
− | p[2][2]="https://static.igem.org/mediawiki/2015/5/52/Tianjin_black3Thc_Cut1.png"; | + | p[2][2]="https://static.igem.org/mediawiki/2015/3/3b/Tianjin_black26.png"; |
− | p[2][3]="https://static.igem.org/mediawiki/2015/5/52/Tianjin_black3Thc_Cut1.png"; | + | p[2][3]="https://static.igem.org/mediawiki/2015/3/3b/Tianjin_black26.png"; |
− | p[3][0]="https://static.igem.org/mediawiki/2015/d/da/Tianjin_white4LC.png"; | + | p[3][0]="https://static.igem.org/mediawiki/2015/4/44/Tianjin_white27.png"; |
− | p[3][1]="https://static.igem.org/mediawiki/2015/d/da/Tianjin_white4LC.png"; | + | p[3][1]="https://static.igem.org/mediawiki/2015/4/44/Tianjin_white27.png"; |
− | p[3][2]="https://static.igem.org/mediawiki/2015/0/0f/Tianjin_black4LC.png"; | + | p[3][2]="https://static.igem.org/mediawiki/2015/1/14/Tianjin_black27.png"; |
− | p[3][3]="https://static.igem.org/mediawiki/2015/0/0f/Tianjin_black4LC.png"; | + | p[3][3]="https://static.igem.org/mediawiki/2015/1/14/Tianjin_black27.png"; |
− | p[4][0]="https://static.igem.org/mediawiki/2015/6/6b/Tianjin_white5GFP.png";
| + | |
− | p[4][1]="https://static.igem.org/mediawiki/2015/6/6b/Tianjin_white5GFP.png";
| + | |
− | p[4][2]="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_black5GFP.png";
| + | |
− | p[4][3]="https://static.igem.org/mediawiki/2015/b/b7/Tianjin_black5GFP.png";
| + | |
− | p[5][0]="https://static.igem.org/mediawiki/2015/a/af/Tianjin_white6BFP.png";
| + | |
− | p[5][1]="https://static.igem.org/mediawiki/2015/a/af/Tianjin_white6BFP.png";
| + | |
− | p[5][2]="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black6BFP.png";
| + | |
− | p[5][3]="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black6BFP.png";
| + | |
− | p[6][0]="https://static.igem.org/mediawiki/2015/f/f3/Tianjin_white7RFP.png";
| + | |
− | p[6][1]="https://static.igem.org/mediawiki/2015/f/f3/Tianjin_white7RFP.png";
| + | |
− | p[6][2]="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black7RFP.png";
| + | |
− | p[6][3]="https://static.igem.org/mediawiki/2015/0/03/Tianjin_black7RFP.png";
| + | |
| $(di).mouseover(function(){ | | $(di).mouseover(function(){ |
| if($img[0].src==p[num][0]){ | | if($img[0].src==p[num][0]){ |
Line 6,477: |
Line 588: |
| } | | } |
| mou2("#div1",0); | | mou2("#div1",0); |
− | mou2("#div2",1);
| + | |
− | mou2("#div3",2);
| + | |
− | mou2("#div4",3);
| + | |
− | mou2("#div5",4);
| + | |
− | mou2("#div6",5);
| + | |
− | mou2("#div7",6);
| + | |
| | | |
| </script> | | </script> |
| </body> | | </body> |
| </html> | | </html> |