HSNU

Lab Notes

Activation of Culture

Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen
Place: Fu Jen University Food Science Department
Date: September 4th, 2015

Material

E.coli(DH5α、CmR J22102)
Tube
LB broth
Inoculating loop
Alcohol Burner

Procedure

Step1:Draw 10mL LB broth with 5mL pipet into a tube (total4).

Step2: Scrape a colony with an inoculating loop sterilized by alcohol burner.

Step3: Add the colony into the tube (two for each strain).

Step4:Keep it in 37℃ incubator.

Preprocess of Growth Curve

Researcher: Leng Yi-Yan, Chang Chun-chieh, Lee Ming-Jhen
Place: Fu Jen University Food Science Department
Date: September 3rd & 4th, 2015

Material

LB agar
0.85% saline
Tube
Dish

Procedure

Solid medium
Step1:Get certain weight of LB broth (25g/L) and agar (1.5%)

Step2: Add the powder into the serum bottle with a wash bottle.

Step3: Add certain amount of ddH₂O into the serum bottle.

Step4:Dissolve the solution with a spinbar.

Step5:Sterilization for 1.5hr.

Step6:Distribute to each dish (10mL/dish).
Buffer solution
Step1: Get certain weight of saline (0.85%)

Step2: Add the powder into the serum bottle with a wash bottle.

Step3: Add certain amount of ddH₂O into the serum bottle.

Step4:Sterilization for 1.5hr.

Step5:Distribute to each tube (9mL/tube).

Plasmid Extraction

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: August 27th, 2015

We extract the plasmid of B0015

Transformation

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: August 12th, 2015

We transform J22106 this time.

Send the DNA sequencing

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: August 20th, 2015

Procedure

Add 223.3 μl and 291.1 μl water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes
Diluted the two primer 10-fold to a concentration of 10μM for use

1μg of the plasmid (220ng/μl)	4.5(μl)
ddH₂O	5.5(μl)
Total	10(μ)l
Primer	2(μl)
	12(μ)l

Send the DNA sequencing

8/14/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 14th, 2015

We successfully draw out the plasmid from E.coli.

8/13/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 13th, 2015

We pick up the single column and incubate it.

8/12/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 12th, 2015

We get another RBS B0032 and transform it.

Send the second DNA sequencing

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: August 11th, 2015

Procedure

Add 223.3 μl and 291.1 μl water to two different primer, and the concentration of the two primer is 100uM. Then put the two primer at 55 degree Celsius for fifteen minutes
Diluted the two primer 10-fold to a concentration of 10μM for use

1μg of the plasmid (220ng/μl)	4.5(μl)
ddH₂O	5.5(μl)
Total	10(μ)l
Primer	2(μl)
	12(μ)l

Send the DNA sequencing

8/11/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 11th, 2015

The transforming is failed.

8/10/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 10th, 2015

We get the part B0034 and transform it.

8/6/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 6th, 2015

Use the enzyme to check the part length correct or not one more time and determine that we success.

8/5/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 5th, 2015

Use the enzyme to check the part length correct or not.

Confirm the first DNA sequencing and Order the primer of second DNA sequencing

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: August 4th, 2015

the primer of second DNA sequencing

TACAGAGTTCTTGAAGTGGTGGCC

TTTAAAGAAAAAGGGCAGGGTGGT

8/4/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: August 4th, 2015

We successfully draw out the plasmid.

Plasmid Extraction

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: July 30th, 2015

We extract the plasmid of B0034 and J23119 and test their concentration

	B0034	J23119
concentration	208 ng/μl	220 ng/μl

7/29/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 29th, 2015

We fell to draw out the plasmid.

Transformation

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: July 28th, 2015

We transform J23119 this time.

7/28/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 28th, 2015

We incubate our E.coli.

7/27/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 27th, 2015

We purify the gel , ligate the part, and transform into the E.coli.

