Difference between revisions of "Team:EPF Lausanne/Notebook/Ecoli"
Line 93: | Line 93: | ||
<div class="col-sm-9"> | <div class="col-sm-9"> | ||
− | <!-- CONSTRUCTION PDCAS9-W--> | + | <!-- CONSTRUCTION PDCAS9-W ++ --> |
<section id="pdcas9w" class="panel"> | <section id="pdcas9w" class="panel"> | ||
<h1>Construction of pdCas9-w</h1> | <h1>Construction of pdCas9-w</h1> | ||
− | <p>pdCas9-w | + | <p>pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP.</p> |
+ | |||
+ | <h2>Materials and method</h2> | ||
<ul> | <ul> | ||
− | <li>pdCas9 | + | <li>Open pdCas9-bacteria by PCR. pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249). |
− | <li>pWJ66 | + | <ul> |
+ | <li>Miniprep (cf. Protocols) bacteria containing pdCas9-bacteria</li> | ||
+ | <li>20 µL Phusion PCR (cf. Protocols) of pdCas9-bacteria with primers f_Gbs_pdCas9 and r_Gbs_pdCas9</li> | ||
+ | <li>PCR product purification (cf. Protocols)</li> | ||
+ | <li>Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler ladder)</li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li>Extract w subunit from pWJ66 by PCR. pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570). | ||
+ | <ul> | ||
+ | <li>Miniprep (cf. Protocols) bacteria containing pWJ66</li> | ||
+ | <li>20 µL Phusion PCR (cf. Protocols) of pWJ66 using primers f_Gbs_w and r_Gbs_w</li> | ||
+ | <li>PCR product purification (cf. Protocols)</li> | ||
+ | <li>Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)</li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li>Gibson assembly of pdCas9-w | ||
+ | <ul> | ||
+ | <li>Gibson assembly (cf. Protocols) with purified PCR products of pdCas9-bacteria and w subunit</li> | ||
+ | <li>Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product</li> | ||
+ | <li>Colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)</li> | ||
+ | <li>Miniprep (cf. Protocols) of overnight liquid cultures to isolate pdCas9-w</li> | ||
+ | <li>Restriction digest (Cf. Protocols) of pdCas9-w with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products (with 1kb Generuler)</li> | ||
+ | <li>Sequencing (Microsynth)</li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li>Site-directed mutagenesis of dCas9-w (necesary for pdCas9-w to be BioBrick compatible) | ||
+ | <ul> | ||
+ | <li>Site-directed mutagenesis (cf. Protocols) of pdCas9-w with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w</li> | ||
+ | <li>Miniprep (cf. Protocols) of overnight liquid cultures in 7 mL LB with Chloramphenicol of colonies from site-directed mutagenesis plate to isolate mutated pdCas9-w plasmids</li> | ||
+ | <li>Restriction digest (cf. Protocols) of mutated pdCas9-w plasmids with EcoRI to identify colonies for which the mutagenesis was successful</li> | ||
+ | <li>Sequencing (Microsynth) of one pdCas9-w for which the mutageneis worked according to the restriction digest</li> | ||
+ | </ul> | ||
+ | </li> | ||
+ | <li>BioBrick mutated dCas9-w | ||
+ | <ul> | ||
+ | </ul> | ||
+ | </li> | ||
</ul> | </ul> | ||
− | < | + | |
+ | <h2>Results</h2> | ||
<div id="PCRpdcas9" class="panel"> | <div id="PCRpdcas9" class="panel"> | ||
− | < | + | <h3>Open pdCas9 by PCR</h3> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div class="row"> | <div class="row"> | ||
<div class="col-md-8"> | <div class="col-md-8"> | ||
− | <p>Linearized pdCas9-w is expected to be 6705 bp.</br> | + | <p>Linearized pdCas9-w is expected to be 6705 bp.</br>We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. Many, but not all, of our samples were successfully amplified (cf. Fig.1).</br>For next steps, sample from lane 1 (cf. Fig.1) was used.</p> |
</div> | </div> | ||
<div class="col-md-4"> | <div class="col-md-4"> | ||
Line 129: | Line 158: | ||
<div id="PCRpwj66" class="panel"> | <div id="PCRpwj66" class="panel"> | ||
− | < | + | <h3>Extract w subunit from pWJ66 by PCR</h3> |
− | + | <div class="row"> | |
− | + | <div class="col-md-8"> | |
− | + | <p>Successful PCR reactions are expected to yield 340 bp fragments.</br>PCR was succesful for sample visible on gel. (cf. Fig.2)</p> | |
− | + | </div> | |
− | + | <div class="col-md-4"> | |
