Difference between revisions of "Team:SZU China/Description"

Line 24: Line 24:
 
               <div class="col-sm-4">
 
               <div class="col-sm-4">
 
           <div class="part_name">
 
           <div class="part_name">
               <h3>part1</h3>
+
               <h3>hUPⅡ+AckRS</h3>
 
               </div>
 
               </div>
 
               <div class="part_info">
 
               <div class="part_info">
                 <p>ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT</p>
+
                 <p><a href="http://parts.igem.org/Part:BBa_K1722007">detail</a><br>
 +
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)
 +
</p>
 
                 </div>
 
                 </div>
 
               </div>
 
               </div>
Line 33: Line 35:
 
             <div class="col-sm-4">
 
             <div class="col-sm-4">
 
             <div class="part_name">
 
             <div class="part_name">
                 <h3>part2</h3>
+
                 <h3>hTERT+tRNA</h3>
 
             </div>
 
             </div>
 
             <div class="part_info">
 
             <div class="part_info">
                 <p>ACGTGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCATCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCGTCAGTCAGGCTAGCTAGCT</p>
+
                 <p><a href="http://parts.igem.org/Part:BBa_K1722010">detail</a><br>
 +
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)
 +
</p>
 
             </div>
 
             </div>
 
             </div>
 
             </div>
Line 42: Line 46:
 
             <div class="col-sm-4">
 
             <div class="col-sm-4">
 
             <div class="part_name">
 
             <div class="part_name">
                 <h3>part3</h3>
+
                 <h3>SV40+Rluc</h3>
 
             </div>
 
             </div>
 
             <div class="part_info">
 
             <div class="part_info">
                 <p>ACGTGTCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCAGTCAGGCTAGCTAGCT</p>
+
                 <p><a href="http://parts.igem.org/Part:BBa_K1722012">detail</a><br> 
 +
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)
 +
</p>
 
             </div>
 
             </div>
 
             </div>
 
             </div>

Revision as of 13:33, 17 September 2015

Improved parts

hUPⅡ+AckRS

detail
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)

hTERT+tRNA

detail
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)

SV40+Rluc

detail
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)

Other parts

part 4:


ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT

part 5:


ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT