Project Breakdown

(Click Images to Enlarge)

Molecular Biology

Inorganic phosphate ions enter the periplasm through the PhoE phosphorin.
Once in the Periplasm phosphate can enter the cytoplasm in one of two ways – non-specific (through Pit) or specific transport. For the latter, the substrate binding protein (PstS) of the Phosphate-specific ABC transporter (Pst) binds the phosphate ion.
It then brings the ion in close proximity to the transporter’s transmembrane domains – the permeases PstC and PstA. These two proteins provide the translocation pathway and the phosphate’s uptake is energized by a homodimer of PstB (an ATP-ase protein that hydrolyses ATP).
Phosphate ions can then be used for cellular metabolism which includes ATP formation from ADP and phosphate by the F-ATPase protein. ATP is the substrate for the Polyphosphate kinase enzyme (PPK1) which reversibly transfers the γ-phosphate of ATP onto a chain of polyphosphate (PolyP). Amongst many roles polyphosphate acts as energy and phosphate storage molecule.
Polyphosphate can be used to generate ATP from ADP and in the case of phosphate shortage, the cell releases orthophosphate residues using the Exopolyphosphatase (PPX) enzyme which cleaves a residue at a time from PolyP’s

Phosphate Assay - Measuring orthophosphate and polyphosphate levels

In order to determine whether our organism "Phil" was accumulating phosphate, we had to develop a test for quantifying the levels of phosphate in media and within our bacterial cells. We developed a reliable technique to measure both orthophosphate and polyphosphate concentrations in cell supernatant and within growth media.

Using the ABCAM kit (ab65622) containing malachite green and ammonium molybdate as indicator components, we enhanced the existing protocol to improve the reliability and accuracy of our tests. This was necessary following preliminary experiments on E.coli supernatant showing that the unaltered assay did not detect polyphosphate. Building on multiple tests, we incorporated an acid hydrolysis and neutralisation step in order to accurately measure polyphosphate levels.

Visualization of polyphosphate granules in E.coli nucleoids using fluorescent microscopy

Introduction

A widely accepted method for in situ polyphosphate (polyP) detection is fluorescence microscopy using a fluorochrome, 4’, 6 – diamino-2-phenylindole (DAPI) at high concentrations ranging from 3 to 50 µg/ ml1. Interaction of polyP with DAPI shifts the emission maxima of the dye from 456 nm emitting blue fluorescence to 526 nm emitting bright yellow- green fluorescence^2,3,4.

Fluorescence microscopy imaging (63x)

Micrographs of immunostained cell coagulates and tissue sections were captured with Nikon Eclipse T300 inverted wide field microscope equipped with a plan apochromat 63x oil immersion objective (NA 1.4) (Nikon, Tokyo, Japan). The images were acquired using Volocity 6.0 software (PerkinElmer, Inc) on the same day using the same exposure time, which allowed a direct comparison between slides.

Confocal microscopy imaging (100x)

Confocal imaging was performed using Zeiss LSM 710 inverted confocal microscope equipped with a plan apochromat 100x oil immersion objective (NA 1.4). The excitation filter was set at 405 nm and emission filter at 526 nm. Image acquisition was performed using Carl Zeiss imaging software ZEN (black edition 2012).

Troubleshooting

The pH of the washing buffer should be 7.0 as the DAPI stain does not react with the polyphosphate granules even at the slight variation of pH. It was also observed that the application of the dye to the specimen at concentrations greater than 25 µg/ ml resulted in only blue light emission making the detection of polyP impossible.

Anticipated results

DAPI-stained polyphosphate granules present in the E.coli nucleoids show bright yellow- green fluorescence at 526 nm upon observation under confocal microscope (Figure 1) whereas the cells devoid of the granules emit a light blue fluorescence at 456 nm.

Figure 1: Detection of polyPgranules in E.coli nucleoids stained with DAPI using fluorescent microscopy. Green signal indicates the presence of polyphosphate granules in the cells of:

A)Chlorella sp. (example from Mukherjee and Ray, 2015); 63x
B)Wild type strain BW25113; 100x
C)Δppk; 100x
D)Δppx; 100x

