Team:Paris Bettencourt/Differentiation

Advancement on E. coli

The whole brainbow system will be integrated chromosomally at the GalK site. It will be synthesized as three gBlocks.

It should allow expression of mCherry first, then upon expression of the CRE recombinase, differentiation in two states (YFP and CFP).

It also contains a landing pad that allow insertion of a third state, which would subsequently lower the probability of states 1 and 2 so the three outcomes are possible.

Writing the artificial gene

Promoter J23199 from the Biobrick collection

4 LoxP sites used together in mammalian brainbow plasmids

RBS from Ihab

ORF for mCerulean and mVenus from Ihab

ORF for mCherry from Antoine

rrnBT1 terminator used on the pOSIP plasmids

Landing Pad (PhiC31 attB TT site)

Check for secondary structure in the RBS Done

Check for RBS in the LoxP array Done

Split to have two ~1500 bp gblocks Done

Design overlaps for Gibson in R6K vector Done

Check for Biobrick restriction sites Done

Fix gBlocks problems

• Palindroms between LoxP sites Done
• Repeats in terminator: replaced with Lambda T0 terminator Done
• Repeat in RBS Done
• More GC in the LoxP array Done
• More GC at the end of fragment 1Done
• Repeat at the end of mVenus and mCerulean Done
• More GC at the beginning of fragment 2 Done

It is very difficult to solve these -> make 3 fragments Done

Fragment A: 0 - 1143

Fragment B: 1105 - 2006

Fragment C: 1981 - 2946

Change the RBS for Fragment A -> “New RBS” Done

Order gBlocks Done 07/13

Design + order oligos for gBlocks amplification Done

Overlaps melting points are 62, 67, 54, 74.

The overlap between fragments B and C should be increased to >62.

R6K LinR	tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag	o15.80
R6K LinF	CGGGCGCGTACTCCAgaagggcatcgatggc	o15.81
Colibow A F	ttgacagctagctcagtcctag	o15.82
Colibow A R	GGCCATTCACATCACCATC	o15.83
Colibow B F	GCCGATTCTTGTTGAACTTG	o15.84
Colibow B R	CCATGGTACCTCCTCCTTACTTCTATAACTTC	o15.85
Colibow C F	GATACTTTATACGAAGTTATAGAAGTAAGGAGGAG	o15.86
Colibow C R	gccatcgatgcccttcTGGAGTACGCGCCCG	o15.87

Overlap melting points: 62, 67, 62, 72.

Design + order oligos for cassette sequencing Done

>50 bp before the interest region

800 bp max contigs

Obtain Pir+ strain Done

Overnight of Pir+ strain Done

Glycerol of Pir+ strain Done

Cloning inside the replication vector

Order oligos linR and linF Done

Obtain R6K vector from Ihab Done

Overnight culture of the R6K vector propagation strain

        Failed New attempt with less harsh growth conditions. Done

• Only 20 ug/ml of Kanamycine
• 6 ul of Thyamine in 3 ul of LB
• Culture at 30°C

Miniprep of the R6K vector Done

Glycerol of R6K strain Done

Linearization of the R6K vector by PCR Done

Primer linF:

CCCTTGGGCTCCCCGGGCGCGTACTCCAgaagggcatcgatggc

(28 bases: longest possible overlap without having a hairpin at 50°)

Tm = 55°

Primer linR:

tagcattatacctaggactgagctagctgtcaaggcaaatttgcggccgcaag

(33 bases overlap)

Tm = 62°

Product length: 2276 bp

Synthetize, reconstitute and dilute primers Done

Run gel for size checking Done

PCR purification Done

Obtain gBlocks Done

PCR of colibow fragments A, B and C Done

PCR purification of amplicon Done

Obtain Gibson mix Done

Make overnight culture of Pir+ strain Done

Make electrocompetent cells out of the Pir+ strain Done

Gibson assembly of 3 gblocks with the R6K backbone. Done

The vector can only replicate in Pir+ strain. Transform into Pir+ strain Got colonies

Check transformant: colony PCR before culture Failed

Liquid culture + miniprep

Analytical digestion or sequencing (find enzymes)

SeqF1	o15.88	cttagtacgttagccatgagg
SeqF2	o15.89	CTAATTTTCCATCTGATGGCC
SeqF3	o15.90	CAAGCTCACGCTCAAATTC
SeqF4	o15.91	ACAACCATTACCTGTCGACG
SeqF5	o15.92	CGACATTAGGGTATGGGCTG
SeqR1	o15.93	TATAAACATTATGGCTATTATAG
SeqR2	o15.94	TTTAGAGAGTTTTGACTGCG
SeqR3	o15.95	TTTGCCAGTCGTACAGATGAA
SeqR4	o15.96	TCTTCTTCTGCATCACCGGGC

Chromosomal integration with GalK

PCR of the purified R6K plasmid. Done

PCR-linerization of the R6K backbone

• Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
• Primers: 15.80 (LinR) et 15.81(LinF)  -> 1 ul each
• Eau qsp 25 ul
• Master mix 25 ul

1’30’’ extension, 50°C annealing.

Find oligos (already there) Done

IntR:

GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAACCATATGAATATCCTCCTTAGTTCCTATTCCG

Alternatively, with only one binding site:

GTTTGCGCGCAGTCAGCGATATCCATTTTCGCGAATCCGGAGTGTAAGAAttagccatggtccatatgaatatcctccttag

IntF:

TTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGTTGAACTGCGGATCTTGCGGC

Italique: Homology region with E. coli GalK site.

Length: 4908 bp

Attention, autre site potentiel d’amorçage, produit de 3515 bp

Purification

Overnight culture de E. coli Lambda Red

Competent cells out of Lambda Red strain

Transformation of E. coli with pKD46 that carries Lambda Red recombinase

Transformation of the Colibow PCR product

Function testing

Tecan + Flux cytometry

CRE recombinase expression

pFHC2938 should work.

It expresses CRE and has a temperature sensitive ORI (30°C)

Monday 07/06

Research about the synthetic integron

It might make the landing pads better than with brainbow because the recombination site is always the same.

Plate culture of E. coli pIT5-KL and pIT5-KH

Very important: grow @30

-> Make a liquid culture of each and freeze at -80

-> Miniprep from pIT5-KL for first construct

These two strains produce the vector plasmids for clonetegration. They have to be linearized with EcoR1 and Pst1, and then Gibson assembled to get the self-integrating plasmids.

The integrase they carry is expressed only at 37 degrees.

They are resistant to Kanamycine.

KH integrates into the HK022 phage’s site, while KL integrates into the Lambda phage site. We will probably only need one of them but I took both just in case. If needed there is a whole collection of such vectors.

Plate culture of E. coli pE-FLP

Grow @ 30

This strain produces the pE-FLP plasmid, which expresses the flippase. It will be useful to remove the backbone after the clonetegration. It’s resistant to ampicillin.

It has a temperature-sensitive ORI and will disappear if grown at 37.

New primers

LC81, LC85, LC82, LC86: used in the PCR to check integration with pIT5 KH.

LC81, LC87, LC83, LC84: used in the PCR to check integration with pIT5 KL.

Thursday 07/09

• Prepared 10 tubes of 1 ml Kanamycine, 50 mg/ml
• Inoculated pIT5-KL and pIT5-KH E. coli in 2 ml LB Kan+50
• Inoculated pE-FLP E. coli in 2ml LB Amp+100
• Cultured these three tubes @ 30

Monday 07/20

Reception of two plates from Ihab

• Shortened R6K vector -> Kan+ and thyamine auxotrophy. Thyamine 1000x is available in an eppendorf tube.
• Pir 116 strain for propagation of the vector.

-> Overnight culture for miniprep for PCR and gleezing

• R6K in LB Kan Thyamine (in antibiotics box)
• Pir116 in LB with a control tube

Started cultures for Colibow

pThy 1.0 aka pBrainbow 1.0 in 3 ml LB-Amp -> Miniprepcr

pR6K in LB-Kan-Thyamine -> Miniprepcr and Glycerol freezing

Pir116 for replication of pR6K-vectors -> LB

Control without innoculation -> LB

All of them, culture @ 37° overnight.

No need to culture pKT174 because we already have the purified version. It may be a good idea to transform DH5a with it in case we run out of plasmid.

Reception of oligos o15.76 to o15.96

• Yeastbow SOE
• R6K linearization
• Colibow gBlock Amp
• Colibow Sequencing

The ultramers (o15.78, o15.79) for Leu2 flanking are not ready yet.

-> Oligo reconstitution and dilution

-> Miniprep of R6K vector

-> PCR of R6K vector

-> Miniprep of pBrainbow 1.0

-> PCR of pBrainbow 1.0

-> PCR of pThy Ura3

Reconstituted all primers to 100 ug/ml.

Miniprep of pR6K and pBrainbow 1.0

For PCR, using Promega kit w/ double wash. Elution in 30 ul

Final concentration: 93 ng/ul

Re-start of the R6K culture

The first culture failed: let’s try again with less harsh conditions.

• Only 20 ug/ml of Kanamycine
• 6 ul of Thyamine in 3 ul of LB
• Culture at 30°C

Wednesday 07/22

PCR-linerization of the R6K backbone

• Miniprep du backbone R6K (20 ng/ul) -> 5 ul in PCR
• Primers: 15.80 (LinR) et 15.81(LinF)  -> 1 ul each
• Eau qsp 25 ul
• Master mix 25 ul

1’30’’ extension, 50°C annealing -> 2276 bp

Bad news from IDT about the gene synthesis

« I would like to notify you about a best effort for gBlock ‘Colibow C’. Even after multiple attempts at trying to correct this issue, the Final QC data for the best prep is not meeting our quality standards. The final prep (mfg# 188635671) has desired peak.  A secondary peak is also present. The target mass was found in the chromatogram, but not as the most abundant product in any of the chromatographic peaks for mass spectrometry, and the sequence has been verified.

If you are using this sequence for cloning and/or qPCR you should not have any problems with this sequence. It may require you to screen additional colonies. However, if your intentions with using this gBlock was for other purposes, we might need to cancel the gBlock and redesign. I have provided the trace below. »

Thursday, 07/23

Glycerol stock for pR6K

1 ml of overnight culture of E. coli pR6K.

1 ml of glycerol.

-> -20°C

Gel for linearized R6K pcr

1% agar TAE, with 1 kb+ generuler.

5 ul PCR product + 1 ul LB.

-> band at the right size (2276 bp) , the PCR worked.

linearized R6K pcr cleanup

Using the Qiagen kit, taken back in 50 ul water

Titration: about 80 ng/ul, but very bad 260/230 ratio (presence of organic molecules).

Pir116 electrocompetent for bowcoli transformation

2 ml overnight culture in 100 ml LB, at 37°C w/ shaking.

When OD reaches 0.6, they were put in ice for half an hour.

Electrocompetent cells were made by Mukit along with DH5a competent cells.

Tuesday, 07/28

Reception of gBlocks Colibow A, B, C

Reconstitution to the concentration of 10 ng/ul (from spec sheet):

• Centrifuge @ 11kG

• Add 100 ul of RNase-free water
• Vortex
• Incubate at 50°C for 20 minutes
• Vortex/Centrifuge

PCR of Colibow gBlocks

Colibow A

Primers: 82 (56°) + 83 (54°) -> 1172 bp

Colibow B

Primers: 84 (53°) + 85 (54°) -> 909 bp

Colibow C

Primers: 86 (54°) + 87 (57°) -> 992 bp

Reaction in 50 ul:

Compound	Volume (ul)
Water	19
Phusion 2x	25
Primer 1	2.5
Primer 2	2.5
gBlock diluted 10 times	1 ul

Program:

98 (30)

98 (10) 58 (25) 72 (45) x35

72 (600)

12 (hold)

In parallel from running the gel, the PCR products were purified with the QIAGEN kit and eluted in 40 ul of water.

Titration

Fragment A: 90 ng/ul

Fragment B: 88 ng/ul

Fragment C: 85 ng/ul

Gel plan

1% agar, SYBRsafe, 5 ul of PCR product + 1 ul of LD.

The 100 bp+ marker was used.

The apparatus didn’t work. It stopped two times, the gel stayed to diffuse in the tank for 30 minutes. At the end it was imaged even though it was far from finished.

Ladder 100 bp+	Colibow A	Colibow B	Colibow C
Expected size	1172	909	992

Colibow Amp Results.jpg1438103355.jpg

Conclusion

There are a lot of non-specific binding.

Due to the awful quality of the gel, it’s not possible to determine their size or which bands are the good ones. The top ones seem more consistent regarding their relative sizes.

To do:

1. Run the whole purified PCR product in a gel and perform a gel extraction. Hopefully the right band can be determined this time.
2. Try the PCR again with a higher annealing temperature.
3. Gibson assemble directly the gBlocks fragments.

Wednesday, 07/29

Gel for Colibow A, B, C and extraction

Agar 1%, SYBRsafe, TAE

Ladder 100 bp+	Colibow A	Colibow B	Colibow C
Expected size	1172	909	992

Colibow Amp Extracted.jpg

For each sample, the top band was extracted. The Colibow B sample was extracted twice: Bg (grande, top band) and Bp (petite, bottom band).

The bottom band is the right one.

-> add DMSO 3% next time

Titration (in 30 ul EB)

Name	1	U	A	Bp	Bg	C
C (ng/ul)	13	41	6	29	11	12.1

The concentrations of Colibow A and C are critically low. It is necessary to fix the PCR and reduce the non-specific priming before performing the Gibson.

New attempt at Colibow A and C PCRs

Mix

Phusion        25

Colibow A        1

o15.82                2.5

o15.83                2.5

Water                19

DMSO                1.5         (3%)

= Two tubes of 50 ul each -> 1172 bp

Mix

Phusion        25

Colibow C        1

o15.86                2.5

o15.87                2.5

Water                19

DMSO                1.5         (3%)

= Two tubes of 50 ul each -> 992 bp

This is stored in 4° for now (29/07)

Received Gibson assembly mixes from Ihab

I need better quality products before doing it.

Thursday, 07/30

Gel for A, C and 1

• Sophie’s sample

*	A	A	A	C	C	C	100+	1	1	1	1kb
*	1172	1172	1172	992	992	992		3965	3965	3965

50 ul sample + 10 ul LD -> 40 ul in each well (3 wells)

Attention C sample accidentally added to the well containing 100 bp + ladder !!!

Colibow A et C amp 29.07.jpg

Gel extraction

With Qiagen kit, product recovered in 30 ul of water.

Name: “product” X+ 30/07

The C product mixed with ladder was labeled Cl.

Titration

Sample	1	A	C	Cl
c (ng/ul)	5.2	15.4	12.9	4.4

Gibson assemblies of Colibow

General mix:

15 ul of Gibson supermix (MMII)

10-100 ng of backbone for a 6 kb fragment

Equimolar amount of DNA fragments

Total: 20 ul

Colibow PCR products

Using the most concentrated PCR products known to date.

