Team:Paris Bettencourt/Differentiation
Contents
- 1 Differentiation on E. coli
- 2 Writing the artificial gene
- 3 Cloning inside the replication vector
- 4 Chromosomal integration with GalK
- 5 Function testing
- 6 CRE recombinase expression
- 7 Thursday 07/09
- 8 Monday 07/20
- 9 Wednesday 07/22
- 10 Thursday, 07/23
- 11 Tuesday, 07/28
- 12 Wednesday, 07/29
- 13 Thursday, 07/30
- 14 Wednesday, 8/5
- 15 Monday, 08/10
- 16 Summary of what should work:
- 17 Advancement
- 18 Wednesday 07/15
- 19 Friday 07/17
- 20 Saturday 07/18
- 21 Monday 07/20
- 22 Thursday 07/16
- 23 Monday 07/20
- 24 Tuesday 07/21
- 25 PCR pURA3
- 26 Miniprep of the pThy1.0 plasmid
- 27 Preparation of Agarose 1% TAE
- 28 PCR of pThy1.0 cassette
- 29 Wednesday 07/22
- 30 Wednesday 07/23
- 31 Friday, 07/24
- 32 Monday, 07/27
- 33 Tuesday 07/28
- 34 Wednesday 07/29
- 35 Thursday, 07/30
- 36 Friday 07/31
- 37 Saturday, 8/1
- 38 Monday 08/03
- 39 Tuesday 8/4
- 40 Monday, 08/10
Differentiation on E. coli
The whole brainbow system will be integrated chromosomally at the GalK site. It will be synthesized as three gBlocks.
It should allow expression of mCherry first, then upon expression of the CRE recombinase, differentiation in two states (YFP and CFP).
It also contains a landing pad that allow insertion of a third state, which would subsequently lower the probability of states 1 and 2 so the three outcomes are possible.
Writing the artificial gene
Promoter J23199 from the Biobrick collection
4 LoxP sites used together in mammalian brainbow plasmids
RBS from Ihab
ORF for mCerulean and mVenus from Ihab
ORF for mCherry from Antoine
rrnBT1 terminator used on the pOSIP plasmids
Landing Pad (PhiC31 attB TT site)
Check for secondary structure in the RBS Done
Check for RBS in the LoxP array Done
Split to have two ~1500 bp gblocks Done
Design overlaps for Gibson in R6K vector Done
Check for Biobrick restriction sites Done
Fix gBlocks problems
- Palindroms between LoxP sites Done
- Repeats in terminator: replaced with Lambda T0 terminator Done
- Repeat in RBS Done
- More GC in the LoxP array Done
- More GC at the end of fragment 1Done
- Repeat at the end of mVenus and mCerulean Done
- More GC at the beginning of fragment 2 Done
It is very difficult to solve these -> make 3 fragments Done
Fragment A: 0 - 1143
Fragment B: 1105 - 2006
Fragment C: 1981 - 2946
Change the RBS for Fragment A -> “New RBS” Done
Order gBlocks Done 07/13
Design + order oligos for gBlocks amplification Done
Overlaps melting points are 62, 67, 54, 74.
The overlap between fragments B and C should be increased to >62.
R6K LinR | tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag | o15.80 |
R6K LinF | CGGGCGCGTACTCCAgaagggcatcgatggc | o15.81 |
Colibow A F | ttgacagctagctcagtcctag | o15.82 |
Colibow A R | GGCCATTCACATCACCATC | o15.83 |
Colibow B F | GCCGATTCTTGTTGAACTTG | o15.84 |
Colibow B R | CCATGGTACCTCCTCCTTACTTCTATAACTTC | o15.85 |
Colibow C F | GATACTTTATACGAAGTTATAGAAGTAAGGAGGAG | o15.86 |
Colibow C R | gccatcgatgcccttcTGGAGTACGCGCCCG | o15.87 |
Overlap melting points: 62, 67, 62, 72.
Design + order oligos for cassette sequencing Done
>50 bp before the interest region
800 bp max contigs
Obtain Pir+ strain Done
Overnight of Pir+ strain Done
Glycerol of Pir+ strain Done
Cloning inside the replication vector
Order oligos linR and linF Done
Obtain R6K vector from Ihab Done
Overnight culture of the R6K vector propagation strain
Failed New attempt with less harsh growth conditions. Done
- Only 20 ug/ml of Kanamycine
- 6 ul of Thyamine in 3 ul of LB
- Culture at 30°C
Miniprep of the R6K vector Done
Glycerol of R6K strain Done
Linearization of the R6K vector by PCR Done
Primer linF:
CCCTTGGGCTCCCCGGGCGCGTACTCCAgaagggcatcgatggc
(28 bases: longest possible overlap without having a hairpin at 50°)
Tm = 55°
Primer linR:
tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag
(33 bases overlap)
Tm = 62°
Product length: 2276 bp
Synthetize, reconstitute and dilute primers Done
Run gel for size checking Done
PCR purification Done
Obtain gBlocks Done
PCR of colibow fragments A, B and C Done
PCR purification of amplicon Done
Obtain Gibson mix Done
Make overnight culture of Pir+ strain Done
Make electrocompetent cells out of the Pir+ strain Done
Gibson assembly of 3 gblocks with the R6K backbone. Done
The vector can only replicate in Pir+ strain. Transform into Pir+ strain Got colonies
Check transformant: colony PCR before culture Failed
Liquid culture + miniprep
Analytical digestion or sequencing (find enzymes)
SeqF1 | o15.88 | cttagtacgttagccatgagg |
SeqF2 | o15.89 | CTAATTTTCCATCTGATGGCC |
SeqF3 | o15.90 | CAAGCTCACGCTCAAATTC |
SeqF4 | o15.91 | ACAACCATTACCTGTCGACG |
SeqF5 | o15.92 | CGACATTAGGGTATGGGCTG |
SeqR1 | o15.93 | TATAAACATTATGGCTATTATAG |
SeqR2 | o15.94 | TTTAGAGAGTTTTGACTGCG |
SeqR3 | o15.95 | TTTGCCAGTCGTACAGATGAA |
SeqR4 | o15.96 | TCTTCTTCTGCATCACCGGGC |
Chromosomal integration with GalK
PCR of the purified R6K plasmid. Done
PCR-linerization of the R6K backbone
- Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
- Primers: 15.80 (LinR) et 15.81(LinF) -> 1 ul each
- Eau qsp 25 ul
- Master mix 25 ul
1’30’’ extension, 50°C annealing.
Find oligos (already there) Done
IntR:
GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAACCATATGAATATCCTCCTTAGTTCCTATTCCG
Alternatively, with only one binding site:
GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAAttagccatggtccatatgaatatcctccttag
IntF:
TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGTTGAACTGCGGATCTTGCGGC
Italique: Homology region with E. coli GalK site.
Length: 4908 bp
Attention, autre site potentiel d’amorçage, produit de 3515 bp
Purification
Overnight culture de E. coli Lambda Red
Competent cells out of Lambda Red strain
Transformation of E. coli with pKD46 that carries Lambda Red recombinase
Transformation of the Colibow PCR product
Function testing
Tecan + Flux cytometry
CRE recombinase expression
pFHC2938 should work.
It expresses CRE and has a temperature sensitive ORI (30°C)
Monday 07/06
Research about the synthetic integron
It might make the landing pads better than with brainbow because the recombination site is always the same.
Plate culture of E. coli pIT5-KL and pIT5-KH
Very important: grow @30
-> Make a liquid culture of each and freeze at -80
-> Miniprep from pIT5-KL for first construct
These two strains produce the vector plasmids for clonetegration. They have to be linearized with EcoR1 and Pst1, and then Gibson assembled to get the self-integrating plasmids.
The integrase they carry is expressed only at 37 degrees.
They are resistant to Kanamycine.
KH integrates into the HK022 phage’s site, while KL integrates into the Lambda phage site. We will probably only need one of them but I took both just in case. If needed there is a whole collection of such vectors.
Plate culture of E. coli pE-FLP
Grow @ 30
This strain produces the pE-FLP plasmid, which expresses the flippase. It will be useful to remove the backbone after the clonetegration. It’s resistant to ampicillin.
It has a temperature-sensitive ORI and will disappear if grown at 37.
New primers
LC81, LC85, LC82, LC86: used in the PCR to check integration with pIT5 KH.
LC81, LC87, LC83, LC84: used in the PCR to check integration with pIT5 KL.
Thursday 07/09
- Prepared 10 tubes of 1 ml Kanamycine, 50 mg/ml
- Inoculated pIT5-KL and pIT5-KH E. coli in 2 ml LB Kan+50
- Inoculated pE-FLP E. coli in 2ml LB Amp+100
- Cultured these three tubes @ 30
Monday 07/20
Reception of two plates from Ihab
- Shortened R6K vector -> Kan+ and thyamine auxotrophy. Thyamine 1000x is available in an eppendorf tube.
- Pir 116 strain for propagation of the vector.
-> Overnight culture for miniprep for PCR and gleezing
- R6K in LB Kan Thyamine (in antibiotics box)
- Pir116 in LB with a control tube
Started cultures for Colibow
pThy 1.0 aka pBrainbow 1.0 in 3 ml LB-Amp -> Miniprepcr
pR6K in LB-Kan-Thyamine -> Miniprepcr and Glycerol freezing
Pir116 for replication of pR6K-vectors -> LB
Control without innoculation -> LB
All of them, culture @ 37° overnight.
No need to culture pKT174 because we already have the purified version. It may be a good idea to transform DH5a with it in case we run out of plasmid.
Reception of oligos o15.76 to o15.96
- Yeastbow SOE
- R6K linearization
- Colibow gBlock Amp
- Colibow Sequencing
The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.
-> Oligo reconstitution and dilution
-> Miniprep of R6K vector
-> PCR of R6K vector
-> Miniprep of pBrainbow 1.0
-> PCR of pBrainbow 1.0
-> PCR of pThy Ura3
Reconstituted all primers to 100 ug/ml.
Miniprep of pR6K and pBrainbow 1.0
For PCR, using Promega kit w/ double wash. Elution in 30 ul
Final concentration: 93 ng/ul
Re-start of the R6K culture
The first culture failed: let’s try again with less harsh conditions.
- Only 20 ug/ml of Kanamycine
- 6 ul of Thyamine in 3 ul of LB
- Culture at 30°C
Wednesday 07/22
PCR-linerization of the R6K backbone
- Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
- Primers: 15.80 (LinR) et 15.81(LinF) -> 1 ul each
- Eau qsp 25 ul
- Master mix 25 ul
1’30’’ extension, 50°C annealing -> 2276 bp
Bad news from IDT about the gene synthesis
« I would like to notify you about a best effort for gBlock ‘Colibow C’. Even after multiple attempts at trying to correct this issue, the Final QC data for the best prep is not meeting our quality standards. The final prep (mfg# 188635671) has desired peak. A secondary peak is also present. The target mass was found in the chromatogram, but not as the most abundant product in any of the chromatographic peaks for mass spectrometry, and the sequence has been verified.
If you are using this sequence for cloning and/or qPCR you should not have any problems with this sequence. It may require you to screen additional colonies. However, if your intentions with using this gBlock was for other purposes, we might need to cancel the gBlock and redesign. I have provided the trace below. »
Thursday, 07/23
Glycerol stock for pR6K
1 ml of overnight culture of E. coli pR6K.
