Template:Heidelberg/ivt/aims
AIMS AND METHODOLOGIES
Common techniques to sense small molecules in biochemical reactions are most likely connected to radioactive labeling. The exposure to radioactive sources is known to result in damage of the genetic information and is therefore more and more banished from lab work. However because of its sensitivity, radioactive chemicals are needed to monitor small changes of those molecules.
A common method that is performed in many laboratories is an in vitro transcription (Fig. 1A). This method is usually performed in a black-box manner. To analyze the decrease of nucleotide trisphosphate over time as well as to determine the success of the in vitro transcription, scientists use radioactive labelled nucleotide triphosphates and perform time demanding acrylamide gel electrophoresis.
To establish such tool box, two different fluorescent RNA constructs will be applied: The first construct is a fusion of an ATP aptamer
The combination of two aptamers that are able to turn on fluorescence by binding to DFHBI or malachite green provide us the possibility to monitor simultaneously the ATP consumption as well as RNA strand synthesis during in vitro transcription in real-time (Fig. 2). The application of the JAWS software generates us the best ATP-aptamer to identify even small changes during RNA synthesis.
To validate the JAWS-generated aptamers as well as to show the functionality of the Spinach2-ATP-Aptamer system we will apply different bacteriophage RNA polymerases (T7, Sp6, T3) that are commonly used. In addition inhibitors (Heparin) of polymerases as well as the effect of different buffer compositions will be analyzed by our approach.
RNA-Spinach2-Template preparation
Spinach2-DNA templates (Table 1) for in vitro transcription were amplified by extension-PCR and purified using Quiaquick PCR Purification Kit or ethanol precipitation. in vitro transcription was performed in presence of 40 mM Tris-HCl pH 8.1, 1 mM spermidine, 20 mM MgCl2, 0.01% Triton-X100, 4 mM each NTP, 10 mM DTT, 5 % DMSO and 0.1 mg/mL T7 RNA Polymerase. DNA was removed by 1 U/ µL DNase I digest. RNA was purified by denaturing PAGE and eluted in 0.3 M NaOAc pH 5.5. RNA was isopropanol precipitated and concentration determined by NanoDrop measurements.
Table 1.Applied DNA templates for the Spinach system.
Sequence |
|
Spinach2 |
GGGCTAATACGACTCACTATAGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGTAGGCTGCTTCGGCAGCCTACTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC |
c-di-GMP Aptamer Spinach2 |
GGGCTAATACGACTCACTATAGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCACACGCACAGGGCAAACCATTCGAAAGAGTGGGACGCAAAGCCTCCGGCCTAAACCAGAAGACATGGTAGGTAGCGGGGTTACCGATGTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC |
c-di-GMP Aptamer Spinach2 Mutant |
GGGCTAATACGACTCACTATAGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCACACGCACAGGGCAAACCGTTCGAAAGAGTGGGACGCAAAGCCTCCGGCCTAAACCAGAAGACATGGTAGGTAGCGGGGTTACCGATGTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC |
ATP Aptamer Spinach2 |
GGGCTAATACGACTCACTATAGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGGGAGATCTACGGATCTCAGGGCTCTTACGGGAGCTACATGGAAGGAGTCCATGTGTTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC |
ATP AptamerJAWS1 Spinach2 |
GGGCTAATACGACTCACTATAGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGGGCCAGGGGGAGATCTACGGATCTCAGGGCTCTTACGGGAGCTACATGGAAGGAGTCCATGTGTCTTTGCCCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC |
ATP AptamerJAWS2 Spinach2 |
GGGCTAATACGACTCACTATAGGATGTAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGCGTAGGGAGATCTACGGATCTCAGGGCTCTTACGGGAGCTACATGGAAGGAGTCCATGTGTATTGTACCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTTACATC |
Purified RNA was renatured in 40 mM HEPES KOH pH 7.5, 125 mM KCl and 3 mM MgCl2 and 20 % RNA. Proper folding was achieved by heating up the RNA to 95 °C for 3 min and then letting it cool down to room temperature.
Functionality of the renatured Spinach2 was determined using 500 nM renatured RNA, 1 mM of ligand (e.g. ATP) 100 µM DFHBI (Lucerna) and 0.2 U/µL of Ribolock RNase Inhibitor (Thermo Scientific). The fluorescence spectrum was measured using a spectro fluorometer (JASCO). Then following settings were applied to measure Spinach 2 fluorescence: Ex= 460 nm and Em=475-600 nm, high sensitivity and 37 °C.
Thin Layer Chromatography to Analyze ATP Consumption During in vitro Transcription
Thin layer chromatography will be applied to analyze ATP consumption during in vitro transcription. To analyze ATP consumptions during the RNA transcription, ATP is converted to AMP after the transcription process by apyrase. in vitro transcription was performed in presence of 40 mM Tris-HCl pH 8.1, 1 mM spermidine, 20 mM MgCl2, 0.01% Triton-X100, 4 mM each NTP, 10 mM DTT, 5 % DMSO and 0.1 mg/mL T7 RNA Polymerase. As DNA template we used the ATP AptamerJAWS1 Spinach2. 5 µL samples were taken every 5 min from the reaction and heated up to 95 °C for 10 min to inactivate the T7 RNA polymerase. To convert ATP to AMP 0.01 U Apyrase and 4 mM CaCl2 were added to each sample and incubated for 1 h at 30 °C. 2 µL of each sample was spotted on a fluorophore coated TLC Plat (ALUGRAM®Xtra SIL G/UV254, Macherey Nagel). TLC was run 4 h 45 min 4:6 Ammonium acetat: ethanol and analyzed with a UV lamp.
Malachite Green Aptamer Template Preparation for in vitro Transcription
Malachite Green Aptamer template (10 µM) was hybridized by heating up a forward and reverse oligo to 95 °C. DNA was cooled down to room temperature. dsDNA (Table 2) was then stored at -20 °C.
Malachite Green Aptamer Activity
Malachite Green Aptamer activity was tested by transcribing the prepared DNA-Template in vitro with T7 polymerase as described above and in presence of 1 mM malachite green (Sigma). To ensure synchronic initiation a master mix containing the buffer, enzymes, dye and template were pipetted separately. The assay was performed in 384 well micro titer plates (black, flat round, transparent bottom [Corning, 3540]) on a 20 µL scale. Evaporation during transcription was prevented by using a sealing tape (#232701, Nunc). Measurements on micro titer plates were performed in a microplate reader (Tecan Safire 2). Following parameters were chosen for the assay setup: Ex= 630 nm and Em=652 nm, 10 nm excitation/ emission bandwidth, high sensitivity flash mode and 40 µs integration time. The reaction was measured every 30 sec at 37 °C. To ensure the functionality of the assay, samples of the in vitro transcription were analyzed on a 10 % 8 M urea PAGE.
Time-resolved in vitro Transcription
To describe in vitro transcription time-resolved in terms of NTP consumption, following conditions were applied: 500 nM renatured ATP Aptamer Spinach2 RNA, 10 µM Malachite Green Aptamer DNA template, 40 mM Tris pH 8.1, 1 mM spermidine, 20 mM MgCl2, 0.01% Triton X-100, 4 mM each NTP, 10 mM DTT, 5 % DMSO, 100 µM DFHBI, 1 mM malachite green, 0.1 mg/mL T7 RNA Polymerase, 0.2 U/µL Ribolock RNase and 0.1 U Pyrophosphatase (Thermo Scientific). The assay was performed in 384 well micro titer plates (black, flat round, transparent bottom [Corning, 3540]) on a 20 µL scale. Evaporation during transcription was prevented by using a sealing tape (#232701, Nunc). Measurements on micro titer plates were performed in a microplate reader (Tecan Safire 2).
Influence of Inhibitors on in vitro Transcription
To analyze the influence of inhibitors on the in vitro transcription, heparin (0.7 mg/mL and 1.3 mg/mL) was applied. in vitro transcriptions were performed similar to “time-resolved in vitro Transcription” as described above.
Quantification of RNA Concentrations using Malachite Green Aptamer Fluorescence Read-Out
The T7-Malachite Green DNA template (Table 2) was applied for in vitro transcription as described above. RNA was purified by denaturing PAGE, eluted and recovered by NaOAc/isopropanol precipitation. The RNA was purified from remaining salts using Amicon Ultra-0.5 mL centrifugal filters 3K (Merck Millipore). For preparation of a calibration curve, RNA solutions of different concentrations were refolded (95°C 3min, in 1x renaturing buffer) 7. After addition of 100 µM DFHBI, 100 µM malachite green, 10 mM DTT, 4 mM ATP, 4 mM GTP, 4mM CTP, 4 mM UTP, 1x transcription buffer (1mM spermidine), 0.0017 U pyrophosphatase, 0.46 U Ribolock, 0.075 % glycerol fluorescence, fluorescence was measured on micro titer plates using microplate reader (Tecan Safire 2). Following parameters were chosen for the assay setup: Ex= 630 nm and Em=652 nm, 10 nm excitation/ emission bandwidth, high sensitivity flash mode and 40 µs integration time. The reaction was measured every 30 sec at 37 °C.