Team:Paris Bettencourt/Notebook/Differentiation
Contents
- 1 Advancement on E. coli
- 2 Cloning inside the replication vector
- 3 Chromosomal integration with GalK
- 4 Function testing
- 5 CRE recombinase expression
- 6 Thursday 07/09
- 7 Monday 07/20
- 8 Wednesday 07/22
- 9 Thursday, 07/23
- 10 Tuesday, 07/28
- 11 Wednesday, 07/29
- 12 Thursday, 07/30
- 13 Wednesday, 8/5
- 14 Monday, 08/10
- 15 Tuesday, 08/11
- 16 Wednesday 08/12
- 17 Thursday 08/13
- 18 Friday 08/14
- 19 Saturday 08/15
- 20 Monday 08/17
- 21 18/08
- 22 19/08
- 23 20/08
- 24 21/08
Advancement on E. coli
The whole brainbow system will be integrated chromosomally at the GalK site. It will be synthesized as three gBlocks.
It should allow expression of mCherry first, then upon expression of the CRE recombinase, differentiation in two states (YFP and CFP).
It also contains a landing pad that allow insertion of a third state, which would subsequently lower the probability of states 1 and 2 so the three outcomes are possible.
Writing the artificial gene
Promoter J23199 from the Biobrick collection
4 LoxP sites used together in mammalian brainbow plasmids
RBS from Ihab
ORF for mCerulean and mVenus from Ihab
ORF for mCherry from Antoine
rrnBT1 terminator used on the pOSIP plasmids
Landing Pad (PhiC31 attB TT site)
Check for secondary structure in the RBS Done
Check for RBS in the LoxP array Done
Split to have two ~1500 bp gblocks Done
Design overlaps for Gibson in R6K vector Done
Check for Biobrick restriction sites Done
Fix gBlocks problems
- Palindroms between LoxP sites Done
- Repeats in terminator: replaced with Lambda T0 terminator Done
- Repeat in RBS Done
- More GC in the LoxP array Done
- More GC at the end of fragment 1Done
- Repeat at the end of mVenus and mCerulean Done
- More GC at the beginning of fragment 2 Done
It is very difficult to solve these -> make 3 fragments Done
Fragment A: 0 - 1143
Fragment B: 1105 - 2006
Fragment C: 1981 - 2946
Change the RBS for Fragment A -> “New RBS” Done
Order gBlocks Done 07/13
Design + order oligos for gBlocks amplification Done
Overlaps melting points are 62, 67, 54, 74.
The overlap between fragments B and C should be increased to >62.
R6K LinR |
tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag |
o15.80 |
R6K LinF |
CGGGCGCGTACTCCAgaagggcatcgatggc |
o15.81 |
Colibow A F |
ttgacagctagctcagtcctag |
o15.82 |
Colibow A R |
GGCCATTCACATCACCATC |
o15.83 |
Colibow B F |
GCCGATTCTTGTTGAACTTG |
o15.84 |
Colibow B R |
CCATGGTACCTCCTCCTTACTTCTATAACTTC |
o15.85 |
Colibow C F |
GATACTTTATACGAAGTTATAGAAGTAAGGAGGAG |
o15.86 |
Colibow C R |
gccatcgatgcccttcTGGAGTACGCGCCCG |
o15.87 |
Overlap melting points: 62, 67, 62, 72.
Design + order oligos for cassette sequencing Done
>50 bp before the interest region
800 bp max contigs
Obtain Pir+ strain Done
Overnight of Pir+ strain Done
Glycerol of Pir+ strain Done
Cloning inside the replication vector
Order oligos linR and linF Done
Obtain R6K vector from Ihab Done
Overnight culture of the R6K vector propagation strain
Failed New attempt with less harsh growth conditions. Done
- Only 20 ug/ml of Kanamycine
- 6 ul of Thyamine in 3 ul of LB
- Culture at 30°C
Miniprep of the R6K vector Done
Glycerol of R6K strain Done
Linearization of the R6K vector by PCR Done
Primer linF:
CCCTTGGGCTCCCCGGGCGCGTACTCCAgaagggcatcgatggc
(28 bases: longest possible overlap without having a hairpin at 50°)
Tm = 55°
Primer linR:
tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag
(33 bases overlap)
Tm = 62°
Product length: 2276 bp
Synthetize, reconstitute and dilute primers Done
Run gel for size checking Done
PCR purification Done
Obtain gBlocks Done
PCR of colibow fragments A, B and C Done
PCR purification of amplicon Done
Obtain Gibson mix Done
Make overnight culture of Pir+ strain Done
Make electrocompetent cells out of the Pir+ strain Done
Gibson assembly of 3 gblocks with the R6K backbone. Done
The vector can only replicate in Pir+ strain. Transform into Pir+ strain Got colonies
Check transformant: colony PCR before culture Failed
Liquid culture + miniprep
Analytical digestion or sequencing (find enzymes)
SeqF1 |
o15.88 |
cttagtacgttagccatgagg |
SeqF2 |
o15.89 |
CTAATTTTCCATCTGATGGCC |
SeqF3 |
o15.90 |
CAAGCTCACGCTCAAATTC |
SeqF4 |
o15.91 |
ACAACCATTACCTGTCGACG |
SeqF5 |
o15.92 |
CGACATTAGGGTATGGGCTG |
SeqR1 |
o15.93 |
TATAAACATTATGGCTATTATAG |
SeqR2 |
o15.94 |
TTTAGAGAGTTTTGACTGCG |
SeqR3 |
o15.95 |
TTTGCCAGTCGTACAGATGAA |
SeqR4 |
o15.96 |
TCTTCTTCTGCATCACCGGGC |
Chromosomal integration with GalK
PCR of the purified R6K plasmid. Done
PCR-linerization of the R6K backbone
- Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
- Primers: 15.80 (LinR) et 15.81(LinF) -> 1 ul each
- Eau qsp 25 ul
- Master mix 25 ul
1’30’’ extension, 50°C annealing.
