Team:SPSingapore/home
 |
Kenneth Lim Kun Ming Research Interest: Bioinformatics, Genetic analysis Random fact: Is apparently Schrˆdinger's Biologist 
Clarice Hong Kit Yee Research Interest: genetics, RNA, cancer Past research projects: (can't rmb, tell you later) Current project: Differential roles of SALL4A and SALL4B in HCC
Wong Chi Yan Research Interest: Microbiology, molecular biology, proteomics Past research project: Genetic studies on Salmonella biofilms Current project: Role of fumarase and cysteine dehydrogenase in DNA damage response Random fact: Likes statistics and playing volleyball :) 
Yeo Xin Yi Research Interests: Neurobiology, Neurosciences Past research projects: Role of STAT in neuroinflammation and the pathogenesis of Alzheimer's Disease Current research projects: Synaptic plasticity threshold in hippocampal CA1 pyramidal neurons, Role of WNK1 in neuronal survival and development Random fact: Blah ~ 
Tan Yi Han Research Interests: Pathogens, Immunology, Synthetic biology Past research projects: Genetic studies on plant pathogenic fungi, Drug screening for Acute Lymphoblastic Leukemia Current project: Characterisation of Klebsiella pneumoniae isolates from liver abscess Random fact: Knits and bakes in spare time. =) 
Hee Yanting
Research Interests: RNA, genomics, epigenetics Past research projects: microRNA as a potential therapeutic strategy for colorectal cancer, Characterising LPA1 antagonists using calcium imaging Current project: The role and targeting of EZH2 in lymphoma Random fact: Plays the erhu and self-learning cello and classical guitar
Research Interest: Genetic Engineering, Cancer, Immunology Random fact: 500 Hours in Terraria 
Soong Yun Ting Research Interests: Proteomics, Past research projects: Genetic studies on Salmonella biofilms Current project: Identification of protein players in metastasis Random fact: Plays the harmonica 
Nguyen Duy Research Interest: Pharmacoinfomatics, Bioinformatics, Neurosciences Past research project: Genetic linkage analysis of asthma Current project: Neurodegeneration of Drosophila Melanogaster. Random fact: 0 hour in Terraria |
|---|
Adrian Tan Hong Ji
Leslie Gapter Dr. Leslie is trained as a molecular biologist and her dissertation focused on breast development and tumorigenesis. Leslie joined NUS in 2005 and her past research has focused on analyzing botanical products for breast and prostate cancer treatment. In 2008, Leslie became a full time scientific writer at the Mechanobiology Institute, Singapore, before moving into her current position as a Lecturer in 2010. Leslie teaches 'The Cell' module, which examines the universal mechanics and functions of cells from an integrated science perspective, for the Special Program in Science. |
Linda J Kenney Dr Kenney is a Professor of Microbiology at the University of Illinois-Chicago. Her laboratory studies two-component systems in bacteria that control gene expression at a single cell and nanometer level. |
Stuti Desai She joined the Kenney group in May, 2012 with a strong urge to amalgamate her doctoral training in studying silent genetic systems in enterics to decipher the behavior of bacteria under various environmental challenges. She obtained her doctorate from the Indian Institute of Science, Bangalore, India, under the guidance of Prof Subramony Mahadevan. She studied Biochemistry for my Master's degree and Chemistry, Physics and Zoology for her Bachelor's degree at the Maharaja Sayajirao University of Baroda, Baroda, India. |
Description
For description
Experiment and Protocol
For experiment and protocol
Result
For result
Design
For design
Team part
For Team part
Basic part
For basic part
Composite part
For composite part
Part collection
For part collection
|
esaGFP quorum sensing [Adrian, Clarice, Kenneth]
Invasin + Listeriolysin [YanTing, YunTing]
Maintenance
FNRgfp [YiHan, ChiYan]
|
|
|---|
Yi Han
Received 2 bacterial stab cultures, EsaR/I plasmid from addgene (CHL) and BBa_K299812 from iGEM HQ.
Streaked out on plates with amp.
Adrian
Transformed:
+Kit plate 1 9N Ba_K763002 chl
+Kit plate 4 13L BBa_E0040 amp
DNa was received in powder form in plates, and resuspended in 10ul ultrapure H2O respectively. Plates were stored in -20/
Yi Han
Plates cracked in incubator as they dried from lack of humidity.
Transfer to small incubator with beaker of water for humidity no single colonies for inv plasmid -> streak again.
Wrong antibiotic for EsaR/I plasmid-> streak out again
Yi Han
Inoculate single colony of invasin plasmid carrying bacteria in 3mL LB+amp
Transformation of 13L repeated with 1ul of DNA.
No colonies grew for 13L on all plates ->adjust incubator, make new media
Miniprep of inoculated bacteria for invasin plasmid, incubate sample in 37degC for 1h 20min
| RE of invasin plasmid | RE control |
|---|---|
| Rsal 1ul | Rsal 0 ul |
| EcoRI 1 ul | EcoRI 0 ul |
| INv plasmid 7.5ul | Inv plasmid 7.5 ul |
| H2O 35.5 ul | H2O 37.5 ul |
| NEB buffer 4.5 ul | Buffer 4.5 ul |
Xin Yi and Yi Han
Miniprep of EsaR/I plasmid for 4 colonies
Restriction digest for EsaR with XbaI/BamHI
| RE reaction |
|---|
| 5ul plasmid |
| 5ul buffer |
| 1ul XbaI |
| 1ul BamHI |
| Add H2O to 50ul |
Xin Yi
Sent EsaR clone 4 and INv-4 for sequencing.
YFP and GFP transformation results - no colonies for YFP
The GFP transformation repeated with 100ng of plasmid was sucessful.
4 colonies of gfp plasmid were inoculated in 3mL LB+amp and grown overnight.
Miniprep of gfp plasmids
RE digest with EcoRI and RsaI
RE digest indicated a very faint smaller band for colonies 2-4, and hence these were likely to be positive clones
Yanting
Inoculated 3mLS of Inv-4 and EsaR-4 plasmid carrying bacteria into 100mL LB+ appropriate Antibiotic
Cell culture-> HEK293 cells revived from freezing down appeared detached.
Yi Han + Yanting
Storage of bacterial glycerol stocks for Inv-4, EsaR4 in 25% glycerol
Yanting: grew HEK293T cells in T25 glask
Gel extract to clean up gfp plasmids which loading dye had accidentally been added to.
Yi Han
Miniprep of gfp plasmids, preparation of samples for sequencing
Yi Han
All gfp plasmids had a correct sequence
Yunting kept glycerol stocok for all, and inoculation of 3mL of gfp3 into 100mL LB+amp for midiprep
Yi Han + Yunting
Midiprep of gfp plasmid PCR of gfp with KpnI-gfp and XhoI-gfp primers
Yunting + Duy
Nanodrop of gfp product-> 595.5ng/ul
RE digest of EsaR vector with KpnI/XHoI
Gel electrophoreseis at 1000V for 30min
Gel extraction: 3.9ng/ul and 6.9ng/ul for Esa fragment and GFP --> low yield
Yunting
Gel extraction using Promega binding solution to melt gel, followed by thermo scientific kit
Adrian
Gel extraction optimisation
Hypothesised that the Binding buffer has a problem/DNA does not bind to column
1: 2X promega binding buffer volume
2: Increase incubation time for binding to 5min
Switch binding buffer to that of thermo scientific PCR purification kit
Use sodium acetate if available? TO facilitate stronger binding to column
Results
1: ~10ng/ul
2: ~9ng/ul
not succesful
further optimisation-> warm buffer, incubate for 5min
elute in 30/20ul smaller volumes
Yihan
1: Thermoscientific miniprep columns with 2XThermoscientific binding buffer
2: Thermoscientific PCR purification kit 2X buffer
3: Promega kit 2X buffer
Yihan
PCR (mastermix: 8)
| Reagent | Amount |
|---|---|
| PCR buffer | 10 ul * 8 = 8-ul |
| primers | 0.8ul, 0.8ul |
| DNA polymerase | 4ul |
| dH2O | 61.75 * 8 = 494ul |
| Templates | 5.55*7 = 38.75ul |
Digest more plasmid (Esa plasmid)
4 rxns ( KpnI/XhoI digest) 50ul each
| Reagent | Amount |
|---|---|
| Buffer | |
KpnI |
2ul |
XhoI |
2ul |
DNA |
34.8ul |
H2O |
141.2ul |
Yihan
PCR
RP_XhoI_GFP and FP_KpnI_GFP with GFP midiprep
For 15 reactions with control .: Mastermix * 17
| Reagent | Amount |
|---|---|
PCR buffer |
170ul |
primers |
1.7ul, 1.7ul |
dNTP |
34 ul |
DNA polymerase |
8.5 ul |
dH2O |
66.3*17 = 1127.1ul |
templates |
17ul |
total |
1360ul |
PCR protocol “GFP 1” (32 cycles)
GFP PCR product -> 448ng/ul
Gel extraction
Qiagen gel extraction kit at MBI
Esa gel band from 14/6
Nanodrop: 16.4 ng/ul, 260/280 = 2.60
Plasmid construction
-
RE digest (KpnI, XhoI)
-
3 Replicates of the following
| Reagent | Amount |
|---|---|
DNA |
2.6ul |
Buffer |
5ul |
H2O |
41.5ul |
KpnI |
0.5ul |
XhoI |
0.5ul |
Ligation (2x reaction) 40ul
| Reagent | Amount |
|---|---|
10X T4 DNA ligase buffer |
4ul |
Vector DNA (16ng/ul) |
100ng -> 6.25ul |
insert DNA |
75nl -> 12 ul |
T4 DNA Ligase |
2ul |
H2O |
16ul |
Note: ALL digested DNA in tube labeled lacGFP.ligation was used
Nanodrop of ligation: 1114.0ng/ul. 260/280 = 3.7
Transformation
Transformation of ligated esa-GFP plasmid into DH5\alpha cells
DH5\alpha ,<- unlabelled brown vial inside DH5\alpha box at -80
Plates spread at 11:40h
LB + chloroamphenicol
+4x (100ul)
+10x (40ul)
+20x (20ul)
+LB - 20x (20ul)
remaining transformed cells (~220ul) are kept at 4C
--> labeled as placGFP in brown tube
Oservation: only 4x placGFP plate has colonies (7)
spread one new LB + chlor plate with 200ul of transformed bacteria
picked 6 colonies to grow for miniprep in LB + chl liq media
Conclusion:
+protocol works
+optimization for increase vol needed
cloning of synparts in amp vector
+comes as 4mg dry DNA
+40ul of DI/RNAse free H20
+for transformation, 150ml on wed
Unknown
Miniprep of placGFP followed by RE digest (Kpn, XhoI): 50 ul total
| Reagent | Amount |
|---|---|
Buffer |
2.5ul |
KpnI |
<ILLEGIBLE> |
XhoI |
<ILLEGIBLE> |
DNA |
10 |
H2O |
12025 |
Colony PCR for synparts
+ Failed
+ No specific <illegible> produced+ Might need optimization
Yihan
RE digest (XhoI, KpnI) of esa and GFP
Yunting
Gel electrophoresis (100V, 40min)
+ Lane 2: gpf: no bands
+ Lane 3: 100bp ladder
+ Lane 4: blank
+ Lane 5: esa: 2 bands
+ Lane 6: 1kb ladder
+ Lane 7:blank
<Picture of gel>
Optimizing gel extract protocol
+ RE GFP from PCR (directly RE)
+ promega agarose 1% gel
+ add NaAC in binding buffer
Result:
+ yield for cut plasmid was 12.8ng/ul
+ GFP was 8.6ng/ul
Ligation reaction 6 reactions
| Reagent | Amount |
|---|---|
Buffer |
12ul |
Vector |
30ul |
Insert |
30ul |
+ 6x ligation result transformed into competent DH5\alpha 20 ul, 50ul, 100ul plated on LB + chl
Yunting
Ligation of GFP tester plasmid.
Performed 4x ligation using RE- digested esa and GFP (CY, 22/6). Ligation rxn at room temperature for 30min instead of 10min.
Included vector-only and insert-only controls.
Stored in -20deg.
Will run gel tmr. Insert only control should be same size as gfp product. Same for the other control. Can try to plate vector only to see re-ligation??
Nanodrop:
PlacGFP - 642.8ng/ul. 260/280=3.89
Vector ctrl - 756.6ng/ul. 260/280=4.11
Insert ctrl - 557 ng/ul. 260/280=3.86
Yanting
Ran 0.8% pre-cast gel at 100V for 45min.
10ul of each sample to 2ul of loading dye.
Gel lanes:
100bp; uncut esa (used esa4 from -20);
pLacGFP; vector ctrl; insert ctrl; 1kb.
[YH] Re-run gel. 35ul of each sample. No bands.
<insert gel picture>
RE of esa and Gfp pcr product.
Gel electrophoresis.
Cast a thick 1% gel (60ml) with combined wells. [Don't need to cast thick gel next time, takes too long to melt]
Gel run at 100V, 45min. Lanes: 100bp, esa, gfp 1&2, 1kb
Image after cutting is also saved.Gel extraction of RE esa & gfp.
Used Promega kit, loaded both gfp bands into one column. Eluted with 30ul water for 5min before centrifugation.Nanodrop:
Esa- 37.7ng/ul. 260/280= 1.83
Gfp - 25.1ng/ul. 260/280= 1.84
Overnight ligation
6x ligation:
| Reagent | Amount |
|---|---|
Buffer |
6ul |
Vector (37.7ng/ul) |
50ng = 7.8ul |
Insert (25.1ng/ul) |
37.7 ng = 6.6ul |
H2O |
87.6ul |
Ligase |
6ul |
[Chi Yan + Yunting] Midiprep of EsaR plasmid
[Yihan Yunting] Gel electrophoresis of inv colony PCR
insert picture gel
[Xinyi] Colony pcr for placgfp for >18 colonies
insert gel picture
[Adrian] Gfp expression observed using gfp filter with the SPS microscopeYanting
Subculture of HEK 293
P4 -> p5
Grow/split into 150mm dish for freezing on sat(20/6)
-->30ml DMEM + 1ml cells
90mm dish for maintenance (buffer)
-->10ml DMEM + 30ul cells
Cells combined from 3 90mm dishes
Yanting
Freezing of HEK293
P6
Cells from a 150 mm dish and 90mm dish
Adrian
Prepared restreak of inv/hly plasmid from original stab culture
Yanting and Yunting
Colony PCR of invasin
Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7).
Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.
Also constituted dNTP w 2.5mM of each atcg triphosphate.
Yanting
100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”.
When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.
Yunting
Placed BBa_K299812 plate in incubator for overnight growth.
Yanting and Yunting
Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.
Primer conc=0.5 uM, template DNA dissolved in 10ul h20.
Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.
100V for 34min.
Tubes 1-2: FP-prefix, RP-suffix.
3-4: FP-VF2, RP-VR.
5-6: FP-prefix, RP_Inv_M2.
7-8: RP-suffix, FP_Inv_M1.
No template control with FP-prefix, RP-suffix.
[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].
Gel image saved as “7.17_inv colony.sgd” (handphone pic below).Results: Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.
Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time).
Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.
No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.
Yihan
Inoculation of positive colonies in liquid culture. 3mL and shaking incubation.
Yunting
Miniprep of positive colonies from 30h liquid culture.
Eluted in 50ul elution buffer and stored at -20.
C= 225.9ng/ul. 260/280=1.86
D= 297.7ng/ul. 1.87
Yunting
Colony PCR with thermogradient: 14rxn
| Reagent | Amount |
|---|---|
H2O |
70ul |
dNTP |
14ul |
MgCl2 |
35ul |
Taq |
3.25ul |
primers (forward + reverse) |
14ul*2 |
Template DNA |
14ul |
C/D-1,2: Col3.
C/D-3,4: Col12.
D-5,6: Col 9.
D-7,8: Col 10.
Negative control (no template): Col 8.
Gel ran for 80V, 1h.
D-1,2: VF2, VR.
D-3,4: FP-prefix, RP-suffix.
D-5,6: FP-prefix, FP_M2.
D-7,8: FP-prefix, FP_invF.
C-1,2: VF2, VR.
C-3,4: FP-prefix, RP-suffix.
Results Notes:
Too much template DNA (~250ng). Separate the universal primers (to avoid differing extension time).
Yanting
RE digest of inv/hyl plasmid with EcoRI and PstI for 2 hours at 37oC.
Lane 1-4: 1kb ladder, 100bp ladder, RE of colony C, RE of colony D.
Size is correct: 4kb main band (inv+hly part) and 2kb (plasmid backbone). These plasmid DNA should have the part.
Yanting and Yunting
Colony PCR, used with temperature gradient to vary annealing temperature. 10rxn
| Reagent | Amount |
|---|---|
| 5x buffer | 50ul |
H2O |
127.5ul |
dNTP |
50ul |
MgCl2 |
10ul |
Taq |
3.25ul |
primers (forward + reverse) |
14ul*2 |
Template DNA |
14ul |
100V for 45min (can run for longer).
Result:
Lane 1: 1kb ladder; lane 2: 100bp ladder;
lane 3-7: FP prefix + RP suffix (5 repeats with increasing annealing temperatures) has 2 bands ~800 bp & 100-200bp (probably non specific bands, will lower # of cycles in future, use higher annealing temp, lower annealing time).
Expected size of inv+hly part is 4.1kb.
lane 8-9: VF + M2 has a thick band 800-900bp.
Expected size is 600+130bp (VF adds ~130bp compared to FP_prefix) .: doesn’t seem to be correct….
lane 10-11: VF + inv F has no bands. Expected is at least 200bp (bcos universal primers).
lane 12: VR + inv F seems to have a small band <100bp. Non specific amplification?
Expected is 1.5+0.1 kb (from VR).
Yanting
RE with XbaI and PstI
| Reagent | Amount |
|---|---|
| Restriction enzyme | 2ul |
| Buffer | 5ul |
| DNA (4x of miniprep=74.5ng/ul) | 13.4ul |
| H2O | 29.6ul |
Incubate at 37degC for 2.5h (1130-1400)
Results: Gel loaded 1kb ladder, uncut, RE digested. 100V for 1h.
Plasmid doesn't have XbaI site - RE digested DNA is a linear 6kb band.
Yunting
Cast a big gel. Stored in 4 deg. [Used up 26/6]
Pre-cast two 0. 8% gels. Stored in 4deg. [Used up on 24 & 25/6]
Chi Yan and Yunting
Midiprep of esaR plasmid.
Airdry ON.
Transformation of ligated FNRgfp plasmid into dH5alpha
Cleaned waterbath, de-iced the fridge.