7/24/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 24th, 2015

We use gel electrophoresis to cut our part. Than we purify our gel.

7/23/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 23rd, 2015

We draw out the plasmid from single column by plasmid mini kit.

And start to use restriction enzyme to cut the part E1010 and B0015.

7/22/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 22nd, 2015

We draw out the plasmid from single column by plasmid mini kit but failed.

7/21/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 21st, 2015

We get the part B0015.

Draw out the plasmid from single column by plasmid mini kit.

We are going to do the combine the part in time but our plasmid disappeared.

7/17/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 17th, 2015

Using gel electrophoresis again and check the part have problem.

7/16/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 16th, 2015

We use gel electrophoresis to cut our part, and check the part length and determine that the part B0030 which we have has a mistake.

7/15/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 15th, 2015

Draw out the plasmid from single column by plasmid mini kit{E0040,B0030,E1010,K896008}

7/14/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 14th, 2015

We pick single column, and incubate in another tube.

7/13/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: July 13th, 2015

We get “k89608” part and transform it.

Transformation

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: July,2nd, 2015

Because transformation we did on 6/11 was fail, this week, we did transformation again.

In order to find the cause, we did two control group. One is J23102 the other is the kit provided. And we transform B0034 this time.

Plasmid Purification

Researcher: Shen Yu-Chun, Chen Sheng-Yuan
Place: NTUCM
Date: June 18th, 2015

Material:

70 % Ethanol
Isopropanol
50 ml centrifuge tubes
Plasmid DNA Midi Kit
pSB1C3-BBa_B0030 in DH5α
pSB1C3-BBa_E1010 in DH5α
pSB1A2-BBa_E0040 in DH5α
pSB1A2-BBa_B0010 in DH5α

Notes:

Add RNase A to PL1 Buffer and store at 4℃
Warm PL2 Buffer in a 37℃ waterbath
Use 100~150 ml of bacterial culture for Midi Kit

Protocol:

Flick a PM Column 2~3 times, then place the PM Column on a conical flask.
Equilibrate the PM Column by applying 5 ml of PL4 Buffer by gravity flow
Harvest the bacterial culture 100 ml by centrifuge at 6000 x g for 10 mins
Add 5 ml of PL1 Buffer to resuspend the cell pellet by vortexing or pipetting
Add 5 ml of PL2 Buffer and mix gently by inverting the tube 10 times. DO NOT VORTEX!!!
Place for 10 mins at room temperature until lysate clears
Add 5 ml of PL3 Buffer and mix immediately by inverting the tube 10 times. DO NOT VORTEX!!!
Centrifuge at 15000g for 20 minutes or filtered with a filter paper
Apply the supernatant from step 8. to the equilibrated PM Column and allow it to flow by gravity flow.
Wash the PM Column by using PL5 Buffer 15 ml and allow the column empty by gravity flow.
Discard the filtrate.
Place PM Column in a clean centrifuge and apply 10 ml of PL6 Buffer to elute DNA by gravity flow
Using eluates from step 12. Add 7.5 ml of room temperature isopropanol. Vortex well and let the mixture sit for 2 minutes.
Centrifuge at 12500 x g for 30 minutes.
Remove the supernatant, then add 3 ml of 70% ethanol to wash.
Centrifuge at 12500 x g for 5 minutes, then dry ethanol at room temperature.
Apply 0.2 ml of TE Buffer to resuspend DNA.

6/18/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: June 18th, 2015

We get “B0030, E0040, E1010”part,and transform them.

6/15/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: June 15th, 2015

We do the ligation, and then transform the plasmid into E.coli

Mixing with LB broth, we smear the solid on the plate.

6/14/2015 Cadmium

Researcher: Chang I, Chi Ying-Cheng
Place: NTNU
Date: June 14th, 2015

This is our first time do the experience.

We are going to use the restriction enzyme to cut the sample part {E GFP} and add a part by ligation.