− | + | <figure> | |
− | + | <a href="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig2.jpg"><img src="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig2.jpg" alt="Figure 2"></a> | |
− | + | <figcaption><b>Fig.2</b> - Gel of w subunit extracted from pWJ66</figcaption> | |
− | + | </figure> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</div> | </div> | ||
</div> | </div> | ||
+ | </div> | ||
<div id="gibsonpdcas9w" class="panel"> | <div id="gibsonpdcas9w" class="panel"> | ||
− | + | <h3>Gibson assembly of pdCas9-w</h3> | |
− | + | ||
− | <h3 | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<h4>Colony PCR</h4> | <h4>Colony PCR</h4> | ||
<div class="row"> | <div class="row"> | ||
− | <div class="col-md- | + | <div class="col-md-8"> |
<p>Amplicons are 666 bp if Gibson assembly worked and 396 bp if the plasmid self-ligated.</br>Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.</br>Gibson assembly seems to have worked for some samples. (cf. Fig.3)</br>To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.</p> | <p>Amplicons are 666 bp if Gibson assembly worked and 396 bp if the plasmid self-ligated.</br>Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.</br>Gibson assembly seems to have worked for some samples. (cf. Fig.3)</br>To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.</p> | ||
</div> | </div> | ||
− | <div class="col-md- | + | <div class="col-md-4"> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<figure> | <figure> | ||
− | <figcaption><b>Fig.3</b> - Gels of colony PCR of dCas9-w Gibson assembly products | + | <a href="https://static.igem.org/mediawiki/2015/f/f9/Lab_nb_ecoli_fig3a.jpg"><img src="https://static.igem.org/mediawiki/2015/f/f9/Lab_nb_ecoli_fig3a.jpg" alt="Figure 3a" style="width:90%"></a> |
+ | <a href="https://static.igem.org/mediawiki/2015/1/12/Lab_nb_ecoli_fig3b.jpg"><img src="https://static.igem.org/mediawiki/2015/1/12/Lab_nb_ecoli_fig3b.jpg" alt="Figure 3b" style="width:90%"></a> | ||
+ | <a href="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fib3c.jpg"><img src="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fib3c.jpg" alt="Figure 3c" style="width:90%"></a> | ||
+ | <a href="https://static.igem.org/mediawiki/2015/f/ff/Lab_nb_ecoli_fig4d.jpg"><img src="https://static.igem.org/mediawiki/2015/f/ff/Lab_nb_ecoli_fig4d.jpg" alt="Figure 3d" style="width:90%"></a> | ||
+ | <figcaption><b>Fig.3</b> - Gels of colony PCR of dCas9-w Gibson assembly products</figcaption> | ||
</figure> | </figure> | ||
</div> | </div> | ||
Line 208: | Line 205: | ||
<a href="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg"><img src="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg" alt="Figure 4b" style="width:70%"></a> | <a href="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg"><img src="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg" alt="Figure 4b" style="width:70%"></a> | ||
<a href="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg" alt="Figure 4c" style="width:70%"></a> | <a href="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg" alt="Figure 4c" style="width:70%"></a> | ||
− | <figcaption><b>Fig.4</b> - Gels of restriction digest of pdCas9-w Gibson assembly products | + | <figcaption><b>Fig.4</b> - Gels of restriction digest of pdCas9-w Gibson assembly products</figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 216: | Line 213: | ||
</div> | </div> | ||
− | + | <div id="mutagenesis" class="panel"> | |
− | + | <h3>Site-directed mutagenesis of dCas9-w</h3> | |
− | + | </div> | |
− | + | <div id="biobrickpdcas9w" class="panel"> | |
− | + | <h3>BioBrick mutated dCas9-w</h3> | |
− | + | </div> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | </section> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | <!--CONSTRUCTION PDCAS9-W-SGRNAS--> | + | <!--CONSTRUCTION PDCAS9-W-SGRNAS ++ --> |
<section id="pdcas9wsgrna" class="panel"> | <section id="pdcas9wsgrna" class="panel"> | ||
<h1>Construction of pdCas9-w-sgRNAs</h1> | <h1>Construction of pdCas9-w-sgRNAs</h1> | ||
Line 258: | Line 236: | ||
