Team:Paris Bettencourt/Notebook/Phytase
Ferment It Yourself
iGEM Paris-Bettencourt 2O15
- Background
- Design
-
-
-
-
-
-
Vitamin B12
Background
Aims
Results
Cobalamin (vitamin B12) deficiency is widely spread in India, due to diet that is mostly vegetarian. We aimed at introducing a high-level cobalamin producer to the rice batter. Tadaa.
5/08/15
Design primers
Gene PHO85
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGATAATCATTTGCA
TCCATACATTTTGATGGC -3’
3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACAGCAGTATAG
CGACCAGCATTC-5’
- tail homologie PHO85
- Primer Kan
Gene PHO80
5’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
5’-ATCATAAGACGAGGATATCCTTTGGAGACTCATAGAAATCATAATCATTTGCATCCAT
ACATTTTGATGGC-3’
3’Primer of Kan resistance gene with tails use to transformation with the PHO80 gene of the yeast.
3’-CTCAATCATGATTGCTTTCATAATACCCCACGAAAAATCACAGCAGTATAGCGACCA
GCATTC-5’
- tail homologie PHO80
- Primer Kan
Gene FRT + PHO85
5’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
5’-TATCATTATATATACATGGCTACGGTTTTTCGCTGACGGGCTGCGGAAGTTCCTATTC
TCTAGAAAGTATAGGAACTTCATAATCATTTGCATCCATACATTTTGATGGC-3’
3’Primer of Kan resistance gene with tails use to transformation with the PHO85 gene of the yeast, including FRT sequence to can delete both of PHO80 an PHO85.
3’-AAGGGATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCACTTCAAGGATAT
GAAAGATCTCTTATCCTTGAAGCAGCAGTATAGCGACCAGCATTC-5’
- tail homologie PHO85
- FRT
- Primer Kan
12/08/15
Culture
The saccharomyces cerevisiae SK1 was thaw and sow 100µL of it on YPD medium overnight. (at 30°C)
This yeast will be transformed.
PCR
3 PCR were realized on OH plasmid to create a Kanamicine resistance marker, thanks to 3 pair of primers wich have tails we’ll be use to knock out genes PHO80, PHO85 and both in the yeast.
Protocol:PHO80 PHO85 FRT+ PHO85 Master mix (µL) 50 50 50 H2O DNAse Free (µL) 45 45 45 Resistance plasmid (µL) 1 1 1 PHO80 5'Primer (µL) 2 PHO80 3'Primer (µL) 2 PHO85 5'Primer (µL) 2 PHO85 3'Primer (µL) 2 PHO85 + FRT 5'Primer (µL) 2 PHO85 + FRT 3'Primer (µL) 2 13/08/15
PCR purification
Protocol: Dilute PCR product (5 or 10 times ?) with the resuspension buffer. Pour it in a purification column. Centrifuge 30sec at 14K rpm Throw the filtrat Add 700µL of EtOH (washing solution) Centrifuge 30sec at 14K rpm DThrow the filtrat Add 500µLof washing solution Centrifuge 30sec at 14K rpm Throw the filtrat Centrifuge 30sec at 14K rpm Throw the filtrat Put the column in a Eppendorf Add 45µL of RNAse/DNAse free water right on the membrane Wait 2min Centrifuge 2min at 10K rpm
PCR The PCR control with an electrophoresis
We expected strips around 1.300bp. The strip corresponding to marker with FRT is bigger than the two others strips wich have just the Kan resistance with tails.
pre-culture
Swo one colony saccharomyces (...) of the yesterday in 5mL of the liquid YPD medium, let 's grow overnight.
14/08/15