So first, we use enzyme to cut the plasmid, and use gel electrophoresis to cut our part.

Than we purify our gel.

Transformation

Researcher: Shen Yu-Chun, Chen Sheng-Yuan
Place: NTUCM
Date: June 11th, 2015

Material:

E.coli DH5α (ps: E.coli should be kept on the ice at all time)
Plasmid : pSB1A2-BBa_E0040(Ampicillin-resistant) GFP
Plasmid : pSB1C3-BBa_B0010(Chloramphenicol-resistant) Terminator
Plasmid : pSB1C3-BBa_B0030(Chloramphenicol-resistant) RBS
Plasmid : pSB1C3-BBa_E1010(Chloramphenicol-resistant) RFP
LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )
LB plate(LB broth + 1% agar)
Antibiotics : Ampicillin & Chloramphenicol (100μg/mL for each)

Protocol:

Add 0.5μL of plasmid into 100μL of E.coli and mix by tapping the tube.(ps: the quantity of plasmid is dependent on bacterial competency)
Put the tube on the ice for 20~30mins.
Remove from the ice and put the tube to the 42℃ hot bath for 45 sec.
After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.
Add 500 μL of LB broth into the tube and incubate for 30~60 mins at 37℃
Take out the tube and put into 6000 rpm centrifuge for 5 mins.
Remove supertant and remain about 100μL of LB to resuspend
Spread onto LB plate containing the appropriate antibiotic
Incubate overnight for 12~16 hrs at 37℃.

Transformation

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: June 11th, 2015

This week, we did transformation.

We transform B0034, B0015, I765001, I732005.

Ag⁺ adsorb on Au-NPs affect with different heavy metal ( Cu, Hg )

Researcher: Lin Sheng, Chu Wei-Min
Place: NTU Chemistry
Date: June 4th, 2015

Procedure

total:400 μL
material:
- 13nm Au-NPs 15mM,Cu 1mM100μM10μM
- Hg 1mM100μM10μM,pH7 Tris-Borate buffer 100mM
- AR 100μM,H₂O₂ 1mM

Caclulate:

Cu²⁺	buffer	DI water	Au-NPs	Ag⁺	Mⁿ⁺	AR	H₂O₂
target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
Control	40μL	220μL	20μL	40μL	0μL	40μL	40μL
100μM	40μL	180μL	20μL	40μL	40μL(1mM→100μM)	40μL	40μL
10μM	40μL	180μL	20μL	40μL	40μL(100μM→10μM)	40μL	40μL
1μM	40μL	180μL	20μL	40μL	40μL(10μM→1μM)	40μL	40μL

Hg⁺	buffer	DI water	Au-NPs	Ag⁺	Mⁿ⁺	AR	H₂O₂
target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
Control	40μL	220μL	20μL	40μL	0μL	40μL	40μL
100μM	40μL	180μL	20μL	40μL	40μL(1mM→100μM)	40μL	40μL
10μM	40μL	180μL	20μL	40μL	40μL(100μM→10μM)	40μL	40μL
1μM	40μL	180μL	20μL	40μL	40μL(10μM→1μM)	40μL	40μL

Cu²⁺	buffer	DI water	Au-NPs	Ag⁺	Mⁿ⁺	AR	H₂O₂
target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
Control	40μL	260μL	20μL	0μL	0μL	40μL	40μL
100μM	40μL	220μL	20μL	0μL	40μL(1mM→100μM)	40μL	40μL
10μM	40μL	220μL	20μL	0μL	40μL(100μM→10μM)	40μL	40μL
1μM	40μL	220μL	20μL	0μL	40μL(10μM→1μM)	40μL	40μL

Hg⁺	buffer	DI water	Au-NPs	Ag⁺	Mⁿ⁺	AR	H₂O₂
target	50mM→5mM		15mM→750μM	100μM→10μM		100μM→10μM	1mM→100μM
Control	40μL	260μL	20μL	0μL	0μL	40μL	40μL
100μM	40μL	220μL	20μL	0μL	40μL(1mM→100μM)	40μL	40μL
10μM	40μL	220μL	20μL	0μL	40μL(100μM→10μM)	40μL	40μL
1μM	40μL	220μL	20μL	0μL	40μL(10μM→1μM)	40μL	40μL

Result:

We put all the result into fluorescent reader.