References

Ryazanova, L. et al. The early stage of polyphosphate accumulation in Saccharomyces cerevisiae: comparative study by extraction and DAPI staining. Adv. Biosci Biotech. 2, 293-297 (2011).
Tijssen, J.P. et al. Localization of polyphosphates in Saccharomyces fragilis, as revealed by 4’,6 – diamidino-2-phenylindole fluorescence. Biochim Biophys Acta. 721, 394-398 (1982).
DAPI Staining Protocol. Laboratory for Experimental Botany, University of Ljubljana, Slovenia. http:// botanika.biologija.org/exp/protocols/DAPI-staining-protocol.pdf (accessed September 18, 2015).
Gunther, S. et al. Dynamics of polyphosphate-accumulating bacteria in wastewater treatment plant microbial communities detected via DAPI (4’,6’ – diamidino-2-phenylindole) and tetracycline labeling. Appl. Environ. Microb.75, 2111-2121 (2009).
Mukherjee C. and Ray Krishna. An improved DAPI staining procedure for visualization of polyphosphate granules in cyanobacterial and microlagal cells. Nature Protocol Exchange (accessed September 18, 2015)

Growth Assay - Measuring Phil's growth

To be able to tell whether Phil was going to work in environments with variable phosphate concentrations, we devised an assay to measure his growth rates. Using the KEIO collection we were able to determine the effect of each gene we were tampering with. Knocking out phosphate transporters exhibits a growth phenotype, and based on modelling results we expected a change in the growth as phosphate metabolism is interfered with.

Growth assays were based on optical density measurements of cell cultures at 650nm over a set period of time, either 7, 24 or 48 hours. The growth rates and curves of multiple phosphate transporter knockout strains have been compared and analysed to find both a chassis for characterisation of genes, as well as, to experimentally test for a decrease in cell growth.

Initially we decide to test each of our KEIO collection knockouts, these consisted of the interference several genes:

ΔpstA - Phosphate ABC transporter permease
ΔpstB - Phosphate ABC transporter, ATPase
ΔpstC - Phosphate ABC transporter permease
ΔpstS - Phosphate ABC transporter periplasmic binding component
ΔphoE - Outer membrane phosphoporin protein E
Δppk - Polyphosphate kinase
Δppx - Exopolyphosphatase
Each gene was tested in triplicate in MOPS media (see fine details) containing a variety of phosphate concentrations in order to determine how each phosphate transporter reacts. Before carrying out growth assays with these particular mutants we used colony PCR to verify the knockouts. This showed that the mutations were correct in the bacteria.

Figure 1: Picture showing Colony PCR verification of KEIO collection

Name	Sequence	Estimated Tm °C	Size bp
PhoE for	CCGGCAATATTCATTAAAACTGATACGTC	58	29
Phoe rev	ATTCGCGCGTTAATTAAAATCAGGAAT	58	27
ppk for	CCGTGAATAAAACGGAGTAAAAGTGG	58	26
ppk rev	AGGGTTATTCAGGTTGTTCGAGTGA	59	25
ppx for	AATCACTCGAACAACCTGAATAACCC	58	26
ppx rev	AGTATTAAGCGGCGATTTCTGGTGT	60	25
pstA for	AGCAATATCAACCGTGTTTATTCTTCGC	59	28
pstA rev	CTAAGAATGAGGGGGCACGCTAATG	60	25
pstB for	TGAATCAACCGTAACGACCGGTGAT	61	25
pstB rev	GCACGATGAGGAAAAGATTGCAATG	59	25
pstC for	CCATTAGCGTGCCCCCTCATT	60	21
pstC rev	AAACGCGTTTAACTGAAGAGTAACTTATG	57	29
pstS for	TTTATTAGTACAGCGGCTTACCGCT	59	25
pstS rev	ATGAATCCTCCCAGGAGACATTATG	57	25

Table 1. Primers used for PCR verification

Our first growth experiment was to test two knockouts, Δppx and Δppk , against the with the parent strain BW25113. We did this for 48 hours at concentrations of 1.32mM, 0.1mM and 0 mM phosphate. Overall no real difference was observed in Δppx and Δppk.

Figure 2: Graphs showing a 48 hour growth assay comparing BW25113, ΔPPK and ΔPPX. Cells were grown in MOPS media at different phosphate concentrations of 1.32mM (Figure 1A) 0.1mM (Figure 1B) and 0mM ( Figure 1C). Overall no significant difference observed. Error bars show standard error of the mean. Assay was started at 0.01 OD650 and OD650 was measured using a BMG FLUOstar Omega plate reader.