<a href="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg" alt="Figure ¨8a" style="width:100%"></a> | <a href="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg" alt="Figure ¨8a" style="width:100%"></a> | ||
<a href="https://static.igem.org/mediawiki/2015/archive/a/a0/20150907074344%21Lab_nb_ecoli_fig8b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/a/a0/20150907074344%21Lab_nb_ecoli_fig8b.jpg" alt="Figure ¨8b" style="width:100%"></a> | <a href="https://static.igem.org/mediawiki/2015/archive/a/a0/20150907074344%21Lab_nb_ecoli_fig8b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/a/a0/20150907074344%21Lab_nb_ecoli_fig8b.jpg" alt="Figure ¨8b" style="width:100%"></a> | ||
− | <figcaption><b>Fig.8:Schematics of structure and assembly of sgRNA cassettes</b></br><small><b>Fig.8a</b> - Structure of a sgRNA cassette</br><b>Fig.8b</b> - Assembly of three sgRNA cassettes | + | <figcaption><b>Fig.8:Schematics of structure and assembly of sgRNA cassettes</b></br><small><b>Fig.8a</b> - Structure of a sgRNA cassette</br><b>Fig.8b</b> - Assembly of three sgRNA cassettes</small></figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 282: | Line 260: | ||
<figure> | <figure> | ||
<a href="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg"><img src="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg" alt="Figure 9"></a> | <a href="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg"><img src="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg" alt="Figure 9"></a> | ||
− | <figcaption><b>Fig.9</b> - Gel of digested pdCas9-w (lane 1) and undigested pdCas9-w (lane 2) | + | <figcaption><b>Fig.9</b> - Gel of digested pdCas9-w (lane 1) and undigested pdCas9-w (lane 2)</figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 357: | Line 335: | ||
</div> | </div> | ||
<figure> | <figure> | ||
− | <figcaption><b>Fig.10: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B | + | <figcaption><b>Fig.10: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</small></figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 406: | Line 384: | ||
</div> | </div> | ||
<figure> | <figure> | ||
− | <figcaption><b>Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products</b></br><small><b>Fig.11a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.</br><b>Fig.11b</b> - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies</br><b>Fig.11c</b> - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others</br><b>Fig.11d</b> - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.</br><b>Fig.11e</b> - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise. | + | <figcaption><b>Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products</b></br><small><b>Fig.11a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.</br><b>Fig.11b</b> - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies</br><b>Fig.11c</b> - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others</br><b>Fig.11d</b> - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.</br><b>Fig.11e</b> - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.</small></figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 417: | Line 395: | ||
</section> | </section> | ||
− | <!--CONSTRUCTION PWJ89ALT--> | + | <!--CONSTRUCTION PWJ89ALT (OK)--> |
<section id="pwj89alt" class="panel"> | <section id="pwj89alt" class="panel"> | ||
<h1>Construction of pWJ89alt</h1> | <h1>Construction of pWJ89alt</h1> | ||
− | <p>pWJ89alt was constructed | + | <p>pWJ89alt was constructed from the following DNA fragments:</p> |
<ul> | <ul> | ||
<li>pWJ89: low copy plasmid with GFP under a J23117 promoter with and GG-rich upstream regulating sequence (URS) and a Kanamycin resistance gene, received from David Bikard's lab</li> | <li>pWJ89: low copy plasmid with GFP under a J23117 promoter with and GG-rich upstream regulating sequence (URS) and a Kanamycin resistance gene, received from David Bikard's lab</li> | ||
Line 446: | Line 424: | ||
<figure> | <figure> | ||
<a href="https://static.igem.org/mediawiki/2015/7/71/Lab_nb_ecoli_fig13.jpg"><img src="https://static.igem.org/mediawiki/2015/7/71/Lab_nb_ecoli_fig13.jpg" alt="Figure 13" style="width:40%"></a> | <a href="https://static.igem.org/mediawiki/2015/7/71/Lab_nb_ecoli_fig13.jpg"><img src="https://static.igem.org/mediawiki/2015/7/71/Lab_nb_ecoli_fig13.jpg" alt="Figure 13" style="width:40%"></a> | ||
