Difference between revisions of "Template:Team:Groningen/CONTENT/EXPERIMENTS/Colony PCR thrC locus 2 (th18)"
| Line 2: | Line 2: | ||
|title=00:00, 4 September 2015 - 00:00, 4 September 2015 | |title=00:00, 4 September 2015 - 00:00, 4 September 2015 | ||
|executor=Marieke Mulder | |executor=Marieke Mulder | ||
| − | |content= | + | |content=<div class="text">Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.</div> |
| − | <div class="text"> | + | |
| − | Colonies from the transformation were checked with a colony PCR. | + | |
| + | <div class="object data" id="tbl1"> | ||
| + | <div class="wrapper"> | ||
| + | <div class="header"> | ||
| + | <div class="field fw3">Primer</div> | ||
| + | <div class="field fw7">Sequence</div> | ||
| + | </div> | ||
| + | <div class="record"> | ||
| + | <div class="field fw3">IGEM thrC forward</div> | ||
| + | <div class="field fw7">AATTCATGTAAAAGATGAGGTTGGTTCATT</div> | ||
| + | </div> | ||
| − | + | <div class="record"> | |
| − | + | <div class="field fw3">iGEM erm-thrC rev 2</div> | |
| − | + | <div class="field fw7">AGGAAGTTAAAGGAGCTCGAATTAATTCC</div> | |
| + | </div> | ||
| + | </div> | ||
| + | <div class="caption">Ordered primers.</div> | ||
| + | </div> | ||
| − | + | <div class="text">The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.</div> | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at | + | |
| − | + | ||
| − | </div> | + | |
}} | }} | ||
Revision as of 23:14, 21 November 2015
00:00, 4 September 2015 - 00:00, 4 September 2015
Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.
Primer
Sequence
IGEM thrC forward
AATTCATGTAAAAGATGAGGTTGGTTCATT
iGEM erm-thrC rev 2
AGGAAGTTAAAGGAGCTCGAATTAATTCC
Ordered primers.
The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.