Team:SPSingapore/home

600ript>$(document).ready(function(){$("#accordionProject").accordion({heightStyle:"fill",collapsible:true,active:"none",autoHeight:false,navigation:true})});$(document).ready(function(){$("#accordionPart").accordion({heightStyle:"fill",collapsible:true,active:"none",autoHeight:false,navigation:true})});$(document).ready(function(){$("#accordionHumanPractice").accordion({heightStyle:"fill",collapsible:true,active:"none",autoHeight:false,navigation:true})});

• Home
• Team
• Project
• Protocol
• Part
• Notebook
• Human Practice
• Safety
• Requirement

Home

Kenneth Lim Kun Ming Research Interest: Bioinformatics, Genetic analysis Random fact: Is apparently Schrˆdinger's Biologist Clarice Hong Kit Yee Research Interest: genetics, RNA, cancer Past research projects: (can't rmb, tell you later) Current project: Differential roles of SALL4A and SALL4B in HCC Wong Chi Yan Research Interest: Microbiology, molecular biology, proteomics Past research project: Genetic studies on Salmonella biofilms Current project: Role of fumarase and cysteine dehydrogenase in DNA damage response Random fact: Likes statistics and playing volleyball :) Yeo Xin Yi Research Interests: Neurobiology, Neurosciences Past research projects: Role of STAT in neuroinflammation and the pathogenesis of Alzheimer's Disease Current research projects: Synaptic plasticity threshold in hippocampal CA1 pyramidal neurons, Role of WNK1 in neuronal survival and development Random fact: Blah ~ Tan Yi Han Research Interests: Pathogens, Immunology, Synthetic biology Past research projects: Genetic studies on plant pathogenic fungi, Drug screening for Acute Lymphoblastic Leukemia Current project: Characterisation of Klebsiella pneumoniae isolates from liver abscess Random fact: Knits and bakes in spare time. =) Hee Yanting Research Interests: RNA, genomics, epigenetics Past research projects: microRNA as a potential therapeutic strategy for colorectal cancer, Characterising LPA1 antagonists using calcium imaging Current project: The role and targeting of EZH2 in lymphoma Random fact: Plays the erhu and self-learning cello and classical guitar Adrian Tan Hong Ji Research Interest: Genetic Engineering, Cancer, Immunology Random fact: 500 Hours in Terraria Soong Yun Ting Research Interests: Proteomics, Past research projects: Genetic studies on Salmonella biofilms Current project: Identification of protein players in metastasis Random fact: Plays the harmonica Nguyen Duy Research Interest: Pharmacoinfomatics, Bioinformatics, Neurosciences Past research project: Genetic linkage analysis of asthma Current project: Neurodegeneration of Drosophila Melanogaster. Random fact: 0 hour in Terraria

Leslie Gapter Dr. Leslie is trained as a molecular biologist and her dissertation focused on breast development and tumorigenesis. Leslie joined NUS in 2005 and her past research has focused on analyzing botanical products for breast and prostate cancer treatment. In 2008, Leslie became a full time scientific writer at the Mechanobiology Institute, Singapore, before moving into her current position as a Lecturer in 2010. Leslie teaches 'The Cell' module, which examines the universal mechanics and functions of cells from an integrated science perspective, for the Special Program in Science.

Linda J Kenney Dr Kenney is a Professor of Microbiology at the University of Illinois-Chicago. Her laboratory studies two-component systems in bacteria that control gene expression at a single cell and nanometer level.

Stuti Desai She joined the Kenney group in May, 2012 with a strong urge to amalgamate her doctoral training in studying silent genetic systems in enterics to decipher the behavior of bacteria under various environmental challenges. She obtained her doctorate from the Indian Institute of Science, Bangalore, India, under the guidance of Prof Subramony Mahadevan. She studied Biochemistry for my Master's degree and Chemistry, Physics and Zoology for her Bachelor's degree at the Maharaja Sayajirao University of Baroda, Baroda, India.

Introduction

For description

Esa Quorum sensing

Invasin + lysteriolysin

FNR hypoxic promoter

Design

For design

• Protocol 1
• Protocol 2
• Protocol 3

Protocol

Mauris mauris ante, blandit et, ultrices a, suscipit eget, quam. Integer ut neque. Vivamus nisi metus, molestie vel, gravida in, condimentum sit amet, nunc. Nam a nibh. Donec suscipit eros. Nam mi. Proin viverra leo ut odio. Curabitur malesuada. Vestibulum a velit eu ante scelerisque vulputate.

Assessment

Sed non urna. Donec et ante. Phasellus eu ligula. Vestibulum sit amet purus. Vivamus hendrerit, dolor at aliquet laoreet, mauris turpis porttitor velit, faucibus interdum tellus libero ac justo. Vivamus non quam. In suscipit faucibus urna.

Team part

For Team part

Basic part

For basic part

Composite part

For composite part

Part collection

For part collection

esaGFP quorum sensing [Adrian, Clarice, Kenneth] Invasin + Listeriolysin [YanTing, YunTing] Maintenance FNRgfp [YiHan, ChiYan]

Yi Han

Received 2 bacterial stab cultures, EsaR/I plasmid from addgene (CHL) and BBa_K299812 from iGEM HQ.

Streaked out on plates with amp.

Adrian

Transformed:

+Kit plate 1 9N Ba_K763002 chl

+Kit plate 4 13L BBa_E0040 amp

DNa was received in powder form in plates, and resuspended in 10ul ultrapure H2O respectively. Plates were stored in -20/

Yi Han

Plates cracked in incubator as they dried from lack of humidity.

Transfer to small incubator with beaker of water for humidity no single colonies for inv plasmid -> streak again.

Wrong antibiotic for EsaR/I plasmid-> streak out again

Yi Han

Inoculate single colony of invasin plasmid carrying bacteria in 3mL LB+amp

Transformation of 13L repeated with 1ul of DNA.

