Difference between revisions of "Template:Team:Groningen/CONTENT/LOGBOOK/Ordered Primers th12"
(Created page with " {{Team:Groningen/TEMPLATES/EXPERIMENT |title= Ordered thrC primers (th12) |protocol=none |protocolurl=none |goal=extra integration of DNA in thrC locus |description=Orde...") |
|||
| Line 1: | Line 1: | ||
{{Team:Groningen/TEMPLATES/EXPERIMENT | {{Team:Groningen/TEMPLATES/EXPERIMENT | ||
| − | |title= Ordered thrC primers (th12) | + | |title=Ordered thrC primers (th12) |
|protocol=none | |protocol=none | ||
|protocolurl=none | |protocolurl=none | ||
| − | |goal= | + | |goal=Extra integration of DNA in thrC locus |
|description=Ordering primers for thrC locus | |description=Ordering primers for thrC locus | ||
| − | |conclusion= | + | |conclusion=Primers were ordered |
}} | }} | ||
Latest revision as of 23:00, 21 November 2015
Ordered thrC primers (th12)
Ordering primers for thrC locus
Extra integration of DNA in thrC locus
Primers were ordered
<a class="postscriptum protocol" href="https://2015.igem.org/Team:Groningen/Protocols_and_Protocols/none">none</a>
00:00, 25 Augustus 2015 - 00:00, 25 Augustus 2015
The following primers were ordered.
Primer
Sequence
iGEM thrC locus 2 forward
GACCAGGTACTAGTAGCGGCCGCTGCAGTCGATAACCCTAAAGTTATGGAAATAAGACT
iGEM thrC locus 2 reverse
AGGAAGTTAAAGGAGCTCGAATTAATTCC
Ordered primers.