The horizontal axis:1 means control, 2 means 100μM, 3 means 10μM, 4 means 1μM.And series1 represent no Ag⁺ adsorb on Au-NPs,series2 stand for the experiment with Ag⁺ adsorb on Au-NPs which had time mistake(there are one hour shock between adding Mⁿ⁺ and AR), and the third series is the correct one with Ag⁺ adsorb on Au-NPs.

Au-NPs affect with different heavy metal (Cu, Pb, Hg,Zn)

Researcher: Lin Sheng, Chu Wei-Min
Place: NTU Chemistry
Date: May 28th, 2015

Procedure

total:500 μL
material:
- 3nm Au-NPs 1.5mM,Cu 10mM1mM100μM10μM
- Cd 10mM1mM100μM10μM,Hg 10mM1mM100μM10μM
- Zn10mM1mM100μM10μM,pH7 Pb buffer 100mM

Caclulate:

Cu	buffer	DI water	Au-NPs	Mⁿ⁺
target	100mM→10mM		1.5mM→3μM	0.1x
Control	50μL	350μL	100μL	0
1mM	50μL	300μL	100μL	50μL(10mM→1mM)
100μM	50μL	300μL	100μL	50μL(1mM→100μM)
10μM	50μL	300μL	100μL	50μL(100μM→10μM)
1μM	50μL	300μL	100μL	50μL(10μM→1μM)

Cd	buffer	DI water	Au-NPs	Mⁿ⁺
target	100mM→10mM		1.5mM→3μM	0.1x
Control	50μL	350μL	100μL	0
1mM	50μL	300μL	100μL	50μL(10mM→1mM)
100μM	50μL	300μL	100μL	50μL(1mM→100μM)
10μM	50μL	300μL	100μL	50μL(100μM→10μM)
1μM	50μL	300μL	100μL	50μL(10μM→1μM)

Hg	buffer	DI water	Au-NPs	Mⁿ⁺
target	100mM→10mM		1.5mM→3μM	0.1x
Control	50μL	350μL	100μL	0
1mM	50μL	300μL	100μL	50μL(10mM→1mM)
100μM	50μL	300μL	100μL	50μL(1mM→100μM)
10μM	50μL	300μL	100μL	50μL(100μM→10μM)
1μM	50μL	300μL	100μL	50μL(10μM→1μM)

Zn	buffer	DI water	Au-NPs	Mⁿ⁺
target	100mM→10mM		1.5mM→3μM	0.1x
Control	50μL	350μL	100μL	0
1mM	50μL	300μL	100μL	50μL(10mM→1mM)
100μM	50μL	300μL	100μL	50μL(1mM→100μM)
10μM	50μL	300μL	100μL	50μL(100μM→10μM)
1μM	50μL	300μL	100μL	50μL(10μM→1μM)

Result:

H1~H4 Hg1mM~1μM

H4~H8 Cd1mM~1μM

G1~G4 Cu1mM~1μM

G5~G8 Zn1mM~1μM

TRANSFORMATION

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: TMU lab
Date: May 28th, 2015

Materials

Resuspended DNA (B0015, E0240, E0840, E0420, E0430, I13001, J23119, B1006)
Competent cells (20μl DH5α per transformation)
Ice (in ice container)
2ml tube
42℃ water bath
Petri dishes with LB agar and appropriate antibiotic
Spreader
37℃ incubator
SOC Media (180μl per transformation)
Pipettman
Centrifuge

Procedure

Start thawing the competent cells on ice.
Add 20 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
Close tubes and incubate the cells on ice for 30 minutes.
Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
Incubate the cells on ice for 2 minutes for recover.
Add 180 μL of SOC Media(without antibiotic) and then incubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
Centrifuge the cells at 2000 rpm for 2 minutes.
Remove 100 μL of the supernatant by the pipettmen.
For the control, label two petri dishes with LB agar and the appropriate antibiotic(chloramphenicol). Plate 100 μl of the transformation onto the dishes, and spread.
Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
Store the plate in 4 ℃.

TRANSFORMATION

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: TMU lab
Date: May 21th, 2015

Materials

Resuspended DNA (Resuspend well in 10μl dH₂0, pipette up and down several times, let sit for a few minutes)
Competent cells (100μl DH5α per transformation)
Ice (in ice container)
2ml tube (1 per transformation)
42℃ water bath
Petri dishes with LB agar and appropriate antibiotic (1 per transformation)
Spreader (2 per transformation)
37℃ incubator
LB broth (900μl per transformation)
Pipettman
Centrifuge

Procedure

Start thawing the competent cells on ice.
Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
Close tubes and incubate the cells on ice for 30 minutes.
Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
Incubate the cells on ice for 2 minutes for recover.
Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
Centrifuge the cells at 2000 rpm for 2 minutes.
Remove 800 μL of the supernatant by the pipettmen.
For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 150 μl of the transformation onto the dishes, and spread.
Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
After picking colonies, store the plate in 4 ℃.

TRANSFORMATION

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: TMU lab
Date: May 7th, 2015

Materials

Resuspended DNA (Resuspend well in 10μl ddH₂0, pipette up and down several times, let sit for a few minutes)
Competent cells (100μl DH5α per transformation)
Ice (in ice container)
2ml tube (1 per transformation)
42℃ water bath
Petri dishes with LB agar and appropriate antibiotic (1 per transformation)
Spreader (1 per transformation)
37℃ incubator
LB broth (900μl per transformation)
Pipettman
Centrifuge

Procedure

Start thawing the competent cells on ice.
Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
Add 1 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
Close tubes and incubate the cells on ice for 30 minutes.
Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
Incubate the cells on ice for 2 minutes for recover.
Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
Centrifuge the cells at 2000 rpm for 2 minutes.
Remove 800 μL of the supernatant by the pipettmen.
For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 μl of the transformation onto the dishes, and spread.
Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up, and then store the plate in 4 ℃.

First-Strand cDNA Synthesis Using M-MLV RT

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: April 30th, 2015

Material

randon primer 1㎕
2MUG RNA F10 1.95㎕
2MUG RNA m1 1.95㎕
10mM dNTP 1㎕
ddH₂O
5× FSB 4㎕
0.1M DTT 2㎕
RNase out 1㎕
M-MLV RT 1㎕
eppendorf

Procedure

A 20-㎕ reaction volume can be used for 1 ng-5MUG of total RNA or 1-500 ng of mRNA.

Add the following components to a nuclease-free microcentrifuge tube:
- 1㎕ oligo(dT)_12-18(500μg/ml), or 50-250 ng random primers, or 2pmole gene -specific primer
- 1 ng to 5MUG total RNA or 1 ng to 500ng of mRNA
- 1㎕ 10 mM dNTP Mix(10 mM each dATP,dGTP,dCTP and dTTP at neutral pH)
- Sterile, distilled water to 12㎕
Heat mixture to 65℃ for 5 min an quick chill on ice. Collect the contents of the tube by brief centrifugation and add:
- 4㎕ 5X First-Strand Buffer
- 2㎕ 0.1 M DTT
- 1㎕ RNaseOUTTM Recombinant Ribonuclease Inhibitor (40 units/㎕)
(Note: When using less than 50 ng of starting RNA, the addition of RNaseOUTTM is essential.)
Mix contents of the tube gently and incubate at 37℃ for 2 min.
Add 1㎕(200 units) of M-MLV RT,a and mix by pipetting gently up and down. If using random primers, incubate tube at 25℃ for 10 min.
Incubate 50 min at 37℃.
Inactivate the reaction by heating at 70℃ for 15 min.