Xin Yi

No colonies grew for 13L on all plates ->adjust incubator, make new media

Miniprep of inoculated bacteria for invasin plasmid, incubate sample in 37degC for 1h 20min

RE of invasin plasmid	RE control
Rsal 1ul	Rsal 0 ul
EcoRI 1 ul	EcoRI 0 ul
INv plasmid 7.5ul	Inv plasmid 7.5 ul
H2O 35.5 ul	H2O 37.5 ul
NEB buffer 4.5 ul	Buffer 4.5 ul

 

Repeat transformation of 13L with 1ul

Xin Yi and Yi Han

Miniprep of EsaR/I plasmid for 4 colonies

Restriction digest for EsaR with XbaI/BamHI

RE reaction
5ul plasmid
5ul buffer
1ul XbaI
1ul BamHI
Add H2O to 50ul

Xin Yi

Sent EsaR clone 4 and INv-4 for sequencing.

Yi Han

YFP and GFP transformation results - no colonies for YFP

The GFP transformation repeated with 100ng of plasmid was sucessful.

4 colonies of gfp plasmid were inoculated in 3mL LB+amp and grown overnight.

Yi Han

Miniprep of gfp plasmids

RE digest with EcoRI and RsaI

Chi Yan
RE digest indicated a very faint smaller band for colonies 2-4, and hence these were likely to be positive clones

Yanting

Inoculated 3mLS of Inv-4 and EsaR-4 plasmid carrying bacteria into 100mL LB+ appropriate Antibiotic

Cell culture-> HEK293 cells revived from freezing down appeared detached.

Yi Han + Yanting

Storage of bacterial glycerol stocks for Inv-4, EsaR4 in 25% glycerol

Yanting: grew HEK293T cells in T25 glask

Gel extract to clean up gfp plasmids which loading dye had accidentally been added to.

Yi Han

Miniprep of gfp plasmids, preparation of samples for sequencing

Yi Han

All gfp plasmids had a correct sequence

Yunting kept glycerol stocok for all, and inoculation of 3mL of gfp3 into 100mL LB+amp for midiprep

Yi Han + Yunting

Midiprep of gfp plasmid PCR of gfp with KpnI-gfp and XhoI-gfp primers

Yunting + Duy

Nanodrop of gfp product-> 595.5ng/ul

RE digest of EsaR vector with KpnI/XHoI

Gel electrophoreseis at 1000V for 30min

Gel extraction: 3.9ng/ul and 6.9ng/ul for Esa fragment and GFP --> low yield

Yunting

Gel extraction using Promega binding solution to melt gel, followed by thermo scientific kit

Adrian

Gel extraction optimisation

Hypothesised that the Binding buffer has a problem/DNA does not bind to column

1: 2X promega binding buffer volume

2: Increase incubation time for binding to 5min

Switch binding buffer to that of thermo scientific PCR purification kit

Use sodium acetate if available? TO facilitate stronger binding to column

Results

1: ~10ng/ul

2: ~9ng/ul

not succesful

further optimisation-> warm buffer, incubate for 5min

elute in 30/20ul smaller volumes

Yihan

1: Thermoscientific miniprep columns with 2XThermoscientific binding buffer

2: Thermoscientific PCR purification kit 2X buffer

3: Promega kit 2X buffer

Yihan

PCR (mastermix: 8)

Reagent	Amount
PCR buffer	10 ul * 8 = 8-ul
primers	0.8ul, 0.8ul
DNA polymerase	4ul
dH2O	61.75 * 8 = 494ul
Templates	5.55*7 = 38.75ul

Digest more plasmid (Esa plasmid)

4 rxns ( KpnI/XhoI digest) 50ul each

Reagent	Amount
Buffer
KpnI	2ul
XhoI	2ul
DNA	34.8ul
H2O	141.2ul

 

Yihan

PCR

RP_XhoI_GFP and FP_KpnI_GFP with GFP midiprep

For 15 reactions with control .: Mastermix * 17

Reagent	Amount
PCR buffer	170ul
primers	1.7ul, 1.7ul
dNTP	34 ul
DNA polymerase	8.5 ul
dH2O	66.3*17 = 1127.1ul
templates	17ul
total	1360ul

PCR protocol “GFP 1” (32 cycles)

GFP PCR product -> 448ng/ul

Gel extraction

Qiagen gel extraction kit at MBI

Esa gel band from 14/6

Nanodrop: 16.4 ng/ul, 260/280 = 2.60

Plasmid construction

• RE digest (KpnI, XhoI)

• 3 Replicates of the following

Reagent	Amount
DNA	2.6ul
Buffer	5ul
H2O	41.5ul
KpnI	0.5ul
XhoI	0.5ul

Ligation (2x reaction) 40ul

Reagent	Amount
10X T4 DNA ligase buffer	4ul
Vector DNA (16ng/ul)	100ng -> 6.25ul
insert DNA	75nl -> 12 ul
T4 DNA Ligase	2ul
H2O	16ul

Note: ALL digested DNA in tube labeled lacGFP.ligation was used

Nanodrop of ligation: 1114.0ng/ul. 260/280 = 3.7

Transformation

Transformation of ligated esa-GFP plasmid into DH5\alpha cells

DH5\alpha ,<- unlabelled brown vial inside DH5\alpha box at -80

Plates spread at 11:40h

LB + chloroamphenicol

+4x (100ul)

+10x (40ul)

+20x (20ul)

+LB - 20x (20ul)

remaining transformed cells (~220ul) are kept at 4C

--> labeled as placGFP in brown tube

Oservation: only 4x placGFP plate has colonies (7)

spread one new LB + chlor plate with 200ul of transformed bacteria

picked 6 colonies to grow for miniprep in LB + chl liq media

Conclusion:

+protocol works

+optimization for increase vol needed

cloning of synparts in amp vector

+comes as 4mg dry DNA

+40ul of DI/RNAse free H20

+for transformation, 150ml on wed

Unknown

Miniprep of placGFP followed by RE digest (Kpn, XhoI): 50 ul total

Reagent	Amount
Buffer	2.5ul
KpnI	<ILLEGIBLE>
XhoI	<ILLEGIBLE>
DNA	10
H2O	12025

Colony PCR for synparts

+ Failed

+ No specific <illegible> produced

+ Might need optimization

 

Yihan

RE digest (XhoI, KpnI) of esa and GFP

Yunting

Gel electrophoresis (100V, 40min)

+ Lane 2: gpf: no bands

+ Lane 3: 100bp ladder

+ Lane 4: blank

+ Lane 5: esa: 2 bands

+ Lane 6: 1kb ladder

+ Lane 7:blank

<Picture of gel>

Optimizing gel extract protocol

+ RE GFP from PCR (directly RE)

+ promega agarose 1% gel

+ add NaAC in binding buffer

Result:

+ yield for cut plasmid was 12.8ng/ul

+ GFP was 8.6ng/ul

Ligation reaction 6 reactions

Reagent	Amount
Buffer	12ul
Vector	30ul
Insert	30ul

 

+ 6x ligation result transformed into competent DH5\alpha 20 ul, 50ul, 100ul plated on LB + chl

Yunting

Ligation of GFP tester plasmid.

