Team:Tianjin/GFP
Saturday.6.6.2015
PCR on PSB1C3
gene of interst：GFP
primer: Xba1-GFP、GFP-linker
Xba1-GFP: 5’-GCTCTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTC
GFP-linker: 5’-AGAACCACCACCACCAGAACCACCACCACCTTTGTATAGTTCATC
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
Xba1-GFP primer |
2μl |
|
GFP-linker primer |
2μl |
|
GFP PSB1C3 |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：55℃ 3：58℃ 4：60℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
qualitative agarose gel electrophpresis：GFP on 55, 58, 60 centigrade worked well.
(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 750bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration: 51.7 ng/μL
Date: Monday,7.13.2015
PCR on pET28a(+)
gene of interst：sJanus
primer：linker-sJanus、sJanus-Pst1
linker-sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA
sJanus-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
linker- sJanus primer |
2μl |
|
sJanus -Pst1 primer |
2μl |
|
sJanus pET28a(+) |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：55℃ 3：58℃ 4：60℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：sJanus on all centigrades worked
(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:70.2ng/μL
Date: Monday,7.13.2015
PCR on pET28a(+)
gene of interst：sJanus-m
primer：linker- sJanus、sJanus-Pst1
linker- sJanus:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAGCAACGGCAACGGCAA
SJANUS-Pst1:5’- AACTGCAGCGGCCGCTACTAGTATCACCGACGGCGGTCTG
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
linker- sJanus primer |
2μl |
|
sJanus -Pst1 primer |
2μl |
|
sJanus-m pET28a(+) |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：55℃ 3：58℃ 4：60℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：sJanus-m on all centigrades worked
（The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.）
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:70.6ng/μL
Date: Monday,7.13.2015
PCR on pET28a(+)
gene of interst：inJanus
primer：linker- inJanus、inJanus-Pst1
linker- inJanus: 5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
INJANUS-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
BFP_F primer |
2μl |
|
BFP_R primer |
2μl |
|
BFP pSB1C3 |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1:50.1℃ 2:53.4℃ 3:56.4℃ 4:58.5℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：inJanus didn’t work well. The electrophoretic bands towing phenomenon is obvious.
(The maximum sequence of the maker is 2000bp, and following is 1500, 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.)
analyse： We suspect is caused by low temperature. So we raise the temperature to conduct the PCR later.
Date: Tuesday,7.14.2015
PCR on pET28a(+)
gene of interst：inJanus
primer：linker- inJanus、inJanus-Pst1
linker- inJanus:
5’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
inJanus-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
linker- inJanus primer |
2μl |
|
inJanus -Pst1 primer |
2μl |
|
inJanus pET28a(+) |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1:59.4℃ 2:65.4℃ 3:67.0℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：inJanus-m worked
（The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.）
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:43.5ng/μL
Date: Tuesday,7.14.2015
PCR on pET28a(+)
gene of interst：inJanus-m
primer：linker-inJanus-m、inJanus-Pst1
linker-inJanus-m:5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTCTACCACTGGC
inJanus
-Pst15’- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTCAACAGTGCACCACT
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
linker-inJanus-m primer |
2μl |
|
inJanus -Pst1 primer |
2μl |
|
inJanus-m pET28a(+) |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1:59.4℃ 2:65.4℃ 3:67.0℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：inJanus-m on these three centigrades worked
（The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 250bp approximately.）
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:55.0ng/μL
Date: Wednesday,7.15.2015
SOE PCR
SOE PCR stands for Splicing by Overlapp Extension PCR. It is a standard overlapp extension procedure, enabling the assembly of genes wihtout performing any cloning, digesting or ligation inbetween. All you need to do ist running PCRs with specific primers. If gene A is the upstream part and gene B has to be assembled downstream of gene A, primer lo of gene A should have an overlapp of around 20 nucleotides complementary to the first 20 nucleotides of gene B. Primer up of gene B should haven a complementary overlapp of 20 nucleotides to the end of gene A.
gene of interst：GFP- sJanus
primer：Xba1-GFP、sJanus-Pst1
temperature: 53, 55, 56, and 58 centigrade.
PCR system（100μl）
|
Buffer |
10μl |
|
dNTPS |
10μl |
|
GFP fragment |
5μl |
|
sJanus fragment |
5μl |
|
Pfu enzyme |
1μl |
|
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：56℃ 3：65℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：56℃ 3：65℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：GFP－sJanus for SOE PCR with PSB1C3 worked
The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:32.2ng/μL
Date: Wednesday,7.15.2015
SOE PCR
gene of interst：GFP-sJanus-m
primer：Xba1-GFP、sJanus -Pst1
temperature： 53, 55, 56, and 58 centigrade.
PCR system（100μl）
|
Buffer |
10μl |
|
dNTPS |
10μl |
|
GFP fragment |
5μl |
|
sJanus-m fragment |
5μl |
|
Pfu enzyme |
1μl |
|
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：56℃ 3：65℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：56℃ 3：65℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：GFP－sJanus-m for SOE PCR with PSB1C3 worked
The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration: 30.5ng/μL
Date: Wednesday,7.15.2015
SOE PCR
gene of interst：GFP- sJanus
primer：Xba1-GFP、inJanus-Pst1
temperature： 55, 56.3 ,57.8 and 58.9 centigrade.