Find oligos (already there) Done
IntR:
GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAACCATATGAATATCCTCCTTAGTTCCTATTCCG
Alternatively, with only one binding site:
GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAAttagccatggtccatatgaatatcctccttag
IntF:
TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGTTGAACTGCGGATCTTGCGGC
Italique: Homology region with E. coli GalK site.
Length: 4908 bp
Attention, autre site potentiel d’amorçage, produit de 3515 bp
Purification
Overnight culture de E. coli Lambda Red
Competent cells out of Lambda Red strain
Transformation of E. coli with pKD46 that carries Lambda Red recombinase
Transformation of the Colibow PCR product
Function testing
Tecan + Flux cytometry
CRE recombinase expression
pFHC2938 should work.
It expresses CRE and has a temperature sensitive ORI (30°C)
Monday 07/06
Research about the synthetic integron
It might make the landing pads better than with brainbow because the recombination site is always the same.
Plate culture of E. coli pIT5-KL and pIT5-KH
Very important: grow @30
-> Make a liquid culture of each and freeze at -80
-> Miniprep from pIT5-KL for first construct
These two strains produce the vector plasmids for clonetegration. They have to be linearized with EcoR1 and Pst1, and then Gibson assembled to get the self-integrating plasmids.
The integrase they carry is expressed only at 37 degrees.
They are resistant to Kanamycine.
KH integrates into the HK022 phage’s site, while KL integrates into the Lambda phage site. We will probably only need one of them but I took both just in case. If needed there is a whole collection of such vectors.
Plate culture of E. coli pE-FLP
Grow @ 30
This strain produces the pE-FLP plasmid, which expresses the flippase. It will be useful to remove the backbone after the clonetegration. It’s resistant to ampicillin.
It has a temperature-sensitive ORI and will disappear if grown at 37.
New primers
LC81, LC85, LC82, LC86: used in the PCR to check integration with pIT5 KH.
LC81, LC87, LC83, LC84: used in the PCR to check integration with pIT5 KL.
Thursday 07/09
- Prepared 10 tubes of 1 ml Kanamycine, 50 mg/ml
- Inoculated pIT5-KL and pIT5-KH E. coli in 2 ml LB Kan+50
- Inoculated pE-FLP E. coli in 2ml LB Amp+100
- Cultured these three tubes @ 30
Monday 07/20
Reception of two plates from Ihab
- Shortened R6K vector -> Kan+ and thyamine auxotrophy. Thyamine 1000x is available in an eppendorf tube.
- Pir 116 strain for propagation of the vector.
-> Overnight culture for miniprep for PCR and gleezing
- R6K in LB Kan Thyamine (in antibiotics box)
- Pir116 in LB with a control tube
Started cultures for Colibow
pThy 1.0 aka pBrainbow 1.0 in 3 ml LB-Amp -> Miniprepcr
pR6K in LB-Kan-Thyamine -> Miniprepcr and Glycerol freezing
Pir116 for replication of pR6K-vectors -> LB
Control without innoculation -> LB
All of them, culture @ 37° overnight.
No need to culture pKT174 because we already have the purified version. It may be a good idea to transform DH5a with it in case we run out of plasmid.
Reception of oligos o15.76 to o15.96
- Yeastbow SOE
- R6K linearization
- Colibow gBlock Amp
- Colibow Sequencing
The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.
-> Oligo reconstitution and dilution
-> Miniprep of R6K vector
-> PCR of R6K vector
-> Miniprep of pBrainbow 1.0
-> PCR of pBrainbow 1.0
-> PCR of pThy Ura3
Reconstituted all primers to 100 ug/ml.
Miniprep of pR6K and pBrainbow 1.0
For PCR, using Promega kit w/ double wash. Elution in 30 ul
Final concentration: 93 ng/ul
Re-start of the R6K culture
The first culture failed: let’s try again with less harsh conditions.