Our next experiment was to consider the difference in growth of knockouts ΔpstA and ΔpstC compared to that of the parent strain. This assay was performed for only 24h hours as we saw that stationary phase was reached at 12 hours and so it was unnecessary to continue for a longer time period. Also we decided to increase the number of different phosphate concentrations used. We tested the strains at 1.32mM, 0.1mM, 0.05mM, 0.01mM and 0mM phosphate concentration. A significant difference in growth phenotype was observed with ΔpstC as well as ΔpstA showing a reduction in growth at 0.05mM. This corresponds as these knockouts might be candidates to characterise our transport constructs which after transformation in these knockouts should restore the wild type phenotype .

Figure 3: Graphs showing a 24 hour growth assay comparing BW25113, ΔpstA and Δ pstC. Cells were grown in MOPS media with different phosphate concentrations of 1.32mM (Figure 2A) , 1.0mM (Figure 2B), 0.1mM (Figure 2C), 0.05mM (Figure 2D), 0.01mM (Figure 2E) and 0mM (Figure 2F). Error bars show standard error of the mean. Assay was started at 0.01 OD650 and OD650 was measured using a BMG FLUOstar Omega plate reader. JJ needs to do stats on this

Furthering our tests on the KEIO collection knockouts we performed a growth assay testing ΔpstB and ΔpstS against the parent strain. This assay used the same phosphate concentrations as our previous one and again lasted 24 hours. Overall no real difference was shown.

Figure 4: Graphs showing a 24 hour growth assay comparing BW25113, ΔpstB and Δ pstS. Cells were grown in MOPS media with different phosphate concentrations of 1.32mM (Figure 3A) , 1.0mM (Figure 3B), 0.1mM (Figure 3C), 0.05mM (Figure 3D), 0.01mM (Figure 3E) and 0mM (Figure 3F). Error bars show standard error of the mean . Assay was started at 0.01 OD650 and OD650 was measured using a BMG FLUOstar Omega plate reader.

The final of the KEIO collection knockouts to test was ΔphoE. This was tested against parent strain BW25113 for 24 hours in phosphate concentrations of 1mM, 0.1mM, 0.05mM and 0mM. A slight difference between growth phenotypes was observed, however since PhoE is a phosphoporin which is expressed (REF) under stress a knockout does correspond to a reduction in growth.

Figure 5: Graphs showing a 24 hour growth assay comparing BW25113 with ΔphoE. Cells were grown in MOPS media with different phosphate concentrations of 1mM (Figure 4A) , 0.1mM (Figure 4B), 0.05mM (Figure 4C) and 0mM (Figure 4D). Standard Error Bars. Assay was started at 0.01 OD650 and OD650 was measured using a BMG FLUOstar Omega plate reader.

From the growth assays using the KEIO collection mutants we decided that the best chassis for characterisation of genes would be ΔpstC, since this is the one that showed the greatest change in growth phenotype from the parent strain. Unfortunatly due to unforseen circumstance we were unable to use the plate reader for the remainder of our experminents. Therefore using this data that we collected we applied to a manual version of our growth assay (PROTOCOLS). Due to the limitations of time we have we were unable to use MOPS as the growth was too slow to see a difference. Therefore we switched to LB. We then used this growth assay to focus on characterising our transports, however at the time only Sinorhizobium meliloti pstSCAB could be characterised. Here we tested this construct in triplicate in LB media. The growth assay was performed over 7 hours to capture the growth rate in its exponential phase. Our construct had been put under a promoter induced by IPTG so we decided to test the genes both with and without this due to the stress induced by IPTG. Overall no significant difference was observed between ΔpstC and smpstC. However there was a difference seen between ΔPstC and BW25113. Suggesting that this transporter might not be as efficient. However when compared between IPTG and no IPTG we found that there was an increase in growth proposing that this part can restore some measure of the growth phenotype.

Figure 6: Graphs showing 7 hour growth assays comparing BW25113, ΔpstC and ΔpstC+smpst. Cell were tested LB without IPTG (Figure 6A) and with IPTG (Figure 6B). Error bars show standard error of the mean. Assay was started at 0.1 OD650

Figure 7. A graph showing a comparison of the growth rates observed in ΔpstC+smpstC with and without IPTG. Assay was started at 0.1 OD650 .

What is MOPS media?

Shortened for "3-(N-morpholino) propanesulfonic acid", it has an almost completely neutral pH and can be used as a replacement media for LB that doesn't have phosphate in it. This allowed us to measure growth at variable concentrations of phosphate by adding the amount of phosphate we desired.

What is the KEIO collection?

This is biggest collection of knockout strains of Escherichia coli using parent strain BW25113. The knockout strains were created through single-gene deletions of all nonessential genes.

Team:York/ProjectBreakdown