PCR system（100μl）
|
Buffer |
10μl |
|
dNTPS |
10μl |
|
GFP fragment |
5μl |
|
inJanus fragment |
5μl |
|
Pfu enzyme |
1μl |
|
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：55℃ 2：56.3℃ 3：57.8℃ 4：58.9℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：56℃ 3：65℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：GFP－inJanus for SOE PCR with PSB1C3 worked
（The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.）
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:31.1ng/μL
Date：Wednesday,7.15.2015
SOE PCR
gene of interst：GFP-inJanus
primer：Xba1-GFP、inJanus-Pst1
temperature： 55, 56.3 ,57.8 and 58.9 centigrade.
PCR system（100μl）
|
Buffer |
10μl |
|
dNTPS |
10μl |
|
GFP fragment |
5μl |
|
inJanus-m fragment |
5μl |
|
Pfu enzyme |
1μl |
|
ddH2O |
69μl |
Add two kinds of primer (1μl) after 5 cycle.
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1：55℃ 2：56.3℃ 3：57.8℃ 4：58.9℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
95℃ |
5min |
|
95℃ |
30s |
|
1：50℃ 2：56℃ 3：65℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：GFP－inJanus-m for SOE PCR with PSB1C3 worked
（The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.）
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:50.3ng/μL
Date: Thursday,7.16.2015
restriction enzyme digestion
After qualitative agarose gel electrophpresis, all the target sequence are 1000bp approximately.
Fragment concentration: sJanus is 6.9ng/μL, sJanus-m is 15.3ng/μL, inJanus is 4.6ng/μL, inJanus-m is 7.0ng/μL.
Date: Friday,7.17.2015
We used T4 DNA ligase to connect them at the temperature of 22 centigrade about an hour.
Transformed the expression vectors we had already connected into the Escherichia coli DH5α, then incubated the bacteria for 12h (37℃).
Date:Saturday,7.18.2015
Enzymes cut each, but they did not work.
（The maximum of marker is 8000bp, and following is 8000, 5000, 3000,1500,1000and 500bp from up and down, our target sequence is about 1000bp approximately. But the bands in this figure are all about 5000bp, so we suspect that the fragments are not connected to plasmid.）
Analyse：The fragments are not connected to plasmid.
Date: Sunday,7.19.2015
We chose another DH5α and trans
formed again.
Date: Monday,7.20.2015
Enzyme cut,
Date: Tuesday,7.21.2015
We design another kind of primer and reverse which contain EcoRI and XhoI site. We have got the standard GFP-sJanus and GFP-sJanus-m fragments, and we got the target fragments used to construct the expression vector by PCR.
gene of interst：EcoR1-GFP-sJanus -Xho1、EcoR1-GFP-sJanus-m-Xho1
primer：EcoR1-GFP、sJanus-Xho1
EcoR1-GFP: 5’-CGGAATTCATGCGTAAAGGAGAAGAACTT
sJanus-Xho1: 5’-CCGCTCGAGTCAAGCACCGACGGCC
PCR system：（50μl）
|
Buffer |
5μl |
|
dNTPS |
5μl |
|
EcoR1-GFP primer |
2μl |
|
sJanus-Xho1 primer |
2μl |
|
Xba1-GFP-sJanus -Pst1/ Xba1-GFP-sJanus-m-Pst1 |
1μl |
|
Pfu enzyme |
0.5μl |
|
ddH2O |
34.5μl |
cycle
|
95℃ |
5min |
|
95℃ |
30s |
|
1:55.4℃ 2:56.6℃ 3:57.8℃ 4:60.3℃ |
30s |
|
72℃ |
2min |
|
72℃ |
10min |
|
4℃ |
Forever |
qualitative agarose gel electrophpresis：fragments on these four centigrades all worked well.
（The maximum of marker is 2000bp, and following is 1000, 750, 500, 250 and 100bp from up and down, our target sequence is about 1000bp approximately.）
Electrophoresis of the PCR products was identified, and finally PCR product was purified by gel extraction kit to prepare for digestion.
Fragment concentration:EcoR1-GFP-sJanus -Xho1:55.0ng/μL、EcoR1-GFP-sJanus-m-Xho1:60ng/μL
Date: Saturday,8.1.2015
We used enzymes of EcoRI site and XhoI site to digest the PCR product and plasmid. We used T4 DNA ligase to connect them at the temperature of 22 centigrade for about one hour. Then we transformed the expression vectors we had already connected into the Escherichia coli DH5α, then incubated the bacteria for 12h (37℃)
It has been confirmed that these sequences we get are right when detecting them in company.
Date:Monday,8.10.2015
Transformed the expression vectors(concentration:140.3ng/μL、121.4ng/μL) we had already built before (pET28a(+)) into the Escherichia coli BL21, then incubated the bacteria for 12h (37℃).