Today, we also did a spring cleaning for the lab
Adrian
BBPrefix_esaRBS PCR
| Reagent | Amount |
|---|---|
H2O |
221ul |
Buffer |
80ul |
MgCl |
32ul |
dNTP |
32ul |
Forward Primer_Biobrick Prefix |
16ul |
ORP_esaRBS_fragsyn |
16ul |
synpart_BBP_esaRBS |
1ul |
gotaq |
2ul |
total |
400ul |
success-> PCR purification
esaRBS_GFP_BBsuffix
| Reagent | Amount |
|---|---|
H2O |
237ul |
Buffer |
80ul |
MgCl2 |
32ul |
dNTP |
32ul |
Reverse primer_BB_suffix |
?? |
ORP_esaRS_GFP |
16ul |
Plac_GFPPLASMID |
1ul |
gotaq |
2ul |
failed -> troubleshooting-> new OFP_esaRBBS_GFP
Redid 30/6 with new primers
success with new primers-> fusion pcr
PCR with inv primers (adrian’s primers)
Clarice
Fusion PCR with esaRBS, GFP
| Reagent | Amount |
|---|---|
H2O |
104.07ul |
Buffer |
40ul |
MgCl2 |
16ul |
dNTP |
16ul |
Forward primer_BB_prefix |
8ul |
Reverse primer_BB_prefix |
8ul |
400ng esaRBS |
2.13ul |
400ng esaRBSgfp |
4.8ul |
gotaq |
1ul |
Total |
200ul |
annealing temp 50degC
Gel electrophoresis: looks correct-> PCR Purification
RE digest of esaRBS+GFP
| Reagent | Insert | Vector |
|---|---|---|
| Buffer | 2ul | 2ul |
| EcoRI/PstI | 1ul | 1ul |
| Template(2ug) | 5ul | 4ul |
| dH2O | 11ul | 12ul |
| total | 20ul | 20ul |
Clarice
COlny PCR with different colonies (15 colonies)
FP_BB_Prefix and RP_BB_Suffix
Success
Clarice
Colony PCR successful - inouclated colony 2,3,4,12 in 3mL LB
PCR-FNRsynpart BBP
| Reagent | Amount |
|---|---|
| dH2O | 221ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTPs | 32ul |
| FP_RNE_PromoterBBP | 16ul |
| GFP_FNR_Prom_GFP | 16ul |
| synpart FNR | 1ul |
| gotaq | 2ul |
Clarice
Verify minipreppped esaGFP plasmid
| Reagent | Amount |
|---|---|
| Buffer | 2ul |
| EcoRI | 1ul |
| Pst1 | 1ul |
| Plasmid | 5ul |
| dH2O | 11ul |
| total | 20ul |
Clarice
Transformatin of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)
plate O/NYihan
Ran gel of gfp plasmid EcoRI/PstI, took out gel slice for vector - 4kb
Gel extraction:
+gfpvector->38.7ng/ul fragment-> direction purification 226.4ng/ul
+LIgation reaction (5:1) 6X
| Reagent | Amount |
|---|---|
| 300ng vector | 7.8ng/ul |
| 531.2ng of insert | 2.4ul |
| Buffer | 12ul |
| Enzyme | 6ul |
| H2O | 91.8ul |
ligate for 2 hours at 16 hours transform, plate, grow ON
Yihan
No colonies-> ligation did not work
Recalcualte ligation reaction (3:1),7x
350ng vector->9ul vector
446.3ng insert-> 2ul 7ul
ligase 110
H2O
12ul buffer
Yihan and Clarice
colonies for EsaGFP
grew Colony PCR for 14 colonies
Unsuccessful-> no bands observed
Yihan
Trying out an idea for workshop
Trial for blue/white screen
Streak out pGFPuv and pGEMT on plate with amp added spread 40ul of 0.1M IPTG and 30ul of 5%xgal, dried and on plate without amp
Yihan
Ran gel with FNR Pcr and gfp pcr
size of pcr product was correct but gel picture was not saved
FNR Product was pcr purified
Plasmid extraction for colony 2,3,4 of esaGFP - > 2,3 were sent for sequencing and primers did not bind, chromatogram was messed up.
Fusion PCR for FNRGFP:
| Reagent | Amount |
|---|---|
| dH2O | 218ul |
| 10X buffer | 80ul |
| MgCl2 | 23ul |
| dNTP | 32ul |
| Template FNR PCR (40ng) | 3ul |
| gfp PCR (400ng) | 1ul |
| FP_BB_Suffix | 16ul |
| RP_BB_Suffix | 16ul |
| gotaq | 2ul |
Chi yan
Gel was run for fusion pcr size was correct
Clarice RE digest:
| Reagent | Amount |
|---|---|
| PstI | 1.5ul |
| EcoRI | 1.5ul |
| Buffer | 4ul |
| Template | 3ul |
| H2O | 20ul |
| Total | 40ul |
Chi yan
Ran gel for gfpp plasmid
gel purificaiton and extraction of 4kb fragment
| Reagent | Amount |
|---|---|
| ligation reaction (2X) | 40ul |
| Buffer | 4ul |
| 100ng of DNA vector | 3.4ul |
| 157ng insert | 16ul |
| enzyme | 2ul |
| H2O | 14.6ul |
Yihan
no colonies for FNRgfp plasmid
Inv plasmid verification
| Reagent | Amount |
|---|---|
| buffer | 1ul |
| EcoRI | 0.5ul |
| invasin plasmid | 0.5ul |
| dH2O | 8ul |
| Total | 10ul |
Gel extraction RE digest of EsaR-GFP plasmid
| Reagent | Ligation | Control |
|---|---|---|
| Vector (45ng) | 1ul | 1ul |
| Insert | 1ul | 1ul |
| Buffer | 1ul | 1ul |
| dH2O | 6ul | 7ul |
| ligase | 1ul | 1ul |
Transformation of FNRgfp anaerobe jar
E. coli grew in both conditions p putida-> some growth in anaerobe chamber proper streak plate in aerobic conditions
packet runs out after 16hours
Yihan and Yunting
LIgation for FNRgfp (4X)
| Reagent | Amount |
|---|---|
| 200ng Gfp plasmid | 4.36ul |
| 297ng insert (7:1) | 10.3ul |
| Buffer | 53.34ul |
| T4 ligase | 4ul |
Trial run of anaerobe chamber:
+ open sachet to decrease O2 at 3.30pm
+ takes 2.5h to activate
place streak plate of p putida a strict aerobe and e coli, facultative aerobe in chamber at 30deg C to grow O/N
P. putida is an abligate aerobe and if chmaber works ,it will not grow
E. coli should grow in both conditions
controls grown outside chamber
Yihan
FNRgfp-> no colonies after transformation
religation (4X reaction)
| Reagent | Amount |
|---|---|
| 200ng GFP plasmid | 4.4ul |
| 2125ng of insert | 8ul |
| T4 ligase | 4ul |
| H2O | 55.6ul |
transformation of FNR gfp into 20ul of BL21
Yihan
No colonies grew
Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder
Chi Yan
RE digest of FNR-GFP fusion PCR with EcoRI and PstI
| Reagent | Amount |
|---|---|
| EcoRI | 1ul |
| PstI | 1ul |
| Buffer | 5ul |
| FNR-GFP from 12/7 in RIP box 1ug | 2.5ul |
| H2O | 40.5ul |
| Total | 50ul |
Direct purification using Promega kit
Overnight ligation (4X reaction)
| Reagent | Amount |
|---|---|
| 200ng of GFP plasmid | 4.4ul |
| 400ng of insert (5:1) | ? |
| T4 ligase | 4ul |
| T4 ligase buffer | 8ul |
| H2O | ? |
200ng of gfp plasmid (4.4ul)
400ng of insert (5:1) (?ul)
4ul T4 ligase
8ul T4 ligase buffer
? H2O
Yihan
Ncbi search in BL21 genome revealed that it does have FNR transcriptional regulator
http://www.ncbi.nlm.nih.gov/nuccore/CP010816.1
In dH5alpha as well
http://www.ncbi.nlm.nih.gov/gene/945908
However no direct data on our specific strains of dH5alpha and BL21
Adrian 1_8
| PCR | reaction |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTPs | 32ul |
| VF2 | 16ul |
| VR | 16ul |
| GoTaq | 2ul |
Cycle conditions 95ºC (3min) -> 95ºC (30s) -> 60ºC (30s) -> 72ºC (1.5min) -> 72ºC (5min) for 25 cycles Result: FP_Biobricks_Suffix and RP_Biobrick_Suffix primers are contaminated -> rediute from stock Maintenance Red Workshop Protocol
| To make Fragment 1 for the | workshop |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| Primer 1 (FP_retarded) | 16ul |
| Primer 2 (RP_retarded) | 16ul |
| GoTaq | 2ul |
| GFP plasmid | 1ul |
| To make Fragment 2 for the | workshop |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| Primer 1 (OFP_esaRBSver2) | 16ul |
| Primer 2 (RP_VR) | 16ul |
| GoTaq | 2ul |
| GFP plasmid | 1ul |
Cycle conditions 95ºC (3min) -> 95ºC (30s) -> 60ºC (30s) -> 72ºC (2.5min) -> 72ºC (10min) for 25 cycles
Recreating backbone
| pSB1A2 | EcoRI/PstI |
| H2O | 22ul |
| pSB1A2-GFP | 10ul |
| Buffer | 4ul |
| EcoRI | 2ul |
| PstI | 2ul |
| Total | 40ul |
| Fusion PCR for | workshop |
| H2O | 111ul |
| Buffer | 40ul |
| MgCl2 | 16ul |
| dNTP | 16ul |
| OFP_esaRBS_GFP_ver2 | 8ul |
| ORP_XhoI_retarded | 8ul |
| GoTaq | 1ul |
| Fragment 1 | 1ul |
| Fragment 2 | 1ul |
95ºC (3min) -> 95ºC (30s) -> 60ºC (30s) -> 72ºC (1.5min) -> 72ºC (10min) for 25 cycles
| EsaR Master Plate | Test |
| Colony PCR | |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| VF2 | 16ul |
| VR | 16ul |
| GoTaq | 2ul |
| 400ul |
For 10 colonies
| 10x T4 DNA ligase Buffer | 1ul |
| Vector | 1ul |
| Insert | 5ul |
| H2O | 10ul |
| T4 DNA ligase | 1ul |
Reactions were incubated for 30min at room temperature Transformation pSB1A2 esaRBSGFP pSB1A2 RNG GFP Control cut pSB1A2
Adrian 17/7
Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)| 10x T4 DNA ligase Buffer | 1ul |
| Vector | 1ul |
| Insert | 5ul |
| H2O | 10ul |
| T4 DNA ligase | 1ul |
Reactions were incubated for 30min at room temperature Transformation pSB1A2 esaRBSGFP pSB1A2 RNG GFP Control cut pSB1A2
Adrian 18/7
Vector dimer check 8 colonies were selected from the control plate (26/7)| PCR | mastermix |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| FP_Biobricks_Prefix | 16ul |
| RP_Biobricks_Prefix | 16ul |
| GoTaq | 2ul |
| Total | 400ul |
The control plate had plasmids with a 800bp insert Gel extract was performed on a 2kb band Ligation Troubleshooting
| Ligation | Mastermix |
| H2O | 222ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| FP_Biobricks_Suffix | 16ul |
| RP_Biobricks_Suffix | 16ul |
| GoTaq | 2ul |
| Total | 400ul |
Colony PCR 8 colonies were selected from esaR and RNG each, total 16 colonies
| PCR | Mastermix |
| H2O | 444ul |
| Buffer | 160ul |
| MgCl2 | 64ul |
| dNTP | 64ul |
| FP_Biobricks_Suffix | 32ul |
| RP_Biobricks_Suffix | 32ul |
| GoTaq | 4ul |
| Total | 800ul |
Ran gel Lanes Vector Backbone (EcoRI/PstI Control Ligation mix esaR ligation mix RNG ligation mix T4 Ligation buffer Blank
Adrian 26/7
BBPprefix_esaRBS PCR synthesis| PCR | Reaction |
| H2O | 22ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| FP_Biobricks_Prefix | 16ul |
| ORP_esaRBS_fragsyn | 16ul |
| synpartBBP_esaRBS | 1ul |
| GoTaq polymerase | 2ul |
| Total | 400ul |
| esaRBS_GFP_BBsuffix | |
| H2O | 221ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTP | 32ul |
| RP_BiobricksSuffix | 16ul |
| OFP_esaRBS_GFPver2 | 16ul |
| pSB1A2_BBa_0040 | 1ul |
| GoTaq | 2ul |
| Total | 400ul |
| PCR for | esa |
| H2O | 220ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTPs | 32ul |
| FP_BB_Prefix | 16ul |
| RP_BB_Suffix | 16ul |
| BBPrefix_esaRBS | 1.2ul |
| esaRBS_GFPBBSuffix | 0.5ul |
| GoTaq | 2ul |
| Total | 400ul |
| PCR for | RNG |
| H2O | 220ul |
| Buffer | 80ul |
| MgCl2 | 32ul |
| dNTPs | 32ul |
| FP_BB_Prefix | 16ul |
| RP_BB_Suffix | 16ul |
| BBPrefix_esaRBS | 1.5ul |
| esaRBS_GFPBBSuffix | 0.5ul |
| GoTaq | 2ul |
| Total | 400ul |
Adrian Clarice
REdigest of esaR and RNF after PCR purification and gel extraction
| esaR-gfp RE | digest |
| Bffer | 2ul |
| PstI | 1ul |
| EcoRI | 1ul |
| 2ug Template | 5.4ul |
| H2O | 10.6ul |
| Total | 20ul |
| RNG RE | digest |
| Bffer | 2ul |
| PstI | 1ul |
| EcoRI | 1ul |
| 2ug Template | 3.9ul |
| H2O | 12.1ul |
| Total | 20ul |
| Ligation of pSB1A2 with esaR and | RNG |
| 10X T4 Ligase Buffer | 2ul |
| Vector (pSB1A2 EcoRI/PstI) | 1ul |
| Insert (esaR and RNG) | 5ul |
| H2O | 11ul |
| T4 DNA ligase | 1ul |
| Total | 20ul |
Ligation for 30min at room temperature
Clarice 19/7
Colony PCR for RNG and esaR-GFP colonies from master plate
| RNG | (10X) |
| H2O 13.8 + colony | each |
| Buffer | 50 |
| MgCl2 | 20 |
| dNTPs | 20 |
| Primer 1 | 10 |
| Primer 2 | 10 |
| Gotaq | 2 |
| esaGFP | (9X) |
| H2O | 45 |
| Buffer | 18 |
| MgCl2 | 18 |
| dNTPs | 9 |
| Primer 1 | 9 |
| Primer 2 | 9 |
| GoTaQ | 1.8 |
CY 8/8
8 minipreps of 4 clones from BL21 pNirB+gfp and 4 clones from dH5alpha pNirB+gfp
| RE | digest |
| EcoRI | 9ul |
| PstI | 9ul |
| Cutsmart Buffer | 45ul |
| DNA of 1ug | 6.7ul |
| H2O | 36.3ul |
Result after running gel: All clones are positive for pNirB+gfp
CY 13/8
Invasin + Listerolysin blue
Inoculated 4 colonies of BL21 transformed with the inv+hly clone D.
