Team:Hamburg/Basic Part
Basic Parts
miRNA2911
The miRNA2911 plays the central role in our project. In reference to our ultimate goal it shall be combined with a light inducible promoter system to trigger the miRNA production accurately. In the lab we managed a composite biobrick only with a constitutive promoter yet (constitutive promoter and miRNA).
BioBrick state: We validated the miRNA2911 biobrick by sequencing and submitted it to the registry.
Sequence: (Prefix and Suffix)
5'
GAATTCGCGGCCGCTTCTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG
3'
Biological context: Lonicera japonica or the Japanese honeysuckle plant is a well-known Chinese herb and has been used to effectively treat influenza infection for thousands of years. The group around Zhou found that the major portion of detected miRNAs in this plant are being degraded by boiling and only miRNA2911 stayed resistant and active in a decoction. Throughout a bioinformatival prediction and luciferase reporter assays they showed that miRNA2911 has antiviral properties by targeting various Influenza A viruses (IAV); e.g. H1N1, H5N1, H7N9. miRNA2911 is highly stable because of its folding and elevated levels could be detected in peripheral blood and lung tissues of mice after gavage feeding of the honeysuckle decoction.
GroEL
After the miRNA production is conducted in a sufficient amount, a cell lysis is intented to release this product. Therefore we employed a GroEL promoter sequence, which activity is received at higher temperatures (42° C). Regarding our ultimate goal, an expression of a cell lysis protein (e.g. PezT) follows. We designed a composite part of GroEL with a blue pigment to verify its heat-induction ability (GroEL promoter and blue pigment).
BioBrick state: We submitted the GroEL biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR.
Sequence: (Prefix and Suffix, RBS, Pribnow sequence)
5'
GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGTAGCGGCCGCTGCAG
3'
Biological context: XXX
Note
In order to be considered for the Best New Basic Part award, you must fill out this page. Please give links to the Registry entries for the Basic parts you have made. Please see the Registry's Help:Parts page for more information on part types.
A basic part is a functional unit of DNA that cannot be subdivided into smaller component parts. BBa_R0051 is an example of a basic part, a promoter regulated by lambda cl.
Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are many opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts.