Template:Team:Groningen/CONTENT/LOGBOOK/Colony PCR th18
Colony PCR thrC locus 2 (th18)
Colony PCR on transformed cells with thrC locus in thrC plasmid A
Extra integration of DNA in thrC locus
A positive colony
<a class="postscriptum protocol" href="https://2015.igem.org/Team:Groningen/Protocols_and_Protocols/ColonyPCR">Colony PCR</a>
00:00, 4 September 2015 - 00:00, 4 September 2015
Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.
Primer
Sequence
IGEM thrC forward
AATTCATGTAAAAGATGAGGTTGGTTCATT
iGEM erm-thrC rev 2
AGGAAGTTAAAGGAGCTCGAATTAATTCC
Used primers.
The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.