Difference between revisions of "Team:Groningen/Notebook/Colony PCR th18"
(Created page with " {{Template:Team:Groningen/TEMPLATES/BASE|pagename=LOGBOOK/Colony_PCR_th18}}") |
|||
| Line 1: | Line 1: | ||
| − | |||
| − | |||
{{Template:Team:Groningen/TEMPLATES/BASE|pagename=LOGBOOK/Colony_PCR_th18}} | {{Template:Team:Groningen/TEMPLATES/BASE|pagename=LOGBOOK/Colony_PCR_th18}} | ||
Latest revision as of 23:11, 21 November 2015
Blue Bio Energy
Colony PCR thrC locus 2 (th18)
Colony PCR on transformed cells with thrC locus in thrC plasmid A
Extra integration of DNA in thrC locus
A positive colony
Colony PCR
00:00, 4 September 2015 - 00:00, 4 September 2015
Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.
Primer
Sequence
IGEM thrC forward
AATTCATGTAAAAGATGAGGTTGGTTCATT
iGEM erm-thrC rev 2
AGGAAGTTAAAGGAGCTCGAATTAATTCC
Used primers.
The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.