Result

TRANSFORMATION

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: TMU lab
Date: April 30th, 2015

Materials

Resuspended DNA (J04450)
Competent cells (100μl DH5α per transformation)
Ice (in ice container)
2ml tube
42℃ water bath
Petri dishes with LB agar and appropriate antibiotic
Spreader
37℃ incubator
LB broth (900μl per transformation)
Pipettman
Centrifuge

Procedure

Start thawing the competent cells on ice.
Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
Add 2 μL of the DNA to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
Close tubes and incubate the cells on ice for 30 minutes.
Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
Incubate the cells on ice for 2 minutes for recover.
Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
Centrifuge the cells at 2000 rpm for 2 minutes.
Remove 800 μL of the supernatant by the pipettmen.
For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 100 μl and 100 μl of the transformation onto the dishes, and spread.
Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
After picking colonies, store the plate in 4 ℃.

Plasmid Purification & Gel electrophoresis

Researcher: Shen Yu-Chun, Chen Sheng-Yuan
Place: NTUCM
Date: April 30th, 2015

Material:

Resuspension Buffer S1
Lysis Buffer S2
Neutralization Buffer S3
Equilibration Buffer N2
Wash Buffer N3
Elution Buffer N5
Overnight bacteria
Room-temperature isopropanol
1% agarose
TE buffer (using at Gel electrophoresis)

Protocol:(Plasmid Purification)

Harvest bacteria from an LB culture by centrifugation at 6000 rpm for 10 mins at 4℃
Resuspend the pellet of bacterial cells in Buffer S1.
Add Buffer S2 the suspension .Mix by inverting the tube for 6~8 times. Incubate the mixture at 18~25℃ for 2~3 mins.
Add Buffer S3 (pre-cooled at 4℃ ) to the suspension. Immediately mix the lysate by inverting the flask 6~8 times.
Equilibrate a Column with Buffer N2
Place the folded filter in a funnel of appropriate size. Wet the filter with a few drop of Buffer N2 and load the bacterial lysate onto the wet filter.
Load the cleared lysate from 6 onto the column. Allow the column to empty by gravity flow.
Wash the column with Buffer N3.
Elute the plasmid DNA with Buffer N5.
Add room-temperature isopropanol to precipitate the eluted plasmid DNA. Mix carefully and centrifuge at 12000 g for 30 mins at 4℃. Carefully discard the supertant.
Add room-temperature 70% ethanol to the pellet. Vortex briefly and centrifuge at 12000 g for 10 min at 18~25℃.
Carefully remove ethantol from the tube with a pipette tip. Allow the pellet to dry at 18~25℃ no iess than the indicated time.

First-Strand cDNA Synthesis Using M-MLV RT

Researcher: Chang Ko-Yu, Chu Yi-Chia
Place: Academia Sinica
Date: April 30th, 2015

Preparing Samples

Homogenizing samples

Determine your sample type, and perform homogenization at room temperature according to the table below. The sample volume should not exceed 10% of the volume of TRIzol Reagent used for homogenization. Be sure to use the indicated amount of TRIzol Reagent, because an insufficient volume can result in DNA contamination of isolated RNA.

Sample Type

Action

Tissues

Add 1mL TRIzol Reagent per 50-100 mg of tissue sample.
Homogenize sample using a glass-Teflon or power homogenizer.

Note: Process or freeze tissue samples immediately upon collection.

RNA Isolation Procedurec

Always use the appropriate precautions to avoid RNase contamination when preparing and handling RNA.