Performed 4x ligation using RE- digested esa and GFP (CY, 22/6). Ligation rxn at room temperature for 30min instead of 10min.

Included vector-only and insert-only controls.

Stored in -20deg.

Will run gel tmr. Insert only control should be same size as gfp product. Same for the other control. Can try to plate vector only to see re-ligation??

Nanodrop:

PlacGFP - 642.8ng/ul. 260/280=3.89

Vector ctrl - 756.6ng/ul. 260/280=4.11

Insert ctrl - 557 ng/ul. 260/280=3.86

Yanting

Ran 0.8% pre-cast gel at 100V for 45min.

10ul of each sample to 2ul of loading dye.

Gel lanes:

100bp; uncut esa (used esa4 from -20);

pLacGFP; vector ctrl; insert ctrl; 1kb.

[YH] Re-run gel. 35ul of each sample. No bands.

<insert gel picture>

RE of esa and Gfp pcr product.

Gel electrophoresis.

Cast a thick 1% gel (60ml) with combined wells. [Don't need to cast thick gel next time, takes too long to melt]

Gel run at 100V,  45min. Lanes: 100bp, esa, gfp 1&2, 1kb

Image after cutting is also saved.

Gel extraction of RE esa & gfp.

Used Promega kit, loaded both gfp bands into one column. Eluted with 30ul water for 5min before centrifugation.

Nanodrop:

Esa- 37.7ng/ul. 260/280= 1.83

Gfp - 25.1ng/ul. 260/280= 1.84

Overnight ligation

6x ligation:

Reagent	Amount
Buffer	6ul
Vector (37.7ng/ul)	50ng = 7.8ul
Insert (25.1ng/ul)	37.7 ng = 6.6ul
H2O	87.6ul
Ligase	6ul

Ligation reaction run overnight in 16 deg hold in thermocycler - 15h, 8pm - 11am.

 

[Chi Yan + Yunting] Midiprep of EsaR plasmid

[Yihan Yunting] Gel electrophoresis of inv colony PCR

insert picture gel

[Xinyi] Colony pcr for placgfp for >18 colonies

insert gel picture

[Adrian] Gfp expression observed using gfp filter with the SPS microscope

Yanting

Subculture of HEK 293

P4 -> p5

Grow/split into 150mm dish for freezing on sat(20/6)

-->30ml DMEM + 1ml cells

90mm dish for maintenance (buffer)

-->10ml DMEM + 30ul cells

Cells combined from 3 90mm dishes

Yanting

Freezing of HEK293

P6

Cells from a 150 mm dish and 90mm dish

Adrian

Prepared restreak of inv/hly plasmid from original stab culture

Yanting and Yunting

Colony PCR of invasin

Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7).

Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.

Also constituted dNTP w 2.5mM of each atcg triphosphate.

Yanting

100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”.

When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.

Yunting

Placed BBa_K299812 plate in incubator for overnight growth.

Yanting and Yunting

Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.

Primer conc=0.5 uM, template DNA dissolved in 10ul h20.

Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.

100V for 34min.

Tubes 1-2: FP-prefix, RP-suffix.

3-4: FP-VF2, RP-VR.

5-6: FP-prefix, RP_Inv_M2.

7-8: RP-suffix, FP_Inv_M1.

No template control with FP-prefix, RP-suffix.

[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].

Gel image saved as “7.17_inv colony.sgd” (handphone pic below).

Results: Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.

Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time).

Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.

No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.

 

Yihan

Inoculation of positive colonies in liquid culture. 3mL and shaking incubation.

Yunting

Miniprep of positive colonies from 30h liquid culture.

Eluted in 50ul elution buffer and stored at -20.

C= 225.9ng/ul. 260/280=1.86

D= 297.7ng/ul. 1.87

Yunting

Colony PCR with thermogradient: 14rxn

Reagent	Amount
H2O	70ul
dNTP	14ul
MgCl2	35ul
Taq	3.25ul
primers (forward + reverse)	14ul*2
Template DNA	14ul

C/D-1,2: Col3.

C/D-3,4: Col12.

D-5,6: Col 9.

D-7,8: Col 10.

Negative control (no template): Col 8.

Gel ran for 80V, 1h.

D-1,2: VF2, VR.

D-3,4: FP-prefix, RP-suffix.

D-5,6: FP-prefix, FP_M2.

D-7,8: FP-prefix, FP_invF.

C-1,2: VF2, VR.

C-3,4: FP-prefix, RP-suffix.

Results Notes:

Too much template DNA (~250ng). Separate the universal primers (to avoid differing extension time).

Yanting

RE digest of inv/hyl plasmid with EcoRI and PstI for 2 hours at 37oC.

Lane 1-4: 1kb ladder, 100bp ladder, RE of colony C, RE of colony D.

Size is correct: 4kb main band (inv+hly part) and 2kb (plasmid backbone). These plasmid DNA should have the part.

Yanting and Yunting

Colony PCR, used with temperature gradient to vary annealing temperature. 10rxn

Reagent	Amount
5x buffer	50ul
H2O	127.5ul
dNTP	50ul
MgCl2	10ul
Taq	3.25ul
primers (forward + reverse)	14ul*2
Template DNA	14ul

100V for 45min (can run for longer).

Result:

Lane 1: 1kb ladder; lane 2: 100bp ladder;

lane 3-7: FP prefix + RP suffix (5 repeats with increasing annealing temperatures) has 2 bands ~800 bp & 100-200bp (probably non specific bands, will lower # of cycles in future, use higher annealing temp, lower annealing time).

Expected size of inv+hly part is 4.1kb.

lane 8-9: VF + M2 has a thick band 800-900bp.

Expected size is 600+130bp (VF adds ~130bp compared to FP_prefix) .: doesn’t seem to be correct….

lane 10-11: VF + inv F has no bands. Expected is at least 200bp (bcos universal primers).

lane 12: VR + inv F seems to have a small band <100bp. Non specific amplification?

Expected is 1.5+0.1 kb (from VR).

Yanting

RE with XbaI and PstI

Reagent	Amount
Restriction enzyme	2ul
Buffer	5ul
DNA (4x of miniprep=74.5ng/ul)	13.4ul
H2O	29.6ul

Incubate at 37degC for 2.5h (1130-1400)

Results: Gel loaded 1kb ladder, uncut, RE digested. 100V for 1h.

Plasmid doesn't have XbaI site - RE digested DNA is a linear 6kb band.

Yunting

Cast a big gel. Stored in 4 deg. [Used up 26/6]

Pre-cast two 0. 8% gels. Stored in 4deg. [Used up on 24 & 25/6]

Chi Yan and Yunting

Midiprep of esaR plasmid.

Airdry ON.

Safety Inspection for our lab by OSHE. We passed with flying colours!

Transformation of ligated FNRgfp plasmid into dH5alpha

Cleaned waterbath, de-iced the fridge.

Today, we also did a spring cleaning for the lab

Pre-cast big and small gels and stored in 4deg in the blue tupperware. [Used up on 20 & 22/7]

Adrian

BBPrefix_esaRBS PCR

Reagent	Amount
H2O	221ul
Buffer	80ul
MgCl	32ul
dNTP	32ul
Forward Primer_Biobrick Prefix	16ul
ORP_esaRBS_fragsyn	16ul
synpart_BBP_esaRBS	1ul
gotaq	2ul
total	400ul

success-> PCR purification

esaRBS_GFP_BBsuffix

Reagent	Amount
H2O	237ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
Reverse primer_BB_suffix	??
ORP_esaRS_GFP	16ul
Plac_GFPPLASMID	1ul
gotaq	2ul

failed -> troubleshooting-> new OFP_esaRBBS_GFP

Redid 30/6 with new primers

success with new primers-> fusion pcr

PCR with inv primers (adrian’s primers)

 

Clarice

Fusion PCR with esaRBS, GFP

Reagent	Amount
H2O	104.07ul
Buffer	40ul
MgCl2	16ul
dNTP	16ul
Forward primer_BB_prefix	8ul
Reverse primer_BB_prefix	8ul
400ng esaRBS	2.13ul
400ng esaRBSgfp	4.8ul
gotaq	1ul
Total	200ul

annealing temp 50degC

Gel electrophoresis: looks correct-> PCR Purification

RE digest of esaRBS+GFP

Reagent	Insert	Vector
Buffer	2ul	2ul
EcoRI/PstI	1ul	1ul
Template(2ug)	5ul	4ul
dH2O	11ul	12ul
total	20ul	20ul

Clarice

COlny PCR with different colonies (15 colonies)

FP_BB_Prefix and RP_BB_Suffix

Success

Clarice

Colony PCR successful - inouclated colony 2,3,4,12 in 3mL LB

PCR-FNRsynpart BBP

Reagent	Amount
dH2O	221ul
Buffer	80ul
MgCl2	32ul
dNTPs	32ul
FP_RNE_PromoterBBP	16ul
GFP_FNR_Prom_GFP	16ul
synpart FNR	1ul
gotaq	2ul

 

Clarice

Verify minipreppped esaGFP plasmid

Reagent	Amount
Buffer	2ul
EcoRI	1ul
Pst1	1ul
Plasmid	5ul
dH2O	11ul
total	20ul

Clarice

Transformatin of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)

plate O/N

Yihan

Ran gel of gfp plasmid EcoRI/PstI, took out gel slice for vector - 4kb

Gel extraction:

+gfpvector->38.7ng/ul fragment-> direction purification 226.4ng/ul

+LIgation reaction (5:1) 6X

Reagent	Amount
300ng vector	7.8ng/ul
531.2ng of insert	2.4ul
Buffer	12ul
Enzyme	6ul
H2O	91.8ul

ligate for 2 hours at 16 hours transform, plate, grow ON

Yihan

No colonies-> ligation did not work

Recalcualte ligation reaction (3:1),7x

350ng vector->9ul vector

446.3ng insert-> 2ul 7ul

ligase 110

H2O

12ul buffer

Yihan and Clarice

colonies for EsaGFP

grew Colony PCR for 14 colonies

Unsuccessful-> no bands observed

Yihan

Trying out an idea for workshop

Trial for blue/white screen

Streak out pGFPuv and pGEMT on plate with amp added spread 40ul of 0.1M IPTG and 30ul of 5%xgal, dried and on plate without amp

Yihan

Ran gel with FNR Pcr and gfp pcr

size of pcr product was correct but gel picture was not saved

FNR Product was pcr purified

Plasmid extraction for colony 2,3,4 of esaGFP - > 2,3 were sent for sequencing and primers did not bind, chromatogram was messed up.

Fusion PCR for FNRGFP:

Reagent	Amount
dH2O	218ul
10X buffer	80ul
MgCl2	23ul
dNTP	32ul
Template FNR PCR (40ng)	3ul
gfp PCR (400ng)	1ul
FP_BB_Suffix	16ul
RP_BB_Suffix	16ul
gotaq	2ul

Chi yan

Gel was run for fusion pcr size was correct

Clarice RE digest:

Reagent	Amount
PstI	1.5ul
EcoRI	1.5ul
Buffer	4ul
Template	3ul
H2O	20ul
Total	40ul

Chi yan

Ran gel for gfpp plasmid

gel purificaiton and extraction of 4kb fragment

Reagent	Amount
ligation reaction (2X)	40ul
Buffer	4ul
100ng of DNA vector	3.4ul
157ng insert	16ul
enzyme	2ul
H2O	14.6ul

Yihan

no colonies for FNRgfp plasmid

Inv plasmid verification

Reagent	Amount
buffer	1ul
EcoRI	0.5ul
invasin plasmid	0.5ul
dH2O	8ul
Total	10ul

Gel extraction RE digest of EsaR-GFP plasmid

Reagent	Ligation	Control
Vector (45ng)	1ul	1ul
Insert	1ul	1ul
Buffer	1ul	1ul
dH2O	6ul	7ul
ligase	1ul	1ul