1 ml of glycerol.
-> -20°C
Gel for linearized R6K pcr
1% agar TAE, with 1 kb+ generuler.
5 ul PCR product + 1 ul LB.
-> band at the right size (2276 bp) , the PCR worked.
linearized R6K pcr cleanup
Using the Qiagen kit, taken back in 50 ul water
Titration: about 80 ng/ul, but very bad 260/230 ratio (presence of organic molecules).
Pir116 electrocompetent for bowcoli transformation
2 ml overnight culture in 100 ml LB, at 37°C w/ shaking.
When OD reaches 0.6, they were put in ice for half an hour.
Electrocompetent cells were made by Mukit along with DH5a competent cells.
Tuesday, 07/28
Reception of gBlocks Colibow A, B, C
Reconstitution to the concentration of 10 ng/ul (from spec sheet):
- Centrifuge @ 11kG
- Add 100 ul of RNase-free water
- Vortex
- Incubate at 50°C for 20 minutes
- Vortex/Centrifuge
PCR of Colibow gBlocks
Colibow A
Primers: 82 (56°) + 83 (54°) -> 1172 bp
Colibow B
Primers: 84 (53°) + 85 (54°) -> 909 bp
Colibow C
Primers: 86 (54°) + 87 (57°) -> 992 bp
Reaction in 50 ul:
Compound | Volume (ul) |
Water | 19 |
Phusion 2x | 25 |
Primer 1 | 2.5 |
Primer 2 | 2.5 |
gBlock diluted 10 times | 1 ul |
Program:
98 (30)
98 (10) 58 (25) 72 (45) x35
72 (600)
12 (hold)
In parallel from running the gel, the PCR products were purified with the QIAGEN kit and eluted in 40 ul of water.
Titration
Fragment A: 90 ng/ul
Fragment B: 88 ng/ul
Fragment C: 85 ng/ul
Gel plan
1% agar, SYBRsafe, 5 ul of PCR product + 1 ul of LD.
The 100 bp+ marker was used.
The apparatus didn’t work. It stopped two times, the gel stayed to diffuse in the tank for 30 minutes. At the end it was imaged even though it was far from finished.
Ladder 100 bp+ | Colibow A | Colibow B | Colibow C |
Expected size | 1172 | 909 | 992 |
Conclusion
There are a lot of non-specific binding.
Due to the awful quality of the gel, it’s not possible to determine their size or which bands are the good ones. The top ones seem more consistent regarding their relative sizes.
To do:
- Run the whole purified PCR product in a gel and perform a gel extraction. Hopefully the right band can be determined this time.
- Try the PCR again with a higher annealing temperature.
- Gibson assemble directly the gBlocks fragments.
Wednesday, 07/29
Gel for Colibow A, B, C and extraction
Agar 1%, SYBRsafe, TAE
Ladder 100 bp+ | Colibow A | Colibow B | Colibow C |
Expected size | 1172 | 909 | 992 |
For each sample, the top band was extracted. The Colibow B sample was extracted twice: Bg (grande, top band) and Bp (petite, bottom band).
The bottom band is the right one.
-> add DMSO 3% next time
Titration (in 30 ul EB)
Name | 1 | U | A | Bp | Bg | C |
C (ng/ul) | 13 | 41 | 6 | 29 | 11 | 12.1 |
The concentrations of Colibow A and C are critically low. It is necessary to fix the PCR and reduce the non-specific priming before performing the Gibson.
New attempt at Colibow A and C PCRs
Mix
Phusion 25
Colibow A 1
o15.82 2.5
o15.83 2.5
Water 19
DMSO 1.5 (3%)
= Two tubes of 50 ul each -> 1172 bp
Mix
Phusion 25
Colibow C 1
o15.86 2.5
o15.87 2.5
Water 19
DMSO 1.5 (3%)
= Two tubes of 50 ul each -> 992 bp
This is stored in 4° for now (29/07)
Received Gibson assembly mixes from Ihab
I need better quality products before doing it.
Thursday, 07/30
Gel for A, C and 1
*Sophie’s sample
* | A | A | A | C | C | C | 100+ | 1 | 1 | 1 | 1kb |
* | 1172 | 1172 | 1172 | 992 | 992 | 992 | 3965 | 3965 | 3965 |
50 ul sample + 10 ul LD -> 40 ul in each well (3 wells)
Attention C sample accidentally added to the well containing 100 bp + ladder !!!
Gel extraction
With Qiagen kit, product recovered in 30 ul of water.
Name: “product” X+ 30/07
The C product mixed with ladder was labeled Cl.
Titration
Sample | 1 | A | C | Cl |
c (ng/ul) | 5.2 | 15.4 | 12.9 | 4.4 |
Gibson assemblies of Colibow
General mix:
15 ul of Gibson supermix (MMII)
10-100 ng of backbone for a 6 kb fragment
Equimolar amount of DNA fragments
Total: 20 ul
Colibow PCR products
Using the most concentrated PCR products known to date.
Nom | Taille (bp) | Concentration | Volume (ul) | Quantité (ng) |
R6K pcr | 2276 | 80 | 0.6 | 50 |
Colibow A+ e (in water) | 1172 | 15 | 1.7 | 25 |
Colibow Bp (in EB) | 909 | 29 | 0.9 | 25 |
Colibow C+ e (in water) | 992 | 13 | 1.6 | 25 |
Colibow gBlocks
Using directly the gBlocks from IDT dna synthesis
Nom | Taille (bp) | Concentration | Volume (ul) | Quantité (ng) |
R6K pcr | 2276 | 80 | 0.5 | 30 |
Colibow A | 1172 | 10 | 1.5 | 15 |
Colibow B | 909 | 10 | 1.5 | 15 |
Colibow C | 992 | 10 | 1.5 | 15 |
Incubation during one hour at 50°C.