RNA precipitation

(Optional) When precipitating RNA from small sample quantities (<10⁶ cells or < 10 mg tissue), add 5-10μg of RNase-free glycogen as a carrier to the aqueous phase.
- Note: Glycogen is co-precipitated with the RNA,but does not inhibit first-strand synthesis at concentrations ≤4mg/mL,and does not inhibit PCR.
Add 0.5mL of 100% isopropanol to the aqueous phase, per 1mL of TRIzol Reagent used for homogenization.
Incubate at room temperature for 10 minutes.
Centrifuge at 12,000 × g for 10 minutes at 4℃.
- Note: The RNA is often invisible prior to centrifugation, and forms a gel-like pellet on the side and bottom of the tube.
Proceed to RNA wash.

Proceed to RNA wash.

Remove the supernatant from the tube,leaving only the RNA pellet.
Wash the pellet,with 1mL of 75% ethanol per 1mL of TRIzol Reagent used in the initial homogenization.
- Note: The RNA can be stored in 75% ethanol at least 1 year at-20℃, or at least 1 week at 4℃.
Vortex the sample briefly,then centrifuge the tube at 7500 × g for 5 minutes at 4℃.Discard the wash.
Vacuum or air dry the RNA pellet for 5-10 minutes. Do not dry the pellet by vacuum centrifuge.
Proceed to RNA resuspension.

RNA resuspension

Resuspend the RNA pellet in RNase-free water or 0.5% SDS solution(20-50㎕) by passing the solution up and down several times through a pipette tip.
- Note: Do not dissolve the RNA in 0.5% SDS if it is to be used in subsequent enzymatic reactions.
Incubate in a water bath or heat block set at 55-60℃ for 10-15 minutes.
Proceed to downstream application, or store at -70℃.

Transformation

Researcher: Shen Yu-Chun, Chen Sheng-Yuan
Place: NTUCM
Date: April 13th, 2015

Material:

E.coli DH5α (ps: E.coli should be kept on the ice at all time)
Plasmid pBR322(Ampicillin-resistant)
LB broth (10 g /L Tryptone, 5 g/L Yeast extract, 5 g/L NaCl )
LB plate(LB broth + 1% agar)
Antibiotics : Ampicillin(100μg/mL)

Protocol:

Add 5μL of DNA into 100μL of E.coli and mix by tapping the tube. (ps: the quantity of DNA is dependent on bacterial competency)
Put the tube on the ice for 20~30mins.
Remove from the ice and put the tube to the 42℃ hot bath for 45 sec.
After heat shock, put the tube into the ice IMMEDIATELY for 2 mins.
Add 500 μL of LB broth into the tube and incubate for 30~60 mins at 37℃
Take out the tube and put into 6000 rpm centrifuge for 5 mins
Remove supertant and remain about 100μL of LB to resuspend
Spread onto LB plate containing the appropriate antibiotic
Incubate overnight for 12~16 hrs at 37℃ and you will see so many colonies on the LB plate!!!(A colony is a white dot on the picture below)

Ligation

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: TMU lab
Date: March 26th, 2015

To an autoclaved, 1.5ml microcentrifuge tube, add the following:

	For Cohesive Ends
5X Ligase Reaction	4 μl
Vector D	3 to 30 fmol
Insert D	9 to 90 fmol
T4 DNA Ligase (	1 unit (in 1 μl)
Autoclaved distilled	to 20 μl

Mix gently. Centrifuge briefly the contents to the bottom of the tube.
Incubate at room temperature for 5 min.
Use 2 μl of the ligation reaction to transform 100 μl of competent cells.