Transformation of FNRgfp anaerobe jar

E. coli grew in both conditions p putida-> some growth in anaerobe chamber proper streak plate in aerobic conditions

packet runs out after 16hours

Yihan and Yunting

LIgation for FNRgfp (4X)

Reagent	Amount
200ng Gfp plasmid	4.36ul
297ng insert (7:1)	10.3ul
Buffer	53.34ul
T4 ligase	4ul

Trial run of anaerobe chamber:

+ open sachet to decrease O2 at 3.30pm

+ takes 2.5h to activate

place streak plate of p putida a strict aerobe and e coli, facultative aerobe in chamber at 30deg C to grow O/N

P. putida is an abligate aerobe and if chmaber works ,it will not grow

E. coli should grow in both conditions

controls grown outside chamber

Yihan

FNRgfp-> no colonies after transformation

religation (4X reaction)

Reagent	Amount
200ng GFP plasmid	4.4ul
2125ng of insert	8ul
T4 ligase	4ul
H2O	55.6ul

transformation of FNR gfp into 20ul of BL21

Yihan

No colonies grew

Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder

Chi Yan

RE digest of FNR-GFP fusion PCR with EcoRI and PstI

Reagent	Amount
EcoRI	1ul
PstI	1ul
Buffer	5ul
FNR-GFP from 12/7 in RIP box 1ug	2.5ul
H2O	40.5ul
Total	50ul

Direct purification using Promega kit

Overnight ligation (4X reaction)

Reagent	Amount
200ng of GFP plasmid	4.4ul
400ng of insert (5:1)	?
T4 ligase	4ul
T4 ligase buffer	8ul
H2O	?

 

200ng of gfp plasmid (4.4ul)

400ng of insert (5:1) (?ul)

4ul T4 ligase

8ul T4 ligase buffer

? H2O

Yihan

Ncbi search in BL21 genome revealed that it does have FNR transcriptional regulator

http://www.ncbi.nlm.nih.gov/nuccore/CP010816.1

In dH5alpha as well

http://www.ncbi.nlm.nih.gov/gene/945908

However no direct data on our specific strains of dH5alpha and BL21

Adrian 1_8

PCR	reaction
H2O	222ul
Buffer	80ul
MgCl2	32ul
dNTPs	32ul
VF2	16ul
VR	16ul
GoTaq	2ul

Cycle conditions 95ºC (3min) -> 95ºC (30s) -> 60ºC (30s) -> 72ºC (1.5min) -> 72ºC (5min) for 25 cycles Result: FP_Biobricks_Suffix and RP_Biobrick_Suffix primers are contaminated -> rediute from stock Maintenance Red Workshop Protocol

To make Fragment 1 for the	workshop
H2O	222ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
Primer 1 (FP_retarded)	16ul
Primer 2 (RP_retarded)	16ul
GoTaq	2ul
GFP plasmid	1ul

To make Fragment 2 for the	workshop
H2O	222ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
Primer 1 (OFP_esaRBSver2)	16ul
Primer 2 (RP_VR)	16ul
GoTaq	2ul
GFP plasmid	1ul

Cycle conditions 95ºC (3min) -> 95ºC (30s) -> 60ºC (30s) -> 72ºC (2.5min) -> 72ºC (10min) for 25 cycles

Adrian 2/8

Recreating backbone

pSB1A2	EcoRI/PstI
H2O	22ul
pSB1A2-GFP	10ul
Buffer	4ul
EcoRI	2ul
PstI	2ul
Total	40ul

Adrian 3/8

Fusion PCR for	workshop
H2O	111ul
Buffer	40ul
MgCl2	16ul
dNTP	16ul
OFP_esaRBS_GFP_ver2	8ul
ORP_XhoI_retarded	8ul
GoTaq	1ul
Fragment 1	1ul
Fragment 2	1ul

95ºC (3min) -> 95ºC (30s) -> 60ºC (30s) -> 72ºC (1.5min) -> 72ºC (10min) for 25 cycles

EsaR Master Plate	Test
Colony PCR
H2O	222ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
VF2	16ul
VR	16ul
GoTaq	2ul
	400ul

For 10 colonies

Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)

10x T4 DNA ligase Buffer	1ul
Vector	1ul
Insert	5ul
H2O	10ul
T4 DNA ligase	1ul

Reactions were incubated for 30min at room temperature Transformation pSB1A2 esaRBSGFP pSB1A2 RNG GFP Control cut pSB1A2

Adrian 17/7

Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)

10x T4 DNA ligase Buffer	1ul
Vector	1ul
Insert	5ul
H2O	10ul
T4 DNA ligase	1ul

Reactions were incubated for 30min at room temperature Transformation pSB1A2 esaRBSGFP pSB1A2 RNG GFP Control cut pSB1A2

Adrian 18/7

Vector dimer check 8 colonies were selected from the control plate (26/7)

PCR	mastermix
H2O	222ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
FP_Biobricks_Prefix	16ul
RP_Biobricks_Prefix	16ul
GoTaq	2ul
Total	400ul

The control plate had plasmids with a 800bp insert Gel extract was performed on a 2kb band Ligation Troubleshooting

Ligation	Mastermix
H2O	222ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
FP_Biobricks_Suffix	16ul
RP_Biobricks_Suffix	16ul
GoTaq	2ul
Total	400ul

Colony PCR 8 colonies were selected from esaR and RNG each, total 16 colonies

PCR	Mastermix
H2O	444ul
Buffer	160ul
MgCl2	64ul
dNTP	64ul
FP_Biobricks_Suffix	32ul
RP_Biobricks_Suffix	32ul
GoTaq	4ul
Total	800ul

Ran gel Lanes Vector Backbone (EcoRI/PstI Control Ligation mix esaR ligation mix RNG ligation mix T4 Ligation buffer Blank

Adrian 26/7

BBPprefix_esaRBS PCR synthesis

PCR	Reaction
H2O	22ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
FP_Biobricks_Prefix	16ul
ORP_esaRBS_fragsyn	16ul
synpartBBP_esaRBS	1ul
GoTaq polymerase	2ul
Total	400ul

	esaRBS_GFP_BBsuffix
H2O	221ul
Buffer	80ul
MgCl2	32ul
dNTP	32ul
RP_BiobricksSuffix	16ul
OFP_esaRBS_GFPver2	16ul
pSB1A2_BBa_0040	1ul
GoTaq	2ul
Total	400ul