Nom	Taille (bp)	Concentration	Volume (ul)	Quantité (ng)
R6K pcr	2276	80	0.6	50
Colibow A+ e (in water)	1172	15	1.7	25
Colibow Bp (in EB)	909	29	0.9	25
Colibow C+ e (in water)	992	13	1.6	25

Colibow gBlocks

Using directly the gBlocks from IDT dna synthesis

Nom	Taille (bp)	Concentration	Volume (ul)	Quantité (ng)
R6K pcr	2276	80	0.5	30
Colibow A	1172	10	1.5	15
Colibow B	909	10	1.5	15
Colibow C	992	10	1.5	15

Incubation during one hour at 50°C.

3 LB ampicillin plates

“30/07 ANTOINE”

50 ml of hot LB-agar.

Transformation of Colibow in Pir116 by Electroporation

pColibow gBlock

pColibow PCR

Biobrick plasmid with RFP (3 ul of 10 pg tube, not dialysed)

Protocol from OWW:

• Thaw cells from -80°C to ice for >20 min
• Chill cuvettes
• Dialyse 6 ul of Gibson products on dWater during >20 min
• Mix 6 ul of dialysed DNA with 50 ul Pir116 electrocompetent cells
• Mix with tip
• Pulse (1.5 kV, 2 mm cuvette)
• Add 1 ml LB (at 18h43)

Incubate for 1 hour at 37°C.

2 Kanamycine 25 plates for each colibow plasmid: 100 ul and 900 ul

1 Chloramphenicol plate for RFP control

Incubation overnight @37.

Transformation of pKT174 in DH5a by Heat shock

Protocol from addgene:

• Thaw cells on ice (20 min)
• 3 ul DNA + 50 ul chemically competent cells, mix gently
• 20-30 min on ice
• 45s at 42°C
• 2 min on ice
• Add 1 ml LB (at 18h50)
• Incubate 1 hour @ 37°C

2 ampicillin plates: 100 ul and 900 ul.

Incubation overnight @37.

Gel for SOE 29/07

1 kb ladder

SOE

SOE

SOE

1 kb ladder

*

Expected size: 5600 for all of them.

SOE+29.07.jpg

It didn’t work at all. Try to Gibson-assemble them.

New electroporation of Pir116

Using the old electroporator (with the square cuvette holder).

Dialysis of 6 ul and sampling of 5 ul of Colibow gBlock assembly

Dialysis of 5 ul and sampling of 5 ul of 5 pg/ul

Compound	x1	x8
10x Taq Buffer	2.5	20
10 nM dNTPs	0.5	4
10 uM primer 90	0.5	4
10 uM primer 94	0.5	4
taq polymerase	0.125	1
water	17.875	167

Then 22 ul of mix is added to 3 ul of template (2 ul water + 1 ul sample for positive control). Template is obtained by soaking part of a colony in 20 ul water.

Program (saved as Colony):

95 (6’00)

95 (15) 49 (25) 68 (45) x30

68 (5’00)

Gel:

P900        B1        B2        B3        ColibowB        100bp+

Results:

• One band at 508 bp on the positive control.
• No band at all on the colonies

-> They are contaminations, the transformation did not work, probably because the Gibson itself did not work due to bad DNA concentration.

Wednesday, 8/5

Pir116 electrocompetent cells

From the overnight culture, 1 ml of cells were diluted in 50 ml of LB and incubated at 37°C (10h30).

Centrifuge steps were done 10 min at 8500 rpm.

• 50 ml culture -> centrifuge and remove well the supernatant
• 50 ml glycerol 10% -> centrifuge
• 50 ml glycerol 10% -> centrifuge

Cells in residual glycerol were aliquoted in eppendorf tubes (6 in the end) and frozen @-80.

Testing of these EC Pir116 cells function

4 ul of pSB1C3 20 pg/ul were dialysed, 3 ul were picked after 20 min and mixed with 100 ul of cells.

Pulse duration: 5.7 ms

After 1 h of preculture @37, it was plated on a chloramphenicol 0.5 plate and grown @37.

New colibow PCR

Performed by Chloé and Émilie.

1438872081.png

Program:

98 (30)

35x 98 (10), Gradient (30), 72 (2’20)

72 (5)

10 (hold)

Gradient:

59, 57.8, 55.3, 53.4

The very long extension time is used to avoid promoting small non-specific fragments.

Gel:

1% agarose, SYBRsafe, 2.5 ul sample + 0.5 ul LD

L

A

A

A

A

L

B

B

B

B

L

C

C

C

C

L

1 kb

1172

1 kb

909

1 kb

992

08.05 Colibow Amp gradient.jpg

Thursday, 8/6

PCR purification of Colibow gBlocks

The homologous tubes were mixed together, except for C2 that didn’t work.

Elution in 50 ul of water.

A second gel was ran in order to know whether the light band at the bottom is still present.

1 kb ladder

A

B

C

Is it. This has to be taken into account when calculating the concentrations for the Gibson assembly.

Titration (in 50 ul of water):

A: 137 ng/ul

B: 167 ng/ul

C: 99 ng/ul

08.06 Colibow gradient after purification.jpg

New R6K PCR

Compound	1x	2x
water	71	142
Phu buffer	20	40
dNTP	2	4
80 primer	1	2
81 primer	1	2
pR6K shortened (template)	1	2
DMSO	3	6
Phusion polymerase	1	2

Program:

98 (30)

98 (10) 52 (30) 72 (1’30) x 35

72 (5’)

Problem: There was only <1 ul of phusion left in the tube. The PCR did not work at all.

New attempt

Mix (made twice)

Phusion master mix        50 ul

80 primer                2 ul

81 primer                2 ul

pR6K                        3 ul

DMSO                        3 ul

Water                        40 ul

Program:

98 (30)

98 (10) 50 (30) 72 (1’30) x 35

72 (5’)

After this PCR, the product was:

• ran on a gel: Ladder 1kb, tube 1, tube 2 (3 ul sample, 2 ul water, 1 ul LD)
• digested by DPN1:

1 ul of DPN1 added directly to the product, then incubated for 15 minutes at 37° in the thermocycler and inactivated (5 min at 80°).

Gel results: To be uploaded (on my pendrive now).

Monday, 08/10

PCR purification of R6K amp

With QIAGEN kit, performed by Chloé & Émilie. At the end, the product was recovered in 50 ul of water and also 30 ul EB, for 80 ul total.

The titration was done using a 5 ul + 3 ul mix as a blank.

Products summary:

R6K pcr	67.4 ng/ul	2276 bp
Colibow A	137	1172 bp
Colibow B	167	909 bp
Colibow C	99	992 bp

A and C have a small band at ~200 bp, so the actual concentration of the product is half of what indicated by the Nanodrop.

Gibson assembly of Colibow

Assuming half the DNA in A and C is the right one.

Name	Volume (ul)	Final amount (pmol)
A	1.11	0.10
B	0.4	0.11
C	1.30	0.10
R6K	2.19	0.10

Added to a MMII Gibson assembly master mix and incubated during 1h at 50°C.

Gel for Colibow’s Gibson

6 ul SYBRsafe in 20 ml agar 1%, with 1 kb ladder.

The sample consisted in 10 ul of Gibson product and 2 ul of LD.

Unfortunately the comb for making the wells went through the gel, resulting in loss of the sample.

Electroporation of Pir116 E. coli with newly assembly pColibow

• Dialyse of the assembly product during 20 min. 5 ul were deposed and 5 ul were taken back.
• Mixed with already tested Pir116 Electrocompetent cells
• Program Ec2, bacterial, in 2 mm cuvette. Pulse time: 4.7 ms.
• Incubation 1h @37
• Plating on “pColibow Gibson” plates (K50 but K20 written on the box). 100 ul on the first box, centrifuged 900 ul on the second one.
• Incubation overnight @37.