3/19/2015

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: TMU
Date: Match 19th, 2015

Add restriction enzyme (EcoRI / SpeI)

Total:40ul

Plasmid DNA:500ng (77.7ng/ul, 500/77.7≒6.5ul)

ddH2O	22.5ul
10Xbfr(EcoRI)	4ul
10XBSA	4ul
Plasmid DNA	6.5ul
EcoRI	1.5ul
SpeI	1.5ul
Total	40ul

TRANSFORMATION

Researcher: Han Yun-An, Chang Yu-Ting, Lee Chang-Lung
Place: Taipei Medical University
Date: March 12th, 2015

Materials

Resuspended DNA (Resuspend well in 10μl dH₂0, pipette up and down several times, let sit for a few minutes)
Competent cells (100μl DH5α per transformation)
Ice (in ice container)
2ml tube (1 per transformation)
42℃ water bath
Petri dishes with LB agar and appropriate antibiotic (2 per transformation)
Spreader (2 per transformation)
37℃ incubator
10pg/μl RFP Control (pSB1C3 w/ BBa_J23102)
LB broth (900μl per transformation)
Pipettman
Centrifuge

Procedure

Start thawing the competent cells on ice.
Add 100 μL of thawed competent cells into pre-chilled 2ml tube, labelled for your control.
Add 1 μL of the DNA with RFP Control to the 2ml tube. Pipet up and down a few times, gently. Make sure to keep the competent cells on ice.
Close tubes and incubate the cells on ice for 30 minutes.
Heat shock the cells by immersion in a pre-heated water bath at 42℃ for 60 seconds.
Incubate the cells on ice for 3 minutes for recover.
Add 900 μL of LB broth(without antibiotic) and thenincubate the cells at 37℃ for 1 hour while the tubes are shaking(200~250 rpm).
Centrifuge the cells at 2000 rpm for 2 minutes.
Remove 800 μL of the supernatant by the pipettmen.
For the control, label two petri dishes with LB agar and the appropriate antibiotic(s). Plate 50 μl and 150 μl of the transformation onto the dishes, and spread.
Incubate the plates at 37℃ for 12-16 hours, making sure the agar side of the plate is up.
After picking colonies, store the plate in 4 ℃.

Team:HSNU-TAIPEI/labnotes

Lab Notes

Activation of Culture

Material

Procedure

Preprocess of Growth Curve

Material

Procedure

Plasmid Extraction

Transformation

Send the DNA sequencing

Procedure

8/14/2015 Cadmium

8/13/2015 Cadmium

8/12/2015 Cadmium

Send the second DNA sequencing

Procedure

8/11/2015 Cadmium

8/10/2015 Cadmium

8/6/2015 Cadmium

8/5/2015 Cadmium

Confirm the first DNA sequencing and Order the primer of second DNA sequencing

8/4/2015 Cadmium

Plasmid Extraction

7/29/2015 Cadmium

Transformation

7/28/2015 Cadmium

7/27/2015 Cadmium

7/24/2015 Cadmium

7/23/2015 Cadmium

7/22/2015 Cadmium

7/21/2015 Cadmium

7/17/2015 Cadmium

7/16/2015 Cadmium

7/15/2015 Cadmium

7/14/2015 Cadmium

7/13/2015 Cadmium

Transformation

Plasmid Purification

Material:

Notes:

Protocol:

6/18/2015 Cadmium

6/15/2015 Cadmium

6/14/2015 Cadmium

Transformation

Material:

Protocol:

Transformation

Ag+ adsorb on Au-NPs affect with different heavy metal ( Cu, Hg )

Procedure

Au-NPs affect with different heavy metal (Cu, Pb, Hg,Zn)

Procedure

TRANSFORMATION

Materials

Procedure

TRANSFORMATION

Materials

Procedure

TRANSFORMATION

Materials

Procedure

First-Strand cDNA Synthesis Using M-MLV RT

Material

Procedure

Result

TRANSFORMATION

Materials

Procedure

Plasmid Purification & Gel electrophoresis

Material:

Protocol:(Plasmid Purification)

First-Strand cDNA Synthesis Using M-MLV RT

Preparing Samples

RNA Isolation Procedurec

RNA precipitation

Proceed to RNA wash.

RNA resuspension

Transformation

Material:

Ag⁺ adsorb on Au-NPs affect with different heavy metal ( Cu, Hg )