PCR for	esa
H2O	220ul
Buffer	80ul
MgCl2	32ul
dNTPs	32ul
FP_BB_Prefix	16ul
RP_BB_Suffix	16ul
BBPrefix_esaRBS	1.2ul
esaRBS_GFPBBSuffix	0.5ul
GoTaq	2ul
Total	400ul

PCR for	RNG
H2O	220ul
Buffer	80ul
MgCl2	32ul
dNTPs	32ul
FP_BB_Prefix	16ul
RP_BB_Suffix	16ul
BBPrefix_esaRBS	1.5ul
esaRBS_GFPBBSuffix	0.5ul
GoTaq	2ul
Total	400ul

Adrian Clarice

REdigest of esaR and RNF after PCR purification and gel extraction

esaR-gfp RE	digest
Bffer	2ul
PstI	1ul
EcoRI	1ul
2ug Template	5.4ul
H2O	10.6ul
Total	20ul

RNG RE	digest
Bffer	2ul
PstI	1ul
EcoRI	1ul
2ug Template	3.9ul
H2O	12.1ul
Total	20ul

Ligation of pSB1A2 with esaR and	RNG
10X T4 Ligase Buffer	2ul
Vector (pSB1A2 EcoRI/PstI)	1ul
Insert (esaR and RNG)	5ul
H2O	11ul
T4 DNA ligase	1ul
Total	20ul

Ligation for 30min at room temperature

Clarice 19/7

Colony PCR for RNG and esaR-GFP colonies from master plate

RNG	(10X)
H2O 13.8 + colony	each
Buffer	50
MgCl2	20
dNTPs	20
Primer 1	10
Primer 2	10
Gotaq	2

esaGFP	(9X)
H2O	45
Buffer	18
MgCl2	18
dNTPs	9
Primer 1	9
Primer 2	9
GoTaQ	1.8

CY 8/8

8 minipreps of 4 clones from BL21 pNirB+gfp and 4 clones from dH5alpha pNirB+gfp

RE	digest
EcoRI	9ul
PstI	9ul
Cutsmart Buffer	45ul
DNA of 1ug	6.7ul
H2O	36.3ul

Result after running gel: All clones are positive for pNirB+gfp

CY 13/8

Invasin + Listerolysin blue
Inoculated 4 colonies of BL21 transformed with the inv+hly clone D.

CY 14/8

Invasin + Listerolysin blue
Miniprep of the inv+hly clones

RE digest with	EcoRI/PstI
EcoRI	5ul
PstI	5ul
Buffer	25ul
DNA 1ug	(4ul)
H2O	11ul
Total	50ul

CY 19/8

Colony PCR for pEFYP plated on (17/8) Pcr for pNirBgfp as with (18/8) with pNirB-gfp primers, Biobricks prefix and suffix primers

PCR Master mix For	pEYFP
H2O	13.25ul
Buffer	5ul
dNTP	5ul
F/R primer	5ul
2.5mM MgCl2	12.5
GoTaq	11.25ul

PCR Master mix for pNirBgfp with pNirB-gfp primers, and Biobricks Prefix and Suffix Primers (Melting temperature increased to 53degrees) 3ul of plasmid in each tube

PCR Master mix for pNirB-gfp primers and BB prefix/suffix	primers
H2O	101.25ul
Buffer	45ul
dNTP	9ul
Forward Primer	9ul
Reverse Primer	9ul
2.5mM MgCl2	22.5ul
GoTaq polymerase	2.25ul

CY 21/7

Ran gel for 20/7 colony pcr for FNR gfp 1kb, 100bp, colonies negative control

CY 22/7

Anaerobic promoter Brown
PCR to test 'FNR-GFP plasmid'.

Colonies 1-5 from 20/7 + negative control 3 sets of primers FP_BB Prefix, RP BB Suffix GFP-F, GFP-R FP_FNRPromoter_BBP, ORP_FNR_Promoter GFP

For each reaction (6X)

H2O 73.5ul

dNTPs 6ul

Forward/Reverse Primer 6ul/6ul MgCl2 15ul

Taq polymerase1.5ul

For each plasmid 1ul

Buffer 30ul

CY 24/7

Ligation of Cut FNRGFP (17/7) with cut GFP vector

1X	reaction
Buffer	2ul
200ng vector	1.1ul
3:1	256.5ng
Water	3.4ul
T4 DNA ligase	1ul
Total	20ul

Incubation at room temperature for 2h Transformation into 10ul BL21 competent cells

CY 27/7

RE of extracted product with EcoRI/PstI for 300ng of DNA

RE	(1X)
FNR-gfp	0.9ul
EcoRI	1ul
PstI	1ul
Buffer	2ul
Water	15.1ul
Total	20ul

CY YH

When gel was run, primer dimers and 700-800bp band were present in the negative control with no template added

Fresh buffer, MgCL2, dNTP and fresh diluted primers were used to repeat colony PCR.

Diluting dATP, dCTP, dGTP, dTTP to 2.5mM

Repeated colony pcr with Prefix-suffix primers using TC pipettors

HYT 15/7

Invasin + Listerolysin blue
RE digest of the miniprepped inv/hly plasmid with EcoRI/PstI from (20/7) Tube C-> 226ng/ul Tube D-> 298ng/ul

RE	reaction
Buffer	3ul
Plasmid 4ul	each
EcoRI	1ul
PstI	1ul
H2O 21ul	each
Total	30ul

incubated at 37degC for 2h Add 6X loading dye to stop reaction in both tubes Ran gel (1kb, 100bp, cut vector C, D)

CY 24/7

Anaerobic promoter Brown
Ligation of Cut FNRGFP (17/7) with cut GFP vector

1X	reaction
Buffer	2ul
200ng vector	1.1ul
3:1	256.5ng
Water	3.4ul
T4 DNA ligase	1ul
Total	20ul

Incubation at room temperature for 2h Transformation into 10ul BL21 competent cells

XY 18/7

Anaerobic promoter Brown
Transformation of FNRGFP ligated product into BL21 (from CY 17/7) 1. 3ul pUC19 control +10ul BL21 2. 20ul Ligation product + 20ul BL21 3. 5ul Ligation product + 20ul BL21 Plated on LB+amp plates 40ul of transformed bacteria in SOC media on LB+amp 20ul of transformed bacteria in SOC media on LB alone

YH 2/8

Inoculated colony 3,7 of FNR GFp selected positive clones for miniprep

YH 3/8

Anaerobic promoter Brown
Miniprep of colony 3, 7 and sent for sequencing with GFP-R and FP_VF2 -> results show there is GFP but no FNR.

YH 6/8

Transform pNirB+gfp from the Biobricks Registry into BL21 and dH5alpha

YH 9/8

OD600 of 1 = 10^8 cells/cm^3

OD600 of 10X	dilution
BL21 clone 1 0.013 -> 1.04x10^8	cells/cm^3
BL21 clone 2 0.094 -> 7.52x10^8	cells/cm^3
dH5alpha clone 1 0.054 -> 4.32x10^8	cells/cm^3
dH5alpha clone 2 1.123 -> 9.84x10^8	cells/cm^3
BL21 0.084 -> 6.72x10^8	cells/cm^3
dH5alpha 0.046-> 3.68x10^8	cells/cm^3
BL21 + pGFPuv 0.036 -> 2.88x10^8	cells/cm^3

The cultures were diluted 100X and 500X in a volume of 200ul in a 24well plate and grown in the anaerobic chamber at 30degrees and 225rpm for 2, 4, 6, 8 hours

Replicating the iGEM Valencia Team - growing cultures under sterile oil (filtered through 0.22um filter) 0.5mL of stationary culture + 2.5mL LB, with 1mL of sterile oil added above

Grown at 28 degrees, 200rpm for 2 days

Results:

GFP signal is expressed in cultures with the anaerobic sensitive promoter grown in anaerobic conditions overnight, but signal was weak.
After 6 hours in anaerobic growth, the BL21 + pNirB clone 1 had highest GFP signal when observed with the GFP microscope.

BL21 strain had no signal

After 24 hours in anaerobic conditions, dH5alpha had highest signal compared to control

Control - colonies picked directly from plates (aerobic conditions) had no GFP signal

After 2 days there was no gfp expression

YH 14/8

Seeded cells for invasion assay

BL21 + inv-hly clones correct after running gel for digest of the plasmids with EcoRI and PstI

YH 15/8

Invasin + Listerolysin blue

Invasion assay with HEK293T cells and BL21, and BL21+inv-hly plasmid on 15/08/15

Rationale: The invasin gene in the invasin+listerolysin plasmid should remain intact and be expressed, leading to an invasion phenotype

Objective: Screen invasion phenotype of BL21 and BL21+invasin-listerolysin Biobricks part

Experiment details

Cells were passage 2 Seed 0.5mL of 5x10^5 HEK293T cells/mL and 1x10^6 in wells of 24-well plates, grow overnight.

Determine cell confluency with microscopy the next day - 80-90% confluency

All strains were grown overnight in 3mL LB broth

For 5x10^5 cells

100ul of 10^9 cells/mL was used for moi 200

100ul of 2X dilution of 10^9 cells/mL was used for moi 100

100ul of 4X dilution of 10^9 cells/mL was used for moi 50

100ul of 5X dilution of 10^9 cells/mL was used for moi10

Result Lawn on all plates HEK293T cells detach too easily.

Grow for 24 hours in the future and do minimal, and gentle washing. For next experiment, 0.5x10^6 and 1x10^6 cells wre seeded 1000ug/mL kanamycin for 1 hour is sufficient for kill step

no contamination in uninfected control

There is invasion in background BL21 strain as well

All mois showed high percentage of infection

In future use moi 10:1 and plate up 10^2 to 10^5 dilution for countable colonies

YH 17/7
For plates on LB alone there was a lawn

For pUC19, the transformation worked, and separated colonies were produced

No colonies were produced for the FNR-gfp plasmid

YH 18/8

PCR for the clones of pNirB-gfp from B21(1-4) and dH5alpha (1-4)with pNirB-gfp-F/R primers

5ul plasmid, 5ul H2O in each tube

PCR Mastermix

dNTP 8ul

MgCl2 20ul

Taq Polymerase 2ul

Buffer 40ul F/R

primers 0.8ul each

H2O 40ul

YH 19/7
inoculated colonies C,D for invasin plasmid in 3mL LB+amp at 1.30pm

Transformed remaining 40u ligation reaction for FNR gfp into 10ul BL21

Transformed 100ng pGFPuv plasmid into 10ul BL21

Poured new LB+amp plates

Plated 20, 40, 100ul of transformed bacteria in SOC media on plates

YH 20/7
pGFPuv transformation worked!

Single colony for FNR-GFP + 4 more from plating on 19/7

Sent FNR-GFP fusion product for sequencing with RP-Biobricks Suffx - result there is no FNR but there is no GFP

Colony PCR for FNR gfp (Colonies 1-5, (-) control)

Colony PCR	(6X)
H2O	19.5ul
Buffer	10ul
6ul	dNTP
6ul FP_Biobricks	Suffix
6ul RP_Biobricks	SUffix
15ul	MgCl2
1.5ul Taq	Polymerase

YH 21.7
Redid colony pcr for above as negative control had a positive band - contamination of PCR

negative control still has band - reagents contaminated

YH 22/7

Miniprepped colonies 1-5 for FNR-gfp plasmid

Did EcoRI/PstI digest

Digest for mastermix	(5X)
Buffer	10ul
EcoRI/PstI	2ul
H2O	60ul
Total 20ul per	tube
400ng plasmid in each	tube

Ran gel for RE samples, none were postive clones

YH 26/7
No colonies for FNRgfp

Hotstart fusion PCR (8X	reaction)
10X Buffer	80ul
dNTPs	16ul
FP Biobricks Prefix	8ul
RP Biobricks Suffix	8ul
FNR Pcr product	12ul
GFP PCR product	4ul
MgCl2	3ul
H2O	668ul

YH 27/7
Ran gel with cut vector and cut PCR product 1kb 100bp cut vector (wells 3-5) FNR-gfp (wells 6-8)

However, PCR product was not detectable

RE digest for FNRgfp	EcoRI/PstI
150ng PCR	5ul
Buffer	2ul
EcoRI	0.5ul
PstI	0.5ul
H2O	12ul
Total	20ul

Gel extracted Ligation reaction was performed overnight

Ligation reaction	(1X)
100ng vector	8.3ul
85ng insert	16ul
T4 ligase	2ul
Buffer	4ul
H2O	9.7ul

YH 28/7

Trialling transformation of 10ul BL21 with 100ng pGFPuv plasmid for workshop.

Using 200ul LB broth for the growth in 1hour step

10ul BL21 + 10ul plasmid Heatshock for 300s

Shake for 1hour at 37 degC 225rpm

plated 40ul on LB, 40ul on LB+amp plate

Transformation of ligation reaction into BL21 with control of cut vector (100ng) into BL21

plated 40ul on LB+amp plate, 20ul on LB plate

YH 29/7
Colonies on pGFPuv plate with amp -> LB works for reviving bacteria small colonies with FNRGFP plasmid

YH 30/7
12 colonies grew for FNRGFP plate no colonies on control with cut vector Colony PCR to screen 12 colonies and negative control using universal primers

PCR Mastermix	(13X)
H2O	42.25ul
PCR Buffer	65ul
VF2 Primer	13ul
RP VR Primer	13ul
MgCl2	32.5ul
GoTaq	3.25ul

[some introduction here]

Workshop

One of the participants taking a closer look at GFP-tagged E. coli under our very own SPS microscope.

The SPS iGEM Team of 2015 hosted a genetic engineering workshop for students from the Faculty of Science on 5th August 2015, in the Active Learning Room and the SPS Wet Lab. The workshop aimed to equip science students with an understanding of both the techniques of synthetic biology, and its risks and rewards. Participants were given the opportunity to be immersed in both the theoretical and wet lab components of synthetic biology.

Students were first guided through the concepts of genetic engineering, and the available wet lab tools and techniques used. After some light refreshments, they then got a chance to try their hands at designing their very own gene vectors with a fun set of theoretical puzzles.

 

One of the workshop facilitators explaining the process of constructing a genetic vector.

Participants and facilitators hard at work figuring out genetic puzzles

After lunch, the participants performed Fusion PCR (Polymerase Chain Reaction) and performed bacterial transformation in the SPS Wet Lab. They also had a look at green fluorescent protein (GFP) expressed in E. coli, as an example of one of the methods that are commonly used to quantify protein expression.

Participants beginning PCR in the SPS Wet Lab!

Loading a gel is hard work – participants ran a DNA gel to confirm if their PCR reaction was successful

All in all, both the workshop participants and facilitators spent an enjoyable day both learning and sharing about genetic engineering. The SPS iGEM Team of 2015 would like to thank all participants for spending their day with us! We would also like to thank Science Dean’s Office for their kind sponsorship, as well as the SPS staff and SPS community for their support.

A final group photograph with some of the facilitators and workshop participants

Video

Interview

Biosafety in our project involves minimising the risks to the researchers working in the laboratory, as well as the general public in future medical applications based off our research.

Safety when handling biological organisms

Non-pathogenic strains of E. coli K-12 strains BL21 and dH5α from Life Technologies were used for bacterial cloning of plasmids and expression of proteins of interest. These strains are Risk group 1 and were handled in a BSL2 Biosafety cabinet. The E. coli strain carrying the Biobrick BBaK299812 (containing parts derived from Risk group 2 organisms) was handled as a Risk Group 2 agent. Mammalian cell line HEK293T is classified under Risk group 2, and was also cultured in a BSL2 Biosafety cabinet.

Safety in Project Design

In our project, we aim to engineer non-pathogenic E. coli as a vector to deliver a potential drug into the tumour core. We use the Biobricks Part BBa_K299812 (http://parts.igem.org/wiki/index.php?title=Part:BBa_K299812), which contains the invasin gene from Yersinia pseudotuberculosis and the listerolysin O gene from Listeria monocytogenes. The Invasin protein allows for bacteria to enter mammalian cells, while Listerolysin O is a pore-forming protein that enable bacteria to escape the endosome. These two proteins are involved in pathogenesis of their respective bacterial species.

The Invasin and Listerolysin proteins enable our E. coli to enter mammalian cells, and escape the endosome, where they can subsequently deliver an encoded therapeutic to kill the tumour cell. To ensure that these proteins are only expressed under the conditions of the tumour microenvironment, the invasin and listerolysin proteins will be placed under the control of an anaerobic promoter, and a quorum sensing system.

Safety in Our Lab

All our team members have undergone Chemical, Biological and Fire Safety Training from the Office of Safety, Health and Environment (OSHE http://www.nus.edu.sg/osh/), the department in charge of Laboratory and Work Safety at the National University of Singapore

For each protocol used for our experiments, we have a separate risk assessment. Please refer to our ‘protocols’ page for more information.

Our laboratory is equipped with biological and chemical spill kits, and all members of our iGEM Team are trained to handle Biological and Chemical Spills. Our laboratory is classified as Biosafety Level 2, according to the classification by the Wolrd Health Organisation (WHO) and the Genetic Modification Advisory Committee of the government of Singapore (http://www.gmac.gov.sg/).

Bacterial work and Mammalian cell culture are performed in separate BSL2 Biosafety Cabinets, while DNA work is done on the bench. No cytotoxic reagents are used in our laboratory; Sybr Safe DNA stain is used rather than Ethidium Bromide. Liquid biological waste is decontaminated using 10% Bleach, while Solid biological waste is sent for incineration in a local incineration plant devoted to medical waste (Sembcorp http://www.sembcorp.com/en/business-on-site-services-solid_waste_management.aspx).

Safety Requirements for iGEM Participation

For the fulfillment of requirements for safety from the iGEM foundation, we have submitted the ‘About our lab’ safety forms (https://2015.igem.org/Safety/About_Our_Lab?team_id=1804) and the ‘Final Safety form (Yihan will complete this later to the deadline as currently can’t confirm what we are submitting to parts registry. Just put in first)’

We have also performed a check-in (https://2015.igem.org/Safety/Check_In) for the Biobricks Part (Bba_k299812 http://parts.igem.org/wiki/index.php?title=Part:BBa_K299812), which contains the invasin gene from Yersinia pseudotuberculosis and the listerolysin O gene from Listeria monocytogenes.

Gold

Silver

Bronze