3 LB ampicillin plates
“30/07 ANTOINE”
50 ml of hot LB-agar.
Transformation of Colibow in Pir116 by Electroporation
pColibow gBlock
pColibow PCR
Biobrick plasmid with RFP (3 ul of 10 pg tube, not dialysed)
Protocol from OWW:
- Thaw cells from -80°C to ice for >20 min
- Chill cuvettes
- Dialyse 6 ul of Gibson products on dWater during >20 min
- Mix 6 ul of dialysed DNA with 50 ul Pir116 electrocompetent cells
- Mix with tip
- Pulse (1.5 kV, 2 mm cuvette)
- Add 1 ml LB (at 18h43)
Incubate for 1 hour at 37°C.
2 Kanamycine 25 plates for each colibow plasmid: 100 ul and 900 ul
1 Chloramphenicol plate for RFP control
Incubation overnight @37.
Transformation of pKT174 in DH5a by Heat shock
Protocol from addgene:
- Thaw cells on ice (20 min)
- 3 ul DNA + 50 ul chemically competent cells, mix gently
- 20-30 min on ice
- 45s at 42°C
- 2 min on ice
- Add 1 ml LB (at 18h50)
- Incubate 1 hour @ 37°C
2 ampicillin plates: 100 ul and 900 ul.
Incubation overnight @37.
Gel for SOE 29/07
1 kb ladder | SOE | SOE | SOE | 1 kb ladder | * |
Expected size: 5600 for all of them.
It didn’t work at all. Try to Gibson-assemble them.
New electroporation of Pir116
Using the old electroporator (with the square cuvette holder).
- Dialysis of 6 ul and sampling of 5 ul of Colibow gBlock assembly
- Dialysis of 5 ul and sampling of 5 ul of 5 pg/ul
<tbody>
Compound
x1
x8
10x Taq Buffer
2.5
20
10 nM dNTPs
0.5
4
10 uM primer 90
0.5
4
10 uM primer 94
0.5
4
taq polymerase
0.125
1
water
17.875
167
Then 22 ul of mix is added to 3 ul of template (2 ul water + 1 ul sample for positive control). Template is obtained by soaking part of a colony in 20 ul water.
Program (saved as Colony):
95 (6’00)
95 (15) 49 (25) 68 (45) x30
68 (5’00)
Gel:
P900 B1 B2 B3 ColibowB 100bp+
Results:
- One band at 508 bp on the positive control.
- No band at all on the colonies
-> They are contaminations, the transformation did not work, probably because the Gibson itself did not work due to bad DNA concentration.
Wednesday, 8/5
Pir116 electrocompetent cells
From the overnight culture, 1 ml of cells were diluted in 50 ml of LB and incubated at 37°C (10h30).
Centrifuge steps were done 10 min at 8500 rpm.
- 50 ml culture -> centrifuge and remove well the supernatant
- 50 ml glycerol 10% -> centrifuge
- 50 ml glycerol 10% -> centrifuge
Cells in residual glycerol were aliquoted in eppendorf tubes (6 in the end) and frozen @-80.
Testing of these EC Pir116 cells function
4 ul of pSB1C3 20 pg/ul were dialysed, 3 ul were picked after 20 min and mixed with 100 ul of cells.
Pulse duration: 5.7 ms
After 1 h of preculture @37, it was plated on a chloramphenicol 0.5 plate and grown @37.
New colibow PCR
Performed by Chloé and Émilie.
Program:
98 (30)
35x 98 (10), Gradient (30), 72 (2’20)
72 (5)
10 (hold)
Gradient:
59, 57.8, 55.3, 53.4
The very long extension time is used to avoid promoting small non-specific fragments.
Gel:
1% agarose, SYBRsafe, 2.5 ul sample + 0.5 ul LD
<tbody>
L
A
A
A
A
L
B
B
B
B
L
C
C
C
C
L
1 kb
1172
1 kb
909
1 kb
992
Thursday, 8/6
PCR purification of Colibow gBlocks
The homologous tubes were mixed together, except for C2 that didn’t work.
Elution in 50 ul of water.
A second gel was ran in order to know whether the light band at the bottom is still present.
<tbody>
1 kb ladder
A
B
C
Is it. This has to be taken into account when calculating the concentrations for the Gibson assembly.
Titration (in 50 ul of water):
A: 137 ng/ul
B: 167 ng/ul
C: 99 ng/ul
New R6K PCR
<tbody>
Compound
1x
2x
water
71
142
Phu buffer
20
40
dNTP
2
4
80 primer
1
2
81 primer
1
2
pR6K shortened (template)
1
2
DMSO
3
6
Phusion polymerase
1
2
Program:
98 (30)
98 (10) 52 (30) 72 (1’30) x 35
72 (5’)
Problem: There was only <1 ul of phusion left in the tube. The PCR did not work at all.
New attempt
Mix (made twice)
Phusion master mix 50 ul
80 primer 2 ul
81 primer 2 ul
pR6K 3 ul
DMSO 3 ul
Water 40 ul
Program:
98 (30)
98 (10) 50 (30) 72 (1’30) x 35
72 (5’)
After this PCR, the product was:
- ran on a gel: Ladder 1kb, tube 1, tube 2 (3 ul sample, 2 ul water, 1 ul LD)
- digested by DPN1:
1 ul of DPN1 added directly to the product, then incubated for 15 minutes at 37° in the thermocycler and inactivated (5 min at 80°).