- Only 20 ug/ml of Kanamycine
- 6 ul of Thyamine in 3 ul of LB
- Culture at 30°C
Wednesday 07/22
PCR-linerization of the R6K backbone
- Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
- Primers: 15.80 (LinR) et 15.81(LinF) -> 1 ul each
- Eau qsp 25 ul
- Master mix 25 ul
1’30’’ extension, 50°C annealing -> 2276 bp
Bad news from IDT about the gene synthesis
« I would like to notify you about a best effort for gBlock ‘Colibow C’. Even after multiple attempts at trying to correct this issue, the Final QC data for the best prep is not meeting our quality standards. The final prep (mfg# 188635671) has desired peak. A secondary peak is also present. The target mass was found in the chromatogram, but not as the most abundant product in any of the chromatographic peaks for mass spectrometry, and the sequence has been verified.
If you are using this sequence for cloning and/or qPCR you should not have any problems with this sequence. It may require you to screen additional colonies. However, if your intentions with using this gBlock was for other purposes, we might need to cancel the gBlock and redesign. I have provided the trace below. »
Thursday, 07/23
Glycerol stock for pR6K
1 ml of overnight culture of E. coli pR6K.
1 ml of glycerol.
-> -20°C
Gel for linearized R6K pcr
1% agar TAE, with 1 kb+ generuler.
5 ul PCR product + 1 ul LB.
-> band at the right size (2276 bp) , the PCR worked.
linearized R6K pcr cleanup
Using the Qiagen kit, taken back in 50 ul water
Titration: about 80 ng/ul, but very bad 260/230 ratio (presence of organic molecules).
Pir116 electrocompetent for bowcoli transformation
2 ml overnight culture in 100 ml LB, at 37°C w/ shaking.
When OD reaches 0.6, they were put in ice for half an hour.
Electrocompetent cells were made by Mukit along with DH5a competent cells.
Tuesday, 07/28
Reception of gBlocks Colibow A, B, C
Reconstitution to the concentration of 10 ng/ul (from spec sheet):
- Centrifuge @ 11kG
- Add 100 ul of RNase-free water
- Vortex
- Incubate at 50°C for 20 minutes
- Vortex/Centrifuge
PCR of Colibow gBlocks
Colibow A
Primers: 82 (56°) + 83 (54°) -> 1172 bp
Colibow B
Primers: 84 (53°) + 85 (54°) -> 909 bp
Colibow C
Primers: 86 (54°) + 87 (57°) -> 992 bp
Reaction in 50 ul:
Compound |
Volume (ul) |
Water |
19 |
Phusion 2x |
25 |
Primer 1 |
2.5 |
Primer 2 |
2.5 |
gBlock diluted 10 times |
1 ul |
Program:
98 (30)
98 (10) 58 (25) 72 (45) x35
72 (600)
12 (hold)
In parallel from running the gel, the PCR products were purified with the QIAGEN kit and eluted in 40 ul of water.
Titration
Fragment A: 90 ng/ul
Fragment B: 88 ng/ul
Fragment C: 85 ng/ul
Gel plan
1% agar, SYBRsafe, 5 ul of PCR product + 1 ul of LD.
The 100 bp+ marker was used.
The apparatus didn’t work. It stopped two times, the gel stayed to diffuse in the tank for 30 minutes. At the end it was imaged even though it was far from finished.
Ladder 100 bp+ |
Colibow A |
Colibow B |
Colibow C |
Expected size |
1172 |
909 |
992 |
<img src="images/image04.jpg" title="fig:Colibow Amp Results.jpg" alt="Colibow Amp Results.jpg" /><img src="images/image02.jpg" title="fig:1438103355.jpg" alt="1438103355.jpg" />
Conclusion
There are a lot of non-specific binding.
Due to the awful quality of the gel, it’s not possible to determine their size or which bands are the good ones. The top ones seem more consistent regarding their relative sizes.
To do:
- Run the whole purified PCR product in a gel and perform a gel extraction. Hopefully the right band can be determined this time.
- Try the PCR again with a higher annealing temperature.
- Gibson assemble directly the gBlocks fragments.
Wednesday, 07/29
Gel for Colibow A, B, C and extraction
Agar 1%, SYBRsafe, TAE
Ladder 100 bp+ |
Colibow A |
Colibow B |
Colibow C |
Expected size |
1172 |
909 |
992 |
<img src="images/image01.jpg" title="Colibow Amp Extracted.jpg" alt="Colibow Amp Extracted.jpg" />
Colibow Amp Extracted.jpg
For each sample, the top band was extracted. The Colibow B sample was extracted twice: Bg (grande, top band) and Bp (petite, bottom band).
The bottom band is the right one.
-> add DMSO 3% next time
Titration (in 30 ul EB)
Name |
1 |
U |
A |
Bp |
Bg |
C |
C (ng/ul) |
13 |
41 |
6 |
29 |
11 |
12.1 |
The concentrations of Colibow A and C are critically low. It is necessary to fix the PCR and reduce the non-specific priming before performing the Gibson.
New attempt at Colibow A and C PCRs
Mix
Phusion 25
Colibow A 1
o15.82 2.5
o15.83 2.5
Water 19
DMSO 1.5 (3%)
= Two tubes of 50 ul each -> 1172 bp
Mix
Phusion 25
Colibow C 1
o15.86 2.5
o15.87 2.5
Water 19
DMSO 1.5 (3%)
= Two tubes of 50 ul each -> 992 bp
This is stored in 4° for now (29/07)
Received Gibson assembly mixes from Ihab
I need better quality products before doing it.
Thursday, 07/30
Gel for A, C and 1
- Sophie’s sample
A |
A |
A |
C |
C |
C |
100+ |
1 |
1 |
1 |
1kb |
|
1172 |
1172 |
1172 |
992 |
992 |
992 |
3965 |
3965 |
3965 |
50 ul sample + 10 ul LD -> 40 ul in each well (3 wells)
Attention C sample accidentally added to the well containing 100 bp + ladder !!!
<img src="images/image00.jpg" title="Colibow A et C amp 29.07.jpg" alt="Colibow A et C amp 29.07.jpg" />
Colibow A et C amp 29.07.jpg
Gel extraction
With Qiagen kit, product recovered in 30 ul of water.
Name: “product” X+ 30/07
The C product mixed with ladder was labeled Cl.
Titration
Sample |
1 |
A |
C |
Cl |
c (ng/ul) |
5.2 |
15.4 |
12.9 |
4.4 |
Gibson assemblies of Colibow
General mix:
15 ul of Gibson supermix (MMII)
10-100 ng of backbone for a 6 kb fragment
Equimolar amount of DNA fragments
Total: 20 ul
Colibow PCR products
Using the most concentrated PCR products known to date.
Nom |
Taille (bp) |
Concentration |
Volume (ul) |
Quantité (ng) |
R6K pcr |
2276 |
80 |
0.6 |
50 |
Colibow A+ e (in water) |
1172 |
15 |
1.7 |
25 |
Colibow Bp (in EB) |
909 |
29 |
0.9 |
25 |
Colibow C+ e (in water) |
992 |
13 |
1.6 |
25 |
Colibow gBlocks
Using directly the gBlocks from IDT dna synthesis
Nom |
Taille (bp) |
Concentration |
Volume (ul) |
Quantité (ng) |
R6K pcr |
2276 |
80 |
0.5 |
30 |
Colibow A |
1172 |
10 |
1.5 |
15 |
Colibow B |
909 |
10 |
1.5 |
15 |
Colibow C |
992 |
10 |
1.5 |
15 |
Incubation during one hour at 50°C.
3 LB ampicillin plates
“30/07 ANTOINE”
50 ml of hot LB-agar.
Transformation of Colibow in Pir116 by Electroporation
pColibow gBlock
pColibow PCR
Biobrick plasmid with RFP (3 ul of 10 pg tube, not dialysed)
Protocol from OWW:
- Thaw cells from -80°C to ice for >20 min
- Chill cuvettes
- Dialyse 6 ul of Gibson products on dWater during >20 min
- Mix 6 ul of dialysed DNA with 50 ul Pir116 electrocompetent cells
- Mix with tip
- Pulse (1.5 kV, 2 mm cuvette)
- Add 1 ml LB (at 18h43)
Incubate for 1 hour at 37°C.
2 Kanamycine 25 plates for each colibow plasmid: 100 ul and 900 ul
1 Chloramphenicol plate for RFP control
Incubation overnight @37.
Transformation of pKT174 in DH5a by Heat shock
Protocol from addgene:
- Thaw cells on ice (20 min)
- 3 ul DNA + 50 ul chemically competent cells, mix gently
- 20-30 min on ice
- 45s at 42°C
- 2 min on ice
- Add 1 ml LB (at 18h50)
- Incubate 1 hour @ 37°C
2 ampicillin plates: 100 ul and 900 ul.
Incubation overnight @37.
Gel for SOE 29/07
1 kb ladder |
SOE |
SOE |
SOE |
1 kb ladder |
Expected size: 5600 for all of them.
<img src="images/image03.jpg" title="SOE+29.07.jpg" alt="SOE+29.07.jpg" />
SOE+29.07.jpg
It didn’t work at all. Try to Gibson-assemble them.
New electroporation of Pir116
Using the old electroporator (with the square cuvette holder).
Dialysis of 6 ul and sampling of 5 ul of Colibow gBlock assembly
Dialysis of 5 ul and sampling of 5 ul of 5 pg/ul
Compound |
x1 |
x8 |
10x Taq Buffer |
2.5 |
20 |
10 nM dNTPs |
0.5 |
4 |
10 uM primer 90 |
0.5 |
4 |
10 uM primer 94 |
0.5 |
4 |
taq polymerase |
0.125 |
1 |
water |
17.875 |
167 |
Then 22 ul of mix is added to 3 ul of template (2 ul water + 1 ul sample for positive control). Template is obtained by soaking part of a colony in 20 ul water.
Program (saved as Colony):
95 (6’00)
95 (15) 49 (25) 68 (45) x30
68 (5’00)
Gel:
P900 B1 B2 B3 ColibowB 100bp+
Results:
- One band at 508 bp on the positive control.
- No band at all on the colonies
-> They are contaminations, the transformation did not work, probably because the Gibson itself did not work due to bad DNA concentration.
Wednesday, 8/5
Pir116 electrocompetent cells
From the overnight culture, 1 ml of cells were diluted in 50 ml of LB and incubated at 37°C (10h30).
Centrifuge steps were done 10 min at 8500 rpm.
- 50 ml culture -> centrifuge and remove well the supernatant
- 50 ml glycerol 10% -> centrifuge
- 50 ml glycerol 10% -> centrifuge
Cells in residual glycerol were aliquoted in eppendorf tubes (6 in the end) and frozen @-80.
Testing of these EC Pir116 cells function
4 ul of pSB1C3 20 pg/ul were dialysed, 3 ul were picked after 20 min and mixed with 100 ul of cells.
Pulse duration: 5.7 ms
After 1 h of preculture @37, it was plated on a chloramphenicol 0.5 plate and grown @37.
New colibow PCR
Performed by Chloé and Émilie.
<img src="images/image06.png" title="1438872081.png" alt="1438872081.png" />
1438872081.png
Program:
98 (30)
35x 98 (10), Gradient (30), 72 (2’20)
72 (5)
10 (hold)
Gradient:
59, 57.8, 55.3, 53.4
The very long extension time is used to avoid promoting small non-specific fragments.
Gel:
1% agarose, SYBRsafe, 2.5 ul sample + 0.5 ul LD
L |
A |
A |
A |
A |
L |
B |
B |
B |
B |
L |
C |
C |
C |
C |
L |
1 kb |
1172 |
1 kb |
909 |
1 kb |
992 |
<img src="images/image07.jpg" title="08.05 Colibow Amp gradient.jpg" alt="08.05 Colibow Amp gradient.jpg" />
08.05 Colibow Amp gradient.jpg
Thursday, 8/6
PCR purification of Colibow gBlocks
The homologous tubes were mixed together, except for C2 that didn’t work.
Elution in 50 ul of water.
A second gel was ran in order to know whether the light band at the bottom is still present.
1 kb ladder |
A |
B |
C |
Is it. This has to be taken into account when calculating the concentrations for the Gibson assembly.
Titration (in 50 ul of water):
A: 137 ng/ul
B: 167 ng/ul
C: 99 ng/ul
<img src="images/image05.jpg" title="08.06 Colibow gradient after purification.jpg" alt="08.06 Colibow gradient after purification.jpg" />
08.06 Colibow gradient after purification.jpg
New R6K PCR
Compound |
1x |
2x |
water |
71 |
142 |
Phu buffer |
20 |
40 |
dNTP |
2 |
4 |
80 primer |
1 |
2 |
81 primer |
1 |
2 |
pR6K shortened (template) |
1 |
2 |
DMSO |
3 |
6 |
Phusion polymerase |
1 |
2 |
Program:
98 (30)
98 (10) 52 (30) 72 (1’30) x 35
72 (5’)
Problem: There was only <1 ul of phusion left in the tube. The PCR did not work at all.
New attempt
Mix (made twice)
Phusion master mix 50 ul
80 primer 2 ul
81 primer 2 ul
pR6K 3 ul
DMSO 3 ul
Water 40 ul
Program:
98 (30)
98 (10) 50 (30) 72 (1’30) x 35
72 (5’)
After this PCR, the product was:
- ran on a gel: Ladder 1kb, tube 1, tube 2 (3 ul sample, 2 ul water, 1 ul LD)
- digested by DPN1:
1 ul of DPN1 added directly to the product, then incubated for 15 minutes at 37° in the thermocycler and inactivated (5 min at 80°).
Gel results: [08.09 R6K pcr]
Monday, 08/10
PCR purification of R6K amp
With QIAGEN kit, performed by Chloé & Émilie. At the end, the product was recovered in 50 ul of water and also 30 ul EB, for 80 ul total.
The titration was done using a 5 ul + 3 ul mix as a blank.
Products summary:
R6K pcr |
67.4 ng/ul |
2276 bp |
Colibow A |
137 |
1172 bp |
Colibow B |
167 |
909 bp |
Colibow C |
99 |
992 bp |
A and C have a small band at ~200 bp, so the actual concentration of the product is half of what indicated by the Nanodrop.
Gibson assembly of Colibow
Assuming half the DNA in A and C is the right one.
Name |
Volume (ul) |
Final amount (pmol) |
A |
1.11 |
0.10 |
B |
0.4 |
0.11 |
C |
1.30 |
0.10 |
R6K |
2.19 |
0.10 |
Added to a MMII Gibson assembly master mix and incubated during 1h at 50°C.
Gel for Colibow’s Gibson
6 ul SYBRsafe in 20 ml agar 1%, with 1 kb ladder.
The sample consisted in 10 ul of Gibson product and 2 ul of LD.
Unfortunately the comb for making the wells went through the gel, resulting in loss of the sample.
Electroporation of Pir116 E. coli with newly assembly pColibow
- Dialyse of the assembly product during 20 min. 5 ul were deposed and 5 ul were taken back.
- Mixed with already tested Pir116 Electrocompetent cells
- Program Ec2, bacterial, in 2 mm cuvette. Pulse time: 4.7 ms.
- Incubation 1h @37
- Plating on “pColibow Gibson” plates (K50 but K20 written on the box). 100 ul on the first box, centrifuged 900 ul on the second one.
- Incubation overnight @37.
Tuesday, 08/11
Pir116 Colibow electroporation results
We got a lot (~300) colonies on the 100 ul plate, and even more on the other plate (too many to distinguish). The colonies don't appear to be red at all. We can distinguish two types of colonies: bigger ones and smaller ones.
Colony PCR for checking colibow transformation
10 big colonies were picked (we're waiting for the small ones to be big enough to be tested) and diluted in 20 ul of water.
x1 |
x13 |
|
|---|---|---|
10x Taq Buffer |
2.5 |
32.5 |
10 nM dNTP |
0.5 |
6.5 |
Primer 90 |
0.5 |
6.5 |
Primer 94 |
0.5 |
6.5 |
Taq |
0.125 |
1.625 |
Water |
17.87 |
Then, 22 ul mix + 3 ul template. Program: Same as last colony PCR (saved as Colony).
Gel: 1,2,3,4,5,6,7,8,9,10, negative, positive. Negative: No template. Positive: Colibow B diluted gBlock.
[08.10 Colony PCR]
Results: The positive control is positive, but it didn't involve cell lysis. All the colonies are negative, which means that either the cell lysis didn't work, or they are not transformed properly.
Hypothesis: Too much template in R6K PCR, or the DPN1 digestion was not thorough enough.
The clones 1,2,5,6 and 7 were put into culture (4 ml LB Kan+) for further analysis. It included a negative control (un-transformed Pir116).
Gel extraction of Colibow A and C
A|A|1 kb ladder|C|C |
[08.10 Colibow A and C]
The bands were cut and extracted with Qiagen kit. Recovery in 30 ul water. As Loading Dye was accidentally mixed with the B sampled, it was PCR-cleaned-up again and recovered in 30 ul water.
Titration:
- A : 28.4 ng/ul
B : 212 ng/ul
C : 34 ng/ul
Wednesday 08/12
New new R6K PCR
Mix
Phusion master mix 50 ul
80 primer 2 ul
81 primer 2 ul
pR6K diluted 20 times 1 ul
DMSO 3 ul
Water 42 ul
The goal is to minimize the amount of R6K backbone in the mix, to limit background colonies.
Program:
98 (30)
98 (10) 52 (30) 72 (1’30) x 35
72 (5’)
Results: It did not work (gel not shown).
New new new R6K PCR
Mix
x1 |
x2 |
|
|---|---|---|
Phusion master mix |
50 |
100 |
primer 80 |
2 |
4 |
primer 81 |
2 |
4 |
pR6K |
0.5 |
1 |
DMSO |
3 |
6 |
Water |
42.5 |
85 |
Program:
98 (30)
98 (10) 50 (30) 72 (1’30) x 35
72 (5’)
Analysis of colonies from pColibow transformation
All of the clones grew overnight. The negative control did not grow, meaning that the kanamycine we used is efficient and the Pir116 native cells are not resistant.
The cultures 1, 2, 5 and 6 were miniprepped (3 ml + 1 ml saved for Glycerol stock if needed) and recovered in 50 ul of water.
Titers:
- I : 96
II : 105
V : 111
VI : 106
The rest was put back into culture at 37°.
NotI digestion of the plasmids
NotI cuts only once in both the pR6K vector and in the pColibow plasmid.
x1 |
x4 |
|
|---|---|---|
Water |
16 |
64 |
10x FD Buffer |
2 |
8 |
Plasmid |
1 |
4 |
Not1 |
1 |
14 |
Incubation at 37° started at 17h10, stopped at 19h10.
Gel after NotI digestion
1 kb ladder, I, II, V, VI, 1 kb ladder. Expected results: 5190 bp if it's pColibow, 2229 bp if it's pR6K.
Gel for R6K PCR
1B and R6K pcrs were ran on the same gel:
1B | 1B | 1 kb ladder | R6K | R6K |
2 ul water + 1 ul LD + 3 ul sample.
Results: [0.13 B1 and R6K]
The R6K PCR yielded two bands: one at around 1000 bp, and one at around 2500 bp. The bigger one is the good one, it could be gel-extracted if needed. However, we should stick to the previous version that will probably be more concentrated anyways due to the absence of off-product.
Thursday 08/13
The new new new new new R6K pcr still did not work. There is a serious problem with one of the things we use because this PCR worked before.
DPN1 digestion of the previous R6K product
As it's no longer possible to even replicate the previous R6K pcr for some reason, I will stick with the small, diluted sample that I have and digest it with DPN1. That's the only thing I can do.
For R6K vol ~ 20 ul DPN1 FD 5ul 10x FD Buffer 3ul
37°C during 30 min, then 80°C for 20 min.
Titration: 24 ng/ul, with a high 280 absorbance due to DPN1 itself. I don't know why the total DNA concentration dropped.
Friday 08/14
Saturday 08/15
R6K PCR, attempt N
Using either purified R6K plasmid or R6K PCR product.
Mix: Master mix, 50 ul F (81), 1ul R (80), 1ul R6K, 1ul DMSO, 3 ul water, 44 ul
Each of them was done in duplicate, with a gradient (annealing temperature of 52 or 55°C).
Program 98 (30) 98 (10) gradient (30) 72 (1'30) * 36 72 (5)
Result: absolutely nothing.
R6K PCR, attempt N+1
Mix: Master mix, 50 ul F (81), 2ul R (80), 2ul R6K, 1ul DMSO, 3 ul water, 44 ul
Same prog, except 50°C annealing, 3'00 extension, 37 cycles.
It didn't work, once again.
3 ml LB + Kanamycine + R6K freezer stock cells for new miniprep, because the template is the only parameter that was not completely new.
Monday 08/17
Preparation for clonetegration
As the R6K setup definitely doesn't work, the working PCRs can't even be reproduce and we're stuck at the first step of a long protocol, I decided to change the strategy completely. Two new primers were order in order to change the vector and use pIT5-KH for clonetegration.
The strain carrying pIT5-KH (u15.39) was put into culture for miniprep in LB Kan+.
New R6K gibson tentative
Using newly digested R6K backbone (poor concentration).
Name |
Concentration |
Size |
Volume |
|---|---|---|---|
A |
28.4 |
1172 |
1.22 |
B |
212 |
909 |
0.13 (0.5 actually) |
C |
34 |
992 |
|
R6K |
24 |
2276 |
0.86 |
This gives 0.01 pmol of each part.
As a control to measure undigested vector, 2.80 ul of linearized R6K vector + 17.2 ul of water.
gBlocks assembly
Name |
Concentration |
Size |
Volume |
|---|---|---|---|
A |
10 |
1172 |
1.18 |
B |
10 |
909 |
1.46 |
C |
10 |
992 |
1.13 |
R6K |
10 |
2276 |
0.86 |
That's 0.004 pmol of each (barely enough...).
Started at 4 pm, ended at 5 pm and put in ice.
PCR for checking the gibson
To know whether the Gibson Assembly really works or not, a bunch of PCR were made.
Junction 1: seqF1 + seqR4 = 799 bp Junction 2: seqF2 + seqR3 = 625 bp Junction 3: seqF4 + seqR1 = 808 bp Junction 4: seqF5 + jw06 = 829 bp
On 2 ul of Gibson product. Control : R2 + F3 = 508 bp
DT mix |
50 |
|---|---|
Template |
15 |
Water |
Then 18 ul of master mix + 1 ul of each primer.
95 (3') 95 (30) 52 (30) 72 (1 min) 72 (5')
Results: 10 ul + 2 ul LD were deposited on a gel. gBlock I, II, III, IV, + ; 100 bp+ ; PCR I, II, III, IV, + [junctions] All of the junctions seem present, but for the PCR sample they are way sharper. Strangely, the control PCR did not work so well.
18/08
Transformation of both Gibson Assembly product
(as at least all the junctions work...). Target: Electrocompetent Pir116 cells. All of the gibson product (~5 ul) was dialysed, along with the control (PCR R6K digested by DPN1 + water). 8 ul of dialyse product were taken back after 20 min. Pulse times: Control: 5.7 ms Gibson gblocks: 5.6 ms Gibson PCR: 5.5 ms
Plates with Kanamycine 20 ug/ml
100 ml LB agar + 40 ul Kanamycine.
19/08
Colibow transformation results
gBlock: nothing clear, a few number of what looks like colonies in the mess. PCR: Same with way more colonies. Control: negative.
They were re-streaked on LB + Kan 25 plates made for the occasion. A total of 16 colonies were tested.
Miniprep of pIT5-KH
Elution in 5* ul of water. It is very clean and the concentration is 167 ng/ul.
Colibow A and C PCR for pIT5 cloning
The goal is to make the A and C colibow parts compatible with pIT5-KH Gibson assembly. This PCR was performed by Constant.
Colibow A: Primers 176 and 83.