− | <figcaption><b>Fig.13</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control | + | <figcaption><b>Fig.13</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control</figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 471: | Line 449: | ||
<figure> | <figure> | ||
<a href="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg"><img src="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg" alt="Figure 13" style="width:30%"></a> | <a href="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg"><img src="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg" alt="Figure 13" style="width:30%"></a> | ||
− | <figcaption><b>Fig.14</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control | + | <figcaption><b>Fig.14</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control</figcaption> |
</figure> | </figure> | ||
</div> | </div> | ||
Line 505: | Line 483: | ||
− | <!--CONSTRUCTION PWJ89ALT-Z4-TO- | + | <!--CONSTRUCTION PWJ89ALT-Z4-TO-X4--> |
<section id="plink" class="panel"> | <section id="plink" class="panel"> | ||
<h1>Construction of pWJ89alt_Z4-to-X4</h1> | <h1>Construction of pWJ89alt_Z4-to-X4</h1> | ||
− | <p> | + | <p>pWJ89alt_Z4-to-X4 contains a cassette producing sgRNA X4 (activator for J23117alt) controlled by the promoter J23117 and GFP under the J23117alt promoter (corresponds to pWJ89alt). It was constructed from pWJ89alt (as described above) and Z4-to-X4, the cassette producing sgRNA X4 controlled by the promoter J23117</p> |
+ | <p>pWJ89alt was linearized by restriction digest by AfeI, Z4-to-X4 was amplified by PCR and both were assembled by Gibson assembly.</p> | ||
<div id="openpwj89alt" class="panel"> | <div id="openpwj89alt" class="panel"> |
Revision as of 08:52, 10 September 2015
Construction of pdCas9-w
pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP.
Materials and method
- Open pdCas9-bacteria by PCR. pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).
- Miniprep (cf. Protocols) bacteria containing pdCas9-bacteria
- 20 µL Phusion PCR (cf. Protocols) of pdCas9-bacteria with primers f_Gbs_pdCas9 and r_Gbs_pdCas9
- PCR product purification (cf. Protocols)
- Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler ladder)
- Extract w subunit from pWJ66 by PCR. pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
- Miniprep (cf. Protocols) bacteria containing pWJ66
- 20 µL Phusion PCR (cf. Protocols) of pWJ66 using primers f_Gbs_w and r_Gbs_w
- PCR product purification (cf. Protocols)
- Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)
- Gibson assembly of pdCas9-w
- Gibson assembly (cf. Protocols) with purified PCR products of pdCas9-bacteria and w subunit
- Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product
- Colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)
- Miniprep (cf. Protocols) of overnight liquid cultures to isolate pdCas9-w
- Restriction digest (Cf. Protocols) of pdCas9-w with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products (with 1kb Generuler)
- Sequencing (Microsynth)
- Site-directed mutagenesis of dCas9-w (necesary for pdCas9-w to be BioBrick compatible)
- Site-directed mutagenesis (cf. Protocols) of pdCas9-w with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w
- Miniprep (cf. Protocols) of overnight liquid cultures in 7 mL LB with Chloramphenicol of colonies from site-directed mutagenesis plate to isolate mutated pdCas9-w plasmids
- Restriction digest (cf. Protocols) of mutated pdCas9-w plasmids with EcoRI to identify colonies for which the mutagenesis was successful
- Sequencing (Microsynth) of one pdCas9-w for which the mutageneis worked according to the restriction digest
- BioBrick mutated dCas9-w
Results
Open pdCas9 by PCR
Linearized pdCas9-w is expected to be 6705 bp.We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. Many, but not all, of our samples were successfully amplified (cf. Fig.1).For next steps, sample from lane 1 (cf. Fig.1) was used.