Gel results: To be uploaded (on my pendrive now).
Monday, 08/10
PCR purification of R6K amp
With QIAGEN kit, performed by Chloé & Émilie. At the end, the product was recovered in 50 ul of water and also 30 ul EB, for 80 ul total.
The titration was done using a 5 ul + 3 ul mix as a blank.
Products summary:
<tbody>
R6K pcr
67.4 ng/ul
2276 bp
Colibow A
137
1172 bp
Colibow B
167
909 bp
Colibow C
99
992 bp
A and C have a small band at ~200 bp, so the actual concentration of the product is half of what indicated by the Nanodrop.
Gibson assembly of Colibow
Assuming half the DNA in A and C is the right one.
<tbody>
Name
Volume (ul)
Final amount (pmol)
A
1.11
0.10
B
0.4
0.11
C
1.30
0.10
R6K
2.19
0.10
Added to a MMII Gibson assembly master mix and incubated during 1h at 50°C.
Gel for Colibow’s Gibson
6 ul SYBRsafe in 20 ml agar 1%, with 1 kb ladder.
The sample consisted in 10 ul of Gibson product and 2 ul of LD.
Unfortunately the comb for making the wells went through the gel, resulting in loss of the sample.
Electroporation of Pir116 E. coli with newly assembly pColibow
- Dialyse of the assembly product during 20 min. 5 ul were deposed and 5 ul were taken back.
- Mixed with already tested Pir116 Electrocompetent cells
- Program Ec2, bacterial, in 2 mm cuvette. Pulse time: 4.7 ms.
- Incubation 1h @37
- Plating on “pColibow Gibson” plates (K50 but K20 written on the box). 100 ul on the first box, centrifuged 900 ul on the second one.
- Incubation overnight @37.
The goal is to pursue the work of Matt for implementation of brainbow on yeast.
- For us, it means that we demonstrate that the brainbow system can be set up on yeast, therefore the whole system that we construct on E. coli could in principle work on S. cerevisiae too.
- It also has application in microscopy, helping people to better distinguish different cells on microfluidic chips. This is not related to our project but it’s a decent bonus.
Summary of what should work:
Amplify Brainbow 1.0 with
B1 Brain1 F: CTAGCGAGCTCATAACTTCGTA (not F+) o15.76
B1 Brain1 R+: AATTCGCTTATTTAGAAGTGcttcgcgcgtgatctagag o15.75
Amplify Ura vector with
B1 Ura F+: ctctagatcacgcgcgaagCACTTCTAAATAAGCGAATTTCTTATG o15.74
B1 Ura R: TGGATGGCGGCGTTAGTATC o15.77
Amplify annealed products with
Leu2 Brain1 F: AGCAATATATATATATATATTTCAAGGATATACCATTCTAACTAGCGAGCTCATAACTTCGT o15.78
Leu2 Brain1 R:
TAAAGTTTATGTACAAATATCATAAAAAAAGAGAATCTTTCTGGATGGCGGCGTTAGTAT
o15.79
Works on snapgene, product size = 5692 bp
Problem: plasmid Ura not available, plasmid pThy not found.
Advancement
Design oligos Done
Oligo checking by Matt Done
Order oligos “+” Done
Obtain previous oligos Ordered
Obtain S. cerevisiae strain from Zoran Done
Plate Zoran’s strain Done
Grow Done
Freeze @ -80
Overnight culture of pThy 1.0 strain
Obtain pUra3 plasmid Done
Miniprep pThy 1.0 plasmid Done
PCR with SOE tails of pThy1.0 Done
PCR with SOE tails of pUra3 Done
PCR cleanup Done
Splicing by Overlap Extension Failed
Gel for size checking
Gel extraction
Receive primers 78 and 79 Done
They are supposed to be delivered but can’t be found anywhere
Couldn’t contact IDT by phone
Contacted IDT by e-mail, waiting for an answer
PCR with flanking homology regions
Overnight culture of CRE yeast + WT yeast
Competent cells out of the three yeasts Not necessary
Transformation of yPH150, yPH151 and wild-type S. cer. for safe replication of the cassette.
Wednesday 07/15
Started to work on the packaging experiments for yeast.
Innoculation of S. cerevisiae BY4743 mCherry
Medium: 100 ml YPD with 400 ul Gentamycine (four 25 ml tubes)
Culture @ 30°C + Shaking
Friday 07/17
Checked the yeast megaculture: growth is okay, but let’s wait for a third day to have more biomass.
Designed and ordered a lot of oligos for Yeastbow and Colibow projects.
Saturday 07/18
Manufacturing experiment, part 1.
A strain of Yeast expressing mCherry was grown during three days at 30°C in 100 ml YPD.
In order to remove as much medium as possible, it was centrifuged at 4000 G during 5 min, twice, while discarding the supernatant each time.
Different conditions of drying were attempted:
- In the tube, at the sun during 30 min (Tube1). This one was not completely dry when packaged.
- Spread on tinfoil (Grattée)
- Put on tinfoil without spreading (Air libre)
- Put on tinfoil and covered with a plastic plate (Boîte)
- Leftover in the tube (Tube2)
After drying these samples were packaged in paper bags and preserved in the fridge.
Monday 07/20
Received oligos o15.74 and o15.75. They’re meant to amplify the Yeastbow source plasmids.
Prepared 9 YPD agar plates.
Manufacturing experiment, part 2.
For each drying protocol, one sample was taken out of the fridge.
They were weighted, transferred in eppendorf tubes and ~1ml of LB was added (YPD not available at that time).
The « tube 1 » sample was not dry enough so a lot of it sticked to the package.