Colibow C: Primers 86 and 177.
Phusion master mix ("B+M") |
50 |
|---|---|
Primer F |
1 |
Primer R |
1 |
Colibow A/C |
1 ul |
DMSO |
3 |
Water |
44 |
Program 98 (30)
98 (10), 50 (30), 72 (2'20) * 37
72 (5')
Results Only a slight smear, no visible PCR product. It didn't work (gel not shown).
Digestion of pIT5-KH
The pIT5-KH vector was linearized by the restriction enzymes EcoR1 and Pst1. This allows excision of the pUC propagation ORI. There is still a R6K ORI that will not bee used here. Hence, the vector is no longer able to replicate and only the integrants will be replicated.
Plasmid |
50 ul |
|---|---|
FD Green Buffer |
5 ul |
FD EcoR1 |
3.2 ul |
FD Pst1 |
This was incubated at 37°C for 20 minutes and not inactivated, as the gel extraction followed immediately.
Gel extraction of digested pIT5-KH
Layout: 1 kb ladder, 3 merged wells with all of the digestion product.
Expected sizes: 1143 bp (to remove) and 5331 bp (to keep). The bands are present at the right size and strong.
After gel extraction, the product was eluted in 30 ul of pre-heated Elution Buffer.
Titration: 19 ng/ul.
Re-streaking of pColibow-R6K transformation product
To figure out if they're resistant or not. 12 LB Kan25 plates were made, with 200 ml of LB-agar and 100 ul of Kanamycine 1000x.
Transformation from PCR product: Two plates from the 200 ul plate, one plate from the 800 ul plate. Transformation from gBlocks: Two plates from the 800 ul plate.
Each of these plates is divided in 4 parts, with one colony on each.
20/08
Colibow R6K rescue
It seems that it is somewhat resistant to Kan but it is not clear: it only grew at the most cell-concentrated spots. It was put back in the incubator in case slower colonies would show up.
Colony PCR
A PCR with 4 primers was done: - We expect one band (jw005 + jw006 = 139 bp) if the backbone is present (unlikely due to the control plate being empty) - We expect two bands (jw005 + 96 = 714 bp and 92 + jw006 = 829 bp) if the right pColibow plasmid is present
Dream taq master mix |
90 |
|---|---|
jw05 |
9 |
jw06 |
9 |
primer 92 |
9 |
primer 96 |
1 |
Colibow A/C |
1 ul |
DMSO |
3 |
Water |
44 |
Then 17 ul of mix was added to 3 ul of cell resuspension solution. Four colonies were tested for each transformation (1,2,3,4 and I,II,III,IV).
The program was the default DreamTaq program with 53°C of annealing temperature.
Results: Absolutely nothing. Either the PCR didn't work, either the cells are not really resistant to kanamycin.
PCR for Colibow pIT5
Gradient PCR.
Primers A: 176 + 83 -> 1202 bp B: 84 + 85 -> 909 bp C: 86 + 177 -> 1004 bp 176 and 177 were diluted again from stock.
Name |
1x |
6.5x |
|---|---|---|
2x Phusion Master Mix |
50 |
325 |
DMSO |
3 |
19.5 |
Water |
35 |
44 ul of mix without primers and template + 5 ul of each primer + 2 ul of template. The templates were diluted again from the gBlocks.
Program:
98 (30)
98 (10), gradient (30), 72 (2'30)
72 (5')
It takes 3h30. Gradient: 60.2 (circled), 59, 57.1, 54.8
21/08
Results of Colibow pIT5 pcr
First gel: 1 kb ladder, A (circled), A, A, A, B (circled), B, B, B
Second gel: C (circled), C, C, C, 1 kb ladder
[colibow A B] [colibow C]
The PCR worked: We get the right bands (A: 1202, B: 909, C: 1004). As before, A and C have a low-size impurity.
Gel extraction of Colibow pIT5 parts
New gel: A, C, B (3 merged), 100 bp+ ladder, A (3 merged), C (3 merged). The well for B is huge. For each PCR, 50 ul of product was added to 5 ul of LD. The whole 200 ul don't fit in the triple ponds, so the first two ponds were used for A and C excess. [dirty]
This gel could not be used for extraction -> Loss of the product :(
Next time, merge 2 ponds and put 100 ul in it. Do not prop the comb, or not so high.
Colibow pIT5 pcr for better gel extraction
What worked best last time with the gradient?
Optimal annealing: - A: 60°C, 176 + 83 -> 1202 bp - B: 55°C, 84 + 85 -> 909 bp - C: 57°C, 86 + 177 -> 1004 bp
Name |
1x |
3x |
|---|---|---|
2x Phusion Master Mix |
50 |
150 |
DMSO |
3 |
9 |
Water |
35 |
105 |
Then to 88 ul of mix, 5 ul of each primer and 2 ul of template were added.
Program:
98 (30)
98 (20) Gradient (30) 72 (2'30) x35
72 (5')