CY 14/8
Invasin + Listerolysin blue
Miniprep of the inv+hly clones
| RE digest with | EcoRI/PstI |
| EcoRI | 5ul |
| PstI | 5ul |
| Buffer | 25ul |
| DNA 1ug | (4ul) |
| H2O | 11ul |
| Total | 50ul |
CY 19/8
Colony PCR for pEFYP plated on (17/8) Pcr for pNirBgfp as with (18/8) with pNirB-gfp primers, Biobricks prefix and suffix primers
| PCR Master mix For | pEYFP |
| H2O | 13.25ul |
| Buffer | 5ul |
| dNTP | 5ul |
| F/R primer | 5ul |
| 2.5mM MgCl2 | 12.5 |
| GoTaq | 11.25ul |
PCR Master mix for pNirBgfp with pNirB-gfp primers, and Biobricks Prefix and Suffix Primers (Melting temperature increased to 53degrees) 3ul of plasmid in each tube
| PCR Master mix for pNirB-gfp primers and BB prefix/suffix | primers |
| H2O | 101.25ul |
| Buffer | 45ul |
| dNTP | 9ul |
| Forward Primer | 9ul |
| Reverse Primer | 9ul |
| 2.5mM MgCl2 | 22.5ul |
| GoTaq polymerase | 2.25ul |
CY 21/7
Ran gel for 20/7 colony pcr for FNR gfp 1kb, 100bp, colonies negative control
CY 22/7
Anaerobic promoter Brown
PCR to test 'FNR-GFP plasmid'.
Colonies 1-5 from 20/7 + negative control 3 sets of primers FP_BB Prefix, RP BB Suffix GFP-F, GFP-R FP_FNRPromoter_BBP, ORP_FNR_Promoter GFP
For each reaction (6X)
H2O 73.5ul
dNTPs 6ul
Forward/Reverse Primer 6ul/6ul MgCl2 15ul
Taq polymerase1.5ul
For each plasmid 1ul
Buffer 30ul
CY 24/7
Ligation of Cut FNRGFP (17/7) with cut GFP vector
| 1X | reaction |
| Buffer | 2ul |
| 200ng vector | 1.1ul |
| 3:1 | 256.5ng |
| Water | 3.4ul |
| T4 DNA ligase | 1ul |
| Total | 20ul |
Incubation at room temperature for 2h Transformation into 10ul BL21 competent cells
CY 27/7
RE of extracted product with EcoRI/PstI for 300ng of DNA
| RE | (1X) |
| FNR-gfp | 0.9ul |
| EcoRI | 1ul |
| PstI | 1ul |
| Buffer | 2ul |
| Water | 15.1ul |
| Total | 20ul |
CY YH
When gel was run, primer dimers and 700-800bp band were present in the negative control with no template added
Fresh buffer, MgCL2, dNTP and fresh diluted primers were used to repeat colony PCR.
Diluting dATP, dCTP, dGTP, dTTP to 2.5mM
Repeated colony pcr with Prefix-suffix primers using TC pipettors
HYT 15/7
Invasin + Listerolysin blue
RE digest of the miniprepped inv/hly plasmid with EcoRI/PstI from (20/7)
Tube C-> 226ng/ul
Tube D-> 298ng/ul
| RE | reaction |
| Buffer | 3ul |
| Plasmid 4ul | each |
| EcoRI | 1ul |
| PstI | 1ul |
| H2O 21ul | each |
| Total | 30ul |
incubated at 37degC for 2h Add 6X loading dye to stop reaction in both tubes Ran gel (1kb, 100bp, cut vector C, D)
CY 24/7
Anaerobic promoter Brown
Ligation of Cut FNRGFP (17/7) with cut GFP vector
| 1X | reaction |
| Buffer | 2ul |
| 200ng vector | 1.1ul |
| 3:1 | 256.5ng |
| Water | 3.4ul |
| T4 DNA ligase | 1ul |
| Total | 20ul |
Incubation at room temperature for 2h Transformation into 10ul BL21 competent cells
XY 18/7
Anaerobic promoter Brown
Transformation of FNRGFP ligated product into BL21 (from CY 17/7)
1. 3ul pUC19 control +10ul BL21
2. 20ul Ligation product + 20ul BL21
3. 5ul Ligation product + 20ul BL21
Plated on LB+amp plates
40ul of transformed bacteria in SOC media on LB+amp
20ul of transformed bacteria in SOC media on LB alone
YH 2/8
Inoculated colony 3,7 of FNR GFp selected positive clones for miniprep
YH 3/8
Anaerobic promoter Brown
Miniprep of colony 3, 7 and sent for sequencing with GFP-R and FP_VF2 -> results show there is GFP but no FNR.
YH 6/8
Transform pNirB+gfp from the Biobricks Registry into BL21 and dH5alpha
YH 9/8
OD600 of 1 = 10^8 cells/cm^3
| OD600 of 10X | dilution |
| BL21 clone 1 0.013 -> 1.04x10^8 | cells/cm^3 |
| BL21 clone 2 0.094 -> 7.52x10^8 | cells/cm^3 |
| dH5alpha clone 1 0.054 -> 4.32x10^8 | cells/cm^3 |
| dH5alpha clone 2 1.123 -> 9.84x10^8 | cells/cm^3 |
| BL21 0.084 -> 6.72x10^8 | cells/cm^3 |
| dH5alpha 0.046-> 3.68x10^8 | cells/cm^3 |
| BL21 + pGFPuv 0.036 -> 2.88x10^8 | cells/cm^3 |
The cultures were diluted 100X and 500X in a volume of 200ul in a 24well plate and grown in the anaerobic chamber at 30degrees and 225rpm for 2, 4, 6, 8 hours
Replicating the iGEM Valencia Team - growing cultures under sterile oil (filtered through 0.22um filter) 0.5mL of stationary culture + 2.5mL LB, with 1mL of sterile oil added above
Grown at 28 degrees, 200rpm for 2 days
Results:
GFP signal is expressed in cultures with the anaerobic sensitive promoter grown in anaerobic conditions overnight, but signal was weak.
After 6 hours in anaerobic growth, the BL21 + pNirB clone 1 had highest GFP signal when observed with the GFP microscope.
BL21 strain had no signal
After 24 hours in anaerobic conditions, dH5alpha had highest signal compared to control
Control - colonies picked directly from plates (aerobic conditions) had no GFP signal
After 2 days there was no gfp expression
YH 14/8
Seeded cells for invasion assay
BL21 + inv-hly clones correct after running gel for digest of the plasmids with EcoRI and PstI
YH 15/8
Invasin + Listerolysin blue
Invasion assay with HEK293T cells and BL21, and BL21+inv-hly plasmid on 15/08/15
Rationale: The invasin gene in the invasin+listerolysin plasmid should remain intact and be expressed, leading to an invasion phenotype
Objective: Screen invasion phenotype of BL21 and BL21+invasin-listerolysin Biobricks part
Experiment details
Cells were passage 2 Seed 0.5mL of 5x10^5 HEK293T cells/mL and 1x10^6 in wells of 24-well plates, grow overnight.
Determine cell confluency with microscopy the next day - 80-90% confluency
All strains were grown overnight in 3mL LB broth
For 5x10^5 cells
100ul of 10^9 cells/mL was used for moi 200
100ul of 2X dilution of 10^9 cells/mL was used for moi 100
100ul of 4X dilution of 10^9 cells/mL was used for moi 50
100ul of 5X dilution of 10^9 cells/mL was used for moi10
Result Lawn on all plates HEK293T cells detach too easily.
Grow for 24 hours in the future and do minimal, and gentle washing. For next experiment, 0.5x10^6 and 1x10^6 cells wre seeded 1000ug/mL kanamycin for 1 hour is sufficient for kill step
no contamination in uninfected control
There is invasion in background BL21 strain as well
All mois showed high percentage of infection
In future use moi 10:1 and plate up 10^2 to 10^5 dilution for countable colonies
YH 17/7
For plates on LB alone there was a lawn
For pUC19, the transformation worked, and separated colonies were produced
No colonies were produced for the FNR-gfp plasmid
YH 18/8
PCR for the clones of pNirB-gfp from B21(1-4) and dH5alpha (1-4)with pNirB-gfp-F/R primers
5ul plasmid, 5ul H2O in each tube
PCR Mastermix
dNTP 8ul
MgCl2 20ul
Taq Polymerase 2ul
Buffer 40ul F/R
primers 0.8ul each
H2O 40ul
YH 19/7
inoculated colonies C,D for invasin plasmid in 3mL LB+amp at 1.30pm
Transformed remaining 40u ligation reaction for FNR gfp into 10ul BL21
Transformed 100ng pGFPuv plasmid into 10ul BL21
Poured new LB+amp plates
Plated 20, 40, 100ul of transformed bacteria in SOC media on plates
YH 20/7
pGFPuv transformation worked!
Single colony for FNR-GFP + 4 more from plating on 19/7
Sent FNR-GFP fusion product for sequencing with RP-Biobricks Suffx - result there is no FNR but there is no GFP
Colony PCR for FNR gfp (Colonies 1-5, (-) control)
| Colony PCR | (6X) |
| H2O | 19.5ul |
| Buffer | 10ul |
| 6ul | dNTP |
| 6ul FP_Biobricks | Suffix |
| 6ul RP_Biobricks | SUffix |
| 15ul | MgCl2 |
| 1.5ul Taq | Polymerase |
YH 21.7
Redid colony pcr for above as negative control had a positive band - contamination of PCR
negative control still has band - reagents contaminated
YH 22/7
Miniprepped colonies 1-5 for FNR-gfp plasmid
Did EcoRI/PstI digest
| Digest for mastermix | (5X) |
| Buffer | 10ul |
| EcoRI/PstI | 2ul |
| H2O | 60ul |
| Total 20ul per | tube |
| 400ng plasmid in each | tube |
Ran gel for RE samples, none were postive clones
YH 26/7
No colonies for FNRgfp
| Hotstart fusion PCR (8X | reaction) |
| 10X Buffer | 80ul |
| dNTPs | 16ul |
| FP Biobricks Prefix | 8ul |
| RP Biobricks Suffix | 8ul |
| FNR Pcr product | 12ul |
| GFP PCR product | 4ul |
| MgCl2 | 3ul |
| H2O | 668ul |
YH 27/7
Ran gel with cut vector and cut PCR product
1kb 100bp cut vector (wells 3-5) FNR-gfp (wells 6-8)
However, PCR product was not detectable
| RE digest for FNRgfp | EcoRI/PstI |
| 150ng PCR | 5ul |
| Buffer | 2ul |
| EcoRI | 0.5ul |
| PstI | 0.5ul |
| H2O | 12ul |
| Total | 20ul |
Gel extracted Ligation reaction was performed overnight
| Ligation reaction | (1X) |
| 100ng vector | 8.3ul |
| 85ng insert | 16ul |
| T4 ligase | 2ul |
| Buffer | 4ul |
| H2O | 9.7ul |
YH 28/7
Trialling transformation of 10ul BL21 with 100ng pGFPuv plasmid for workshop.
Using 200ul LB broth for the growth in 1hour step
10ul BL21 + 10ul plasmid Heatshock for 300s
Shake for 1hour at 37 degC 225rpm
plated 40ul on LB, 40ul on LB+amp plate
Transformation of ligation reaction into BL21 with control of cut vector (100ng) into BL21
plated 40ul on LB+amp plate, 20ul on LB plate
YH 29/7
Colonies on pGFPuv plate with amp -> LB works for reviving bacteria
small colonies with FNRGFP plasmid
YH 30/7
12 colonies grew for FNRGFP plate
no colonies on control with cut vector
Colony PCR to screen 12 colonies and negative control using universal primers
| PCR Mastermix | (13X) |
| H2O | 42.25ul |
| PCR Buffer | 65ul |
| VF2 Primer | 13ul |
| RP VR Primer | 13ul |
| MgCl2 | 32.5ul |
| GoTaq | 3.25ul |
[some introduction here]
Workshop
One of the participants taking a closer look at GFP-tagged E. coli under our very own SPS microscope.
The SPS iGEM Team of 2015 hosted a genetic engineering workshop for students from the Faculty of Science on 5th August 2015, in the Active Learning Room and the SPS Wet Lab. The workshop aimed to equip science students with an understanding of both the techniques of synthetic biology, and its risks and rewards. Participants were given the opportunity to be immersed in both the theoretical and wet lab components of synthetic biology.
Students were first guided through the concepts of genetic engineering, and the available wet lab tools and techniques used. After some light refreshments, they then got a chance to try their hands at designing their very own gene vectors with a fun set of theoretical puzzles.
One of the workshop facilitators explaining the process of constructing a genetic vector.
Participants and facilitators hard at work figuring out genetic puzzles
After lunch, the participants performed Fusion PCR (Polymerase Chain Reaction) and performed bacterial transformation in the SPS Wet Lab. They also had a look at green fluorescent protein (GFP) expressed in E. coli, as an example of one of the methods that are commonly used to quantify protein expression.
Participants beginning PCR in the SPS Wet Lab!
Loading a gel is hard work – participants ran a DNA gel to confirm if their PCR reaction was successful
All in all, both the workshop participants and facilitators spent an enjoyable day both learning and sharing about genetic engineering. The SPS iGEM Team of 2015 would like to thank all participants for spending their day with us! We would also like to thank Science Dean’s Office for their kind sponsorship, as well as the SPS staff and SPS community for their support.
A final group photograph with some of the facilitators and workshop participants
Video
Interview
Safety in our Project
Biosafety in our project involves minimising the risks to the researchers working in the laboratory, as well as the general public in future medical applications based off our research.
Safety when handling biological organisms
Non-pathogenic strains of E. coli K-12 strains BL21 and dH5α from Life Technologies were used for bacterial cloning of plasmids and expression of proteins of interest. These strains are Risk group 1 and were handled in a BSL2 Biosafety cabinet. The E. coli strain carrying the Biobrick BBaK299812 (containing parts derived from Risk group 2 organisms) was handled as a Risk Group 2 agent. Mammalian cell line HEK293T is classified under Risk group 2, and was also cultured in a BSL2 Biosafety cabinet.
Safety in Project Design
In our project, we aim to engineer non-pathogenic E. coli as a vector to deliver a potential drug into the tumour core. We use the Biobricks Part BBa_K299812 (http://parts.igem.org/wiki/index.php?title=Part:BBa_K299812), which contains the invasin gene from Yersinia pseudotuberculosis and the listerolysin O gene from Listeria monocytogenes. The Invasin protein allows for bacteria to enter mammalian cells, while Listerolysin O is a pore-forming protein that enable bacteria to escape the endosome. These two proteins are involved in pathogenesis of their respective bacterial species.
The Invasin and Listerolysin proteins enable our E. coli to enter mammalian cells, and escape the endosome, where they can subsequently deliver an encoded therapeutic to kill the tumour cell. To ensure that these proteins are only expressed under the conditions of the tumour microenvironment, the invasin and listerolysin proteins will be placed under the control of an anaerobic promoter, and a quorum sensing system.
Safety in Our Lab
All our team members have undergone Chemical, Biological and Fire Safety Training from the Office of Safety, Health and Environment (OSHE http://www.nus.edu.sg/osh/), the department in charge of Laboratory and Work Safety at the National University of Singapore
For each protocol used for our experiments, we have a separate risk assessment. Please refer to our ‘protocols’ page for more information.
Our laboratory is equipped with biological and chemical spill kits, and all members of our iGEM Team are trained to handle Biological and Chemical Spills. Our laboratory is classified as Biosafety Level 2, according to the classification by the Wolrd Health Organisation (WHO) and the Genetic Modification Advisory Committee of the government of Singapore (http://www.gmac.gov.sg/).
Bacterial work and Mammalian cell culture are performed in separate BSL2 Biosafety Cabinets, while DNA work is done on the bench. No cytotoxic reagents are used in our laboratory; Sybr Safe DNA stain is used rather than Ethidium Bromide. Liquid biological waste is decontaminated using 10% Bleach, while Solid biological waste is sent for incineration in a local incineration plant devoted to medical waste (Sembcorp http://www.sembcorp.com/en/business-on-site-services-solid_waste_management.aspx).
Safety Requirements for iGEM Participation
For the fulfillment of requirements for safety from the iGEM foundation, we have submitted the ‘About our lab’ safety forms (https://2015.igem.org/Safety/About_Our_Lab?team_id=1804) and the ‘Final Safety form (Yihan will complete this later to the deadline as currently can’t confirm what we are submitting to parts registry. Just put in first)’
We have also performed a check-in (https://2015.igem.org/Safety/Check_In) for the Biobricks Part (Bba_k299812 http://parts.igem.org/wiki/index.php?title=Part:BBa_K299812), which contains the invasin gene from Yersinia pseudotuberculosis and the listerolysin O gene from Listeria monocytogenes.
Protocol
Mauris mauris ante, blandit et, ultrices a, suscipit eget, quam. Integer ut neque. Vivamus nisi metus, molestie vel, gravida in, condimentum sit amet, nunc. Nam a nibh. Donec suscipit eros. Nam mi. Proin viverra leo ut odio. Curabitur malesuada. Vestibulum a velit eu ante scelerisque vulputate.
Assessment
Sed non urna. Donec et ante. Phasellus eu ligula. Vestibulum sit amet purus. Vivamus hendrerit, dolor at aliquet laoreet, mauris turpis porttitor velit, faucibus interdum tellus libero ac justo. Vivamus non quam. In suscipit faucibus urna.