<tbody>
ID
Boîte 2
Tube 1
Air libre 1
Grattée 1
Weight
12 mg
4.5 mg
9.2 mg
1.3 mg
This was then moved to YPD-agar plates and spread with sterile beads.
The plates were cultured at 30°C overnight for colony counting.
Thursday 07/16
Ordered two new oligos for Yeastbow cloning: o15.74 and o15.75
Yeast megaculture for wednesday: A little cell pellet is visible at the bottom.
-> Titled the flasks so they’re shaked better.
Obtained two yeast strains that express CRE recombinase from Zoran, overnight at 30.
Designed and ordered new primers for yeastbow PCRs, based on Matt’s advice.
It was very difficult to find a good priming region since this seems to be in a terminator.
Monday 07/20
Reception of pBrainbow 1.0 and 3.0 propogators as glycerol stocks
Templates for PCR assembly of Yeastbow. Still need primers.
-> Overnight culture for miniprep for PCR
- pThy Brainbow 1.0
Reception of oligos o15.74 and o 15.75
For yeastbow first round of PCRs.
Reconstitution in dH2O, in the bottom drawer of the -20.
Reception of pBrainbow URA3 for Yeastbow
From Zack at Hersen lab.
It carries an AmpR.
Use 1 ul as a template for the PCR, and if it doesn’t work transform the rest into E. coli for propagation.
Stored in Barth’s styrofoam box.
Tuesday 07/21
Results for the preliminary manufacturing experiment
We get a lot of background. It’s almost sure that it is yeast, but no mCherry could be detected. The plasmid was likely lost due to the absence of antibiotics in the plating media.
It’s important to dilute before plating to know the number of colonies per mg.
All the plates are covered in yeast, even the less successful ones.
Reception of oligos o15.76 to o15.96
- Yeastbow SOE
- R6K linearization
- Colibow gBlock Amp
- Colibow Sequencing
The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.
-> Oligo reconstitution and dilution
-> Miniprep of R6K vector
-> PCR of R6K vector
-> Miniprep of pBrainbow 1.0
-> PCR of pBrainbow 1.0
-> PCR of pThy Ura3
Reconstituted all primers to 100 ug/ml.
Miniprep of pR6K and pBrainbow 1.0
For PCR, using Promega kit w/ double wash. Elution in 30 ul
Final concentration: 93 ng/ul
PCR pURA3
- 1 ul template
- 1 ul of each primer
- 25 ul of Phusion master mix
- 22 ul of dH2O
Template: pKT174 plasmid (AmpR).
We have ~5 ul * 2, for a total amount of 1 ug.
Use 1 ul for 1 PCR, then if needed transform the rest in E. coli for propagation.
Primers:
<tbody>
URA F+
o15.74
56°
URA R
o15.77
58°
Polymerase: Phusion in the form of 2x mix.
Program: (saved as “Phusion”)
98 (30s)
98 (10s) 50 (25s) 72 (1 min) x 25
72 (8 min)
4° hold
Lasts 1h30, product size = 1684 bp
Miniprep of the pThy1.0 plasmid
With promega kit.
Recovery in 30 ul.
Preparation of Agarose 1% TAE
Kept at 55°C in the broken incubator.
PCR of pThy1.0 cassette
- 1 ul template
- 1 ul of each primer
- 25 ul of Phusion master mix
- 22 ul of dH2O
Template: pThy1.0 (1 ul = 93 ng)
Primers:
<tbody>
B1 Brain1 F
o15.76
55°
B1 Brain1 R+
o15.75
58°
Program: (modified from Phusion)
98 (30s)
98 (10s) 50 (25s) 72 (2’45’’) x 25
72 (8 min)
4° hold
Expected size: 3965 bp
Wednesday 07/22
Gel for product size checking, in that order:
- Generuler 1 kb+
- PCR Thy1.0 -> 3965 bp
- PCR Ura3 -> 1684 bp
Results:
- PCR Thy1.0 is ~ 4000
- PCR Ura3 is ~ 1700
It worked!
PCR purification
Using the kit.
Titration:
PCR Thy1.0: 32 ng/ul
PCR Ura3: 47 ng/ul
Overlap PCR
- Equimolar amounts of purified fragments
Required volumic ratio Thy/Ura = (47 / 1684) / (32 / 3965) = 3.46
<tbody>
PCR Thy1.0
17 ul
PCR Ura3
5 ul
Water
3 ul
Phusion master mix
25 ul
- Do not add any primers; the templates will prime each-other.
- Run 5 PCR cycles without primers. Predicted annealing temperature ~ 61°C. Use 57° as an annealing temperature and 2’45’’ of elongation time.
- Add primers directly to the mix.
B1 Brain1 F (o15.76) 55°C
Ura R (o15.77) 58°C
1 ul each, directly into the PCR product.
Expected product size: 5610 bp
Wednesday 07/23
Gel for SOE yeastbow assembly
1% agar TAE, with 1 kb+ generuler.
30 ul of product + 6 ul loading dye were loaded for gel extraction.
- Smear at very large sizes
- Band at ~1600, probably from Ura3 PCR
- No visible band at ~6000 bp
The SOE didn’t work, so nothing was extracted.
New attempt for SOE yeastbow assembly
The concentration of template was way too high.
PCR Thy1.0 6 ul
PCR Ura3 2 ul
Water 14 ul
Phusion mix 25 ul
o15.76 2 ul
o15.77 2 ul
« S+ » tube: Primers added from the beginning,
« S » tube: Primers added only after 6 cycles.
Program
98° 30s
98° 15s, 50° 25s, 72° 4’20’’ [35 times] -> Shorter elongation time
72° 8 min
4° hold -> 12 next time
Lid at 103°. It takes about four hours to complete.
Friday, 07/24
Reception of oligos o15.78 and o15.79
For flanking yeastbow with homology regions
Reconstitution:
4 nmol oligos + 40 ul eau = 0.1 nmol/ul = 100 mM
Gel for previous SOE (2nd attempt)
SOE SOE SOE+ SOE+ 1kb+ marker
2 barely visible bands around 5600 bp in SOE+.
It is not possible to know which one is the right one.
Gel extraction of 2 SOE+ bands
“Grande”
“Petite”
Recovery in 30 ul EB
Grande : 22.5 ng/ul
Petite: 6.2 ng/ul
PCR of extracted product
Aim: recover the tiny amount of DNA in the gel.
Template: SOE G or P after purification (29 ul)
Primers: 76 and 77 (2 ul each)
Phusion: 50 ul
Water: 17 ul
Program:
98 (30)
98 (10), 54 (25), 72 (3’20’’) -> 36x
72 (8’00)
12 (hold)
The increased annealing temperature (54 instead of 50) should lower the non-specific hybridation.
This PCR takes ~ 3h30.
Monday, 07/27
Gel for rescue PCR of extracted product
Agar 1% + TAE + SYBRsafe
Laid 5 ul + 1 ul loading dye
Order: « Petite » - Marker 1kb+ - « Grande »
Results
Did. Not. Work.
Thirld attempt at SOEing
- Redo the PCRs with gel extraction this time -> No smear in pThy1.0 product
- Try to Gibson assemble the two parts
- Try again the SOE with a higher annealing temperature
New SOE:
PCR Thy1.0 3 ul
PCR Ura3 1 ul
Water 7 ul
Phusion mix 12.5 ul
o15.76 1 ul
o15.77 1 ul
Program
98° 30s
98° 20s, gradient 30s, 72° 3’10’’ [35 times] (NEB calculator recommends 60°C…)
72° 8 min
12° hold
Gradient: 56 to 62°C (bottom to top).
New PCRs
Objective: Better quality of the SOE reagents, gel-extracted to get rid of the smear.
Larger number of cycles.
Ura3 PCR
pKT174 1ul
o15.74 1ul
o15.77 1ul
Water 22ul
Phusion mix 25ul
Program:
98 (30)
98 (10), 56 (25), 72 (1’00) x35
72 (8)
12 (hold) -> 1684 bp
Thy PCR
pThy1.0 1ul
o15.75 1ul
o15.76 1ul
Water 22ul
Phusion mix 25ul
Program:
98 (30)
98 (10), 56 (25), 72 (1’00) x35
72 (8)
12 (hold) -> 3965 bp
Tuesday 07/28
Gel extraction for PCR Ura, PCR Thy and SOE gradient PCR
Agar 1%, SYBRsafe, TAE
<tbody>
1
1
U
U
M
A
B
C
D
M
1: pThy pcr
U: pUra3 pcr
M: 1kb dna ladder
A, B, C, D: gradient PCR for SOE
It was at first run at 75 kV and then at 100 kV during 25 in total. The buffer in the tank was TBE, and as a result the gel was completely awful, with no possibility to read the size of the bands.
The products were also lost.
New PCRs for Yeastbow
PCR Thy1.0
pThy1.0 1 ul
75 2.5 ul
76 2.5 ul
Phusion mix 25 ul
Water 19 ul
Program:
98 (60)
98 (10) 56 (30) 72 (120) x35
72 (600)
4 (hold)
Expected size: 3965. Should be over at about 18h30.
PCR Ura3
pKT174 1 ul
74 2.5 ul
77 2.5 ul
Phusion 25 ul
Water 19 ul
Program:
98 (60)
98 (10) 56 (30) 72 (60) x35
72 (600)
12 (hold)
Expected size: 1684 bp.
Wednesday 07/29
Gel for Yeastbow 1 and U and extraction
Agar 1%, SYBRsafe, TAE
<tbody>
1kb ladder
1
1
U
U
1kb ladder
3965
3965
1684
1684
The PCR for U worked really well, but the PCR for 1 yielded an extremely low amount of DNA and a smear.
-> Decrease annealing temp
-> Increase extension time
pcr Ura3: 41 ng/ul * 30 ul of EB
pcr Thy1: 13 ng/ul * 30 ul of EB
New attempt at PCR Thy1, 29 july
Mix
Phusion 25
Thy 1
o15.75 2.5
o15.76 2.5
Water 19
= Two tubes of 50 ul each -> 3965 bp
Program
98 (30)
98 (20), 60 (20), 72 (3’00’)
72 (5’00)
12 (hold)
New attempt at SOE, 29 july, with PCR products from 28 july
Mix
Phusion 25
PCR 1 1
PCR U 1
o15.76 2.5
o15.77 2.5
Water 11
= Two tubes of 50 ul each -> 5610 bp
Program
98 (30)
98 (20), 60 (20), 72 (3’00’)
72 (5’00)
12 (hold)
(Along with PCR 1)
Thursday, 07/30
Gel for SOE 29/07
<tbody>
1 kb ladder
SOE
SOE
SOE
1 kb ladder
*
Expected size: 5600 for all of them.
It didn’t work at all. Try to Gibson-assemble them.
Friday 07/31
Culture of pKT174 for freezing + miniprep
In 4 ml LB + 4 ul ampicilline, @37.
Saturday, 8/1
The culture of pKT174 grew:
- Miniprep (not titrated for now)
- Glycerol stock @ -20
New strategy based on Gibson assembly
With minimal PCR steps. Low success rate, low mutation rate.
- Amplify pThy1.0 with o15.75 (58) and o15.78 (58) -> 4006 bp
- Amplify pUra3 with o15.74 (56) and o15.79 (56) -> 1725 bp
- Cleanup or extract (or try both)
- Gibson assembly (39 bp overlap, Tm = 66°C) -> 5692 bp. Works on Snapgene (see Yeastbow Vector.dna)
- Ready to go
Method for PCR: Jake’s magic recipe.
<tbody>
Reagent
Volume
1x
10x
Nuclease-free water
71 ul
710 ul
5x Phusion HF Buffer
20 ul
200 ul
10 mM dNTPs
2 ul
20 ul
Forward Primer (10 uM)
1 ul
10 ul
Reverse Primer (10 uM)
1 ul
10 ul
Template
1 ul
10 ul
DMSO
3 ul
30 ul
Phusion DNA Polymerase
1 ul
10 ul
Total Volume
100 ul
1000 ul
Thermocycler Protocol: NEB Phusion
98 (30)
98 (10) 52 (30) 72 (30/kb) *35
72 (5’)
10 (forever)
Gel
L M L R M R
2.5 ul sample + 0.5 LD
Marker: 1 kb
Both of the PCR worked quite well, the products are of the right size and there is no significant alien band.
-> PCR purification with the QIAGEN kit
Recovery in 40 ul of water.
Titration
Yeastbow R: 300 ng/ul (1725 bp)
Yeastbow L: 155 ng/ul (4006 bp)
Monday 08/03
Gibson assembly of yeastbow
On ice: 15 ul master mix + 5 ul DNA, incubate at 50° for 1 hour.
Number of ng = pmols * bp * 0.65
<tbody>
Fragment
ul
pmol
Yeastbow R
0.9
0.24
Yeastbow R
4.1
0.24
Gibson master mix
15 ul
Tuesday 8/4
Transformation of yeastbow in the CRE strains
Culture in 50 ml 2x YPD.
Problem: According to Matt these strains already have Ura3. It is not possible to transform yeastbow in them.
-> Transform the yeastbow in Ura- S. cerevisiae strains and add the CRE later (maybe by taking it from the yPH150/151)
Thanks to the fluorescence of the transformant, we attempted to transform the yeastbow cassette and select cells with mere fluorescence.
However, while in the process of doing the transformation, the centrifuge got stuck with my samples inside. I gave up at that point.
Freezer stocks of yPH150 and yPH151
500 ul glycerol 50% and 500 ul overnight culture.
Numbers 15.54 and 15.55 resp.
Yeastbow strikes back
CRE yeast strains we have:
- yPH150: CRE under the Ura3 promoter (const)
- yPH151: CRE under the Stl1 promoter (inducible)
These strains are based on BY4743. Both of them are auxotrophic for His, Leu and Lys, but no longer for Ura (as it was used for CRE transformation!)
All the work previously done on yeastbow is therefore useless, and it’s necessary to start over with His3 as a selection marker.
The Leu2 integration tails are correct, even if the Leu2 ORF has been destroyed.
Available plasmids with resistance:
pYMC32, pFA6, pPH75 from euroscarf toolbox. The names might not be correct.
For new primers were designed and ordered:
Amplify pThy1.0 with these primers:
o15.160 GCAATATATATATATATATTTCAAGGATATACCATTCTAACTAGCGAGCTCATAACTTCG (Tm=58, specific)
o15.161 GCTTATTTAGAAGTGGCGCGgacctctgcagaggaaggac (Tm=58, may hairpin but not likely, may dimerize, specific)
Product size: 4066 bp
Amplify pFA6-His3 with these primers:
o15.162 gtccttcctctgcagaggtcCGCGCCACTTCTAAATAAGC (may hairpin, may dimerize, specific) (Tm=56)
o15.163 AAGTTTATGTACAAATATCATAAAAAAAGAGAATCTTTCCTGGATGGCGGCGTTAGTATC (Tm=59, specific)
Product size: 1614 bp
Gibson assembly
Overlap: 40 bp, Tm = 70°C
Product size: 5640 bp
Monday, 08/10
Received plasmids and primers for Yeastbow
Plan with SOE:
<tbody>
Forward
Reverse
Template
PCR type
Tm
Extension Time
Product size
BB1F
BB1R
pThy1-Brainbow1.0
Phusion
60
2’
3965
His3F
His3R
pPH21 or PH75
Phusion
60
1’
1532
Pho85F
Pho85R
PCR1 and 2
SOE
60
3’
5457
Alternative setup
What do we have?
- One brainbow plasmid: pThy1.0
- One His3 resistance plasmid: pPH21
- Two border primers without tails (not used here)
- Two sets of central Gibson assembly primers: 161+162 or BB1R+His3F
- Two sets of integration tails: Pho85F+Pho85R or 160+163
Every four combinations of central primers and integration tails were used separately.
Master mix for both PCRs
<tbody>
Name
1x
5x
Water
40
200
Phusion Master Mix
50
250
DMSO
3
15
Template
1
5
1.0 PCR
Mix:
2 ul of each primers. In that order:
PB: PhoF + BB1 R
1B: 160 + BB1 R
P1: PhoF + 161
11: 160 + 161
Expected result:
~4066 bp
Program (as seen in previous working Yeastbow assembly):
98 (30)
98 (10) 52 (30) 72 (3’00) x35
75 (5)
pPH21 PCR
Mix:
2 ul of each primers. In that order:
HP: His3F + PhoR
1P: 162 + PhoR
H1: His3F + 163
11: 162 + 163
Expected result:
~1614 bp
Program (as seen in previous working Yeastbow assembly):
98 (30)
98 (10) 52 (30) 72 (2’00) x35
75 (5)
The tubes for this one are marked with a blue spot on the hinge of the PCR tube.
Gel for both of these PCR
<tbody>
1kb
PB
1B
P1
11
1kb
HP
1P
H1
11
1kb