Team:Hamburg/Composite Part

Composite Parts

constitutive promoter and miRNA

Following our ultimate goal of a light-inducible expression system for the miRNA2911 (figure 1), we accomplished a constitutive expression system as important intermediate step. It is a composite part of our basic part miRNA2911 and the standard promotor BBa_J23100 (figure 2).

Fig. 1: Future BioBrick regarding our ultimate goal

BioBrick state: We submitted the constitutive promoter and miRNA2911 biobrick to the registry. No sequencing validation was done yet, but an unspecific insert validation via colony PCR was successful.

Fig. 2: Our BioBrick as an important intermediate step

Sequence: (Prefix and Suffix, 3A assembly scar, promoter, miRNA)

5'

GAATTCGCGGCCGCTTCTAGAGttgacggctagctcagtcctaggtacagtgctagcTACTAGAGGGCCGGGGGACGGACTGGGATACTAGTAGCGGCCGCTGCAG

3'

GroEL promoter and blue Pigment

Also for establishing a heat-inducible cell lysis system (GroEL and PezT) we started to create a intermediate BioBrick for the validation of a GroEL heat induction ability. It is a composite part of our basic part GroEL and a blue pigment (BBa_J23100). Future work would target a BioBrick of GroEL and PezT.

BioBrick state: We did not submit the GroEL and blue pigment biobrick to the registry. We just designed the sequence.

Sequence: (Prefix and Suffix, 3A assembly scar, GroEL, RBS, Pribnow sequence, blue pigment)

5'

GAATTCGCGGCCGCTTCTAGAGCAGTTTCCCCCTTGAAGGGGCGAAGCCTCATCCCCATTTGAAGGAGATATTATACTAGAGatgag tgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaagg taagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccaca gtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatg ggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgt caagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgc acgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttaca aggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcg gttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataaTACTAGTAGCGGCCGCTGCAG

3'

Note

In order to be considered for the Best New Composite Part award, you must fill out this page. Please give links to the Registry entries for the Composite parts you have made. Please see the Registry's Help:Parts page for more information on part types.

A composite part is a functional unit of DNA consisting of two or more basic parts assembled together. BBa_I13507 is an example of a composite part, consisting of an RBS, a protein coding region for a red fluorescent protein, and a terminator.

New composite BioBrick devices can be made by combining existing BioBrick Parts (like Inverters, Amplifiers, Smell Generators, Protein Balloon Generators, Senders, Receivers, Actuators, and so on).


We thank our sponsors: