Identifier | Sequence | Measured Strength | BBa_J23119 | ttgacagctagctcagtcctaggtataatgctagc | n/a |
BBa_J23100 | ttgacggctagctcagtcctaggtacagtgctagc | 1 |
BBa_J23102 | ttgacagctagctcagtcctaggtactgtgctagc | 0.86 |
BBa_J23107 | tttacggctagctcagccctaggtattatgctagc | 0.36 |
BBa_J23116 | ttgacagctagctcagtcctagggactatgctagc | 0.16 |
Team:MIT/Promoter
Anderson Promoter Characterization
Anderson Promoter Characterization
The Anderson promoters are a collection of variable strength constitutive promoters for use in E. coli and other prokaryotes. They were created from a consensus sequence (J23119) by Chris Anderson. The table below lists, for the promoters we characterized, their relative strengths and the sequence changes (in red) that distinguish each promoter from the consensus.