Extract w subunit from pWJ66 by PCR
Successful PCR reactions are expected to yield 340 bp fragments.PCR was succesful for sample visible on gel. (cf. Fig.2)
Gibson assembly of pdCas9-w
Colony PCR
Amplicons are 666 bp if Gibson assembly worked and 396 bp if the plasmid self-ligated.Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.Gibson assembly seems to have worked for some samples. (cf. Fig.3)To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.
Restriction digest
pdCas9-w samples from different colonies are present on gels in triplicates in the following order:
- Undigested - expected to yield 7 kb circular plasmid (migrates faster than linear fragments of the same size)
- Digested by BamHI - expected to yield two fragments of 6147 bp and 834 bp if insert is present or one 6705 bp fragment if it is not
- Digested by KpnI - expected to yield two fragments of 45334 bp and 2447 bp if insert is present or one 6705 bp fragment if it is not
BamHI and KpnI are both unique cutters in pdCas9 (without the insert) and double cutters in pdCas9-w (with the insert).Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see.By looking at the relative heights, we can say that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel. Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).
Sequencing
As dCas9-w is very long, only part of it was sequenced (the w subunit and its surrounding base pairs). No mutations were detected.
Site-directed mutagenesis of dCas9-w
BioBrick mutated dCas9-w
Construction of pdCas9-w-sgRNAs
These experiments consist of inserting one or two sgRNA producing cassettes into pdCas9-w.pdCas9-w was linearized by restriction digest. The sgRNA cassettes were synthesized (IDT) and necessary overlaps were added by PCR. The sgRNAs were inserted into pdCas9-w by Gibson assembly.
The sgRNA cassettes were synthesized with sequences "A" and "B" at its ends (cf. Fig.8a). These are the same sequences as those found at the ends of the linearized pdCas9-w.When one cassette is inserted, no overlaps need to be added.When two or three cassettes are added, sequences "C" and/or "D" need to be added at the ends of the cassettes (cf. Fig.8b), thus obtaining unique overlaps for the Gibson assembly.
Open pdCas9-w by restriction digest
Materials and method
- Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Chloramphenicol of pdCas9-w containing bacteria
- Restriction digest (Cf. Protocols) of pdCas9-w with BsrBI (blunt ends)
- Agarose gel electrophoresis of 2 µL of digested and undigested product (with 1kb Generuler)
Results
The digested and undigested plasmids should have the same size. Circular fragments migrates faster than linear fragments of the same size. This means that the undigested plasmid should migrate faster than the digested plasmid.Even though the ladder is not clear, by looking at the relative heights we can see that the digested sample migrated more slowly than the undigested sample (cf. Fig.9). The restriction digest was successful.
Note that this was repeated several times since we needed a lot of linearized pdCas9-w.
Amplify sgRNA cassettes by PCR
Materials and method
- 20 µL Phusion or Q5 PCR (cf. Protocols) of sgRNA cassette with primers as indicated in table below
- Agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)
- PCR product purification (cf. Protocols)
sgRNA cassette(s) | Forward primer(s) / Reverse primer(s) |
---|---|
Z0 | f_Gbs_sgRNA-A / r_Gbs_sgRNA-Bf_Gbs_sgRNA-A / r_Gbs_sgRNA-BtoD |
Z4 | f_Gbs_sgRNA-A / r_Gbs_sgRNA-B |
Z35 | f_Gbs_sgRNA-A / r_Gbs_sgRNA-B |
X0 | f_Gbs_sgRNA-A / r_Gbs_sgRNA-B |
X4 | f_Gbs_sgRNA-A / r_Gbs_sgRNA-B |
X35 | f_Gbs_sgRNA-A / r_Gbs_sgRNA-B |
Results
All amplified sgRNA cassettes are expected to be about 370 bp.
sgRNA cassette Z0 was amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).
sgRNA cassette Z4 was amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).
sgRNA cassette Z35 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)
sgRNA cassette X0 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10d)
sgRNA cassette X4 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10e)
sgRNA cassette X35 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10f)
Assemble pdCas9-w-sgRNA constructs by Gibson assembly
Materials and method
Part 1: pdCas9-w + sgRNA assembly
- Gibson assembly (cf. Protocols) with linearized pdCas9-w and purified sgRNA PCR products:
- Z0 / Z4 / Z35 / X0 / X4 / X35 (overlaps A and B)
- Z0+Z4 / Z0+Z35 / Z4+Z35 / X0+X4 / X0+X35 / X4+X35 (overlaps A and C/D for 1st cassette and C/D and B for 2nd cassette)
- Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product, spreading on Chloramphenicol plates
- Colony PCR (cf. Protocols) of colonies from plate used for culture of transformed cells with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler)One colony PCR (cf. Fig11a) was done with primers f_Gbs_pdCas9 and r_Scq_pdCas9_w_sgRNA
- Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Chloramphenicol of colonies from plate used for culture of transformed cells to isolate pdCas9-w plasmids
- Sequencing (Microsynth) of one colony for which Gibson assembly worked according to colony PCR and restriction analysis
Part 2: pdCas9-w-sgRNA + sgRNA assembly
Coming soon
Results
Part 1: pdCas9-w + sgRNA assembly
In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.
pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.11a) was confirmed by sequencing to be pdCas9-w-Z0 and to not contain any mutations that may have an effect on its activity. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.11a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. (This sample will be used again in Part 2.)Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.11b). Sequencing comfirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.11c) and sequencing confirmed that is the case. Sequencing also showed some mutations or deletions in the promoter and/or terminator for these 2 samples. We decided to keep working with these and test whether these mutations are significative with an activity assay.Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.11d). However, it contains a mutation in the promoter. A 2nd pdCas9-w-X0 without mutations will be constructed in part 2, after which we will be able to compare the activity of this promoter with/without a mutation.Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.11e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4 and that it does not contain any mutations.Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.11d) and no mutations were found in the sequence.
Part 2: pdCas9-w-sgRNA + sgRNA assembly
- Coming soon
Construction of pWJ89alt
pWJ89alt was constructed from the following DNA fragments:
- pWJ89: low copy plasmid with GFP under a J23117 promoter with and GG-rich upstream regulating sequence (URS) and a Kanamycin resistance gene, received from David Bikard's lab
- J23117alt: alternative promoter with randomly generated sequences except for the -35 and -10 sequences (synthesized by IDT)
pWJ89 was amplified without its J23117 promoter by PCR and the J23117alt promoter was amplified by PCR. These fragments were assembled by Gibson assembly, the final product is pWj89alt.The J23117alt promoter was BioBricked.
PCR pWJ89
We received plasmid pWJ89 in bacteria and did a Miniprep (cf. Protocols) on overnight cultures to isolate it. This step consists of amplifying pWJ89 without the J23117 promoter by PCR.
Materials and method
- 20 µL Phusion PCR and 25 µL Q5 PCR (cf. Protocols) of pWJ89 using primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89.
- Agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)
- PCR product purification (cf. Protocols)
Results
Successful PCR reactions are expected to yield 4400 bp amplicons.Both negative control lanes (cf. Fig.13) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.13). We will work with this sample for next steps.
PCR J23117alt promoter
This step consists of amplifying J23117alt promoter by primer extension PCR to use it for a Gibson assembly in a further step.
Materials and method
- 20 µL Phusion PCR and 25 µL Q5 PCR (cf. Protocols) of J23117alt using primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT.
- Agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)
- PCR product purification (cf. Protocols)
Results
Successful PCR reactions are expected to yield 340 bp amplicons.Both negative control lanes (cf. Fig.14) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.
Gibson assembly of pWJ89alt
This step consists of using Gibson assembly to insert the J23117alt promoter into pWJ89alt from which its original promoter J23117 was extracted by PCR. We transformed cells with the Gibson assembly product and tested for colonies that contain the construct by colony PCR, restriction digest and sequencing.
Materials and method
- Gibson assembly (cf. Protocols) with purified PCR products:
- Amplified pWJ89 (wihtout J23117): 0.05 pmol = 143 ng
- J23117alt promoter: 0.1 pmol = 22.1 ng
- Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product, spreading on Kanamycin plates
- Colony PCR (cf. Protocols) of colonies from plate used for culture of transformed cells with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler)
- Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Kanamycin and sequencing (Microsynth) of one colony for which Gibson assembly worked according to colony PCR
Results
Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).
BioBrick J23117alt promoter
Coming soon
Construction of pWJ89alt_Z4-to-X4
pWJ89alt_Z4-to-X4 contains a cassette producing sgRNA X4 (activator for J23117alt) controlled by the promoter J23117 and GFP under the J23117alt promoter (corresponds to pWJ89alt). It was constructed from pWJ89alt (as described above) and Z4-to-X4, the cassette producing sgRNA X4 controlled by the promoter J23117
pWJ89alt was linearized by restriction digest by AfeI, Z4-to-X4 was amplified by PCR and both were assembled by Gibson assembly.
Open pWJ89alt by restriction digest
Coming soon
PCR Z4-to-X4
Coming soon
Gibson assembly pWJ89alt_Z4-to-X4
Coming soon
Construction of pWJ89_mCherry
Coming soon
Open pWJ89 by restriction digest
Coming soon
PCR pWJ89alt
Coming soon
Extract mCherry by restriction digest
Coming soon
PCR mCherry
Coming soon
Gibson assembly of pWJ89_mCherry
Coming soon
Transistor activity assay
Coming soon
Primer table
Name | Sequence | Associated part |
---|---|---|
f_Gbs_pdCas9 | CTCGAGTAAGGATCTCCAG | pdCas9 |
f_Gbs_sgRNA-CtoA | GTCGGCGATGGTGGTAGCTAATTATGTTCCctcgctcactgactcgctac | sgRNA cassettes |
f_Gbs_sgRNA-DtoA | CTAGACCTAACTGAGATACTGTCATAGACGctcgctcactgactcgctac | sgRNA cassettes |
f_Gbs_sgRNA-A | ctcgctcactgactcgctac | sgRNA cassettes | f_Gbs_w | ACACGCATTGATTTGAGTCA | pWJ66 |
f_Mt_A2080C_pdCas9-w | TGACTTTTCGcATTCCTTATTATGTTG | pdCas9-w |
r_Gbs_pdCas9 | GTCACCTCCTAGCTGACTC | pdCas9 |
r_Gbs_sgRNA-B | tggcatcttccaggaaatc | sgRNA cassettes/td> |
r_Gbs_sgRNA-BtoC | GGAACATAATTAGCTACCACCATCGCCGACtggcatcttccaggaaatc | sgRNA cassettes |
r_Gbs_sgRNA-BtoD | CGTCTATGACAGTATCTCAGTTAGGTCTAGtggcatcttccaggaaatc | sgRNA cassettes/td> |
r_Gbs_w | atttgatgcctggagatccttactcgagTTAACGACGACCTTCAGCA | pWJ66 |
r_Mt_A2080C_pdCas9-w | AGATTTTTTCAATCTTCTCACG | pdCas9-w |
r_Scq_pdCas9_w_sgRNA | ctgatttgagcgtcagat | pdCas9-w-sgRNA |