Difference between revisions of "Team:SZU China/Description"

Line 1: Line 1:
−
<html>
 
−
<head>
 
−
<link rel="stylesheet" type="text/css"  href="https://2015.igem.org/Template:SZU_China/Playground/bootstrap/CSS?action=raw&ctype=text/css" />
 
  
−
 
+
   
−
 
+
        <link rel="stylesheet" type="text/css" href="https://2015.igem.org/Template:SZU_China/Playground/bootstrap/CSS?action=raw&ctype=text/css">
−
<!-- Latest compiled and minified JavaScript -->
+
        <!-- Latest compiled and minified JavaScript -->
−
<script src="https://2015.igem.org/Template:SZU_China/bootstrap/Javascript?action=raw&ctype=text/javascript"></script>
+
       
−
 
+
        <!--custom css file-->
−
 
+
        <link href="https://2015.igem.org/Template:SZU_China/Playground/custom/CSS?action=raw&ctype=text/css" rel="stylesheet">
−
<!--custom css file-->
+
        <link href="https://2015.igem.org/Template:SZU_China/Playground/title/CSS?action=raw&ctype=text/css" rel="stylesheet">
−
<link href="https://2015.igem.org/Template:SZU_China/Playground/custom/CSS?action=raw&ctype=text/css" rel="stylesheet">
+
   
−
 
+
−
<link href="https://2015.igem.org/Template:SZU_China/Playground/title/CSS?action=raw&ctype=text/css" rel="stylesheet">
+
−
</head>
+
−
</html>
+
 
{{Template:SZU_China/Playground/menu}}
 
{{Template:SZU_China/Playground/menu}}
−
 
+
   
−
<html>
+
−
<body>
+
−
 
+
−
 
+
−
   
+
−
<div class="text-title">
+
−
  <div class="texts">
+
−
 
+
−
<br>
+
−
<br>
+
−
    <p id="heading">Improved parts</p>
+
−
    </div></br>
+
−
<br>
+
−
</br>
+
−
</div>
+
−
 
+
−
 
+
−
    <div class="container" style="padding:20px;">
+
−
 
+
 
      
 
      
−
      <div class="row">
+
   
−
 
+
         <div class="text-title">
−
         <div class="col-sm-8 blog-main">
+
             <div class="texts">
−
 
+
                <br>
−
          <div class="blog-post">
+
                <br>
−
             <h2 class="blog-post-title">Improved parts</h2>
+
                <p id="heading">Improved parts</p>
−
<div class="content-text">
+
−
      <div class="improved part">
+
−
          <div class="row">
+
−
 
+
−
 
+
−
 
+
−
  <div class="col-sm-4">
+
−
            <div class="part_name">
+
−
                <h3>shTERT</h3>
+
 
             </div>
 
             </div>
−
             <div class="part_info">
+
             <br>
−
                 <p><a href="http://parts.igem.org/Part:BBa_K1722001">BBa_K1722001</a><br>
+
            <br><br>
−
shTERT is short for super human telomerase reverse transcriptase, which is improved from hTERT promoter(<a href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a>), a cancer specific promoter. Three base pairs in hTERT promoter were mutated and the drive efficiency of the promoter was verified to be increased significantly.  
+
        </div>
−
</p>
+
        <div class="container" style="padding:20px;">
−
            </div>
+
            <div class="row">
−
            </div>
+
                 <div class="col-sm-4">
−
         
+
                    <div class="part_name">
−
 
+
                        <h3><strong>New Basic Part :</strong> hUPll</h3>
−
 
+
−
              <div class="col-sm-4">
+
                    </div>
−
          <div class="part_name">
+
                    <div class="part_info">
−
              <h3>Rluc(with TAG)</h3>
+
                        <p><a href="http://parts.igem.org/Part:BBa_K1722000">BBa_K1722000</a>
−
              </div>
+
                            <br>hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells. 2015 SZU-iGEM
−
              <div class="part_info">
+
                            use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized.</p>
−
                <p><a href="http://parts.igem.org/Part:BBa_K1722005">BBa_K1722005</a><br>
+
                    </div>
−
The Rluc was improved from <a href="http://parts.igem.org/Part:BBa_J52012">BBa_J52012</a>,which was being amber mutated.It can be transcripted to an mRNA chain with one codon being mutated to stop codon UAG. It cannot be fully expressed in natural biology system but can be used as a reporter gene in unnatural amino acid orthogonal system which has a tRNA whose anticodon can pair with the stop codon.
+
                </div>
−
</p>
+
                <div class="col-sm-4">
 +
                    <div class="part_name">
 +
                        <h3><strong>Another Basic Part :</strong> hTERT</h3>
 +
 +
                    </div>
 +
                    <div class="part_info">
 +
                        <p><a href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a>
 +
                            <br>hTERT, which is short for human telomerase reverse transcriptase, is recognized as a cancer specific promoter for various cancers. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in
 +
                            normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells.</p>
 +
                    </div>
 +
                </div>
 +
                <div class="col-sm-4">
 +
                    <div class="part_name">
 +
                        <h3><strong>Another Basic Part :</strong> tRNA</h3>
 +
 +
                    </div>
 +
                    <div class="part_info">
 +
                        <p><a href="http://parts.igem.org/Part:BBa_K1722004">BBa_K1722004</a>
 +
                            <br>This tRNA gene can produce an tRNA with CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Only with this tRNA can the mRNA chain with UAG terminator being
 +
                            fully translated. The aminoacyl-tRNA came from barchaebacteria, and it is generally applied to unnatural amino acid orthogonal system.</p>
 +
                    </div>
 
                 </div>
 
                 </div>
−
              </div>
 
−
           
 
−
            <div class="col-sm-4">
 
−
            <div class="part_name">
 
−
                <h3>SV40(with Enhancer)</h3>
 
 
             </div>
 
             </div>
−
             <div class="part_info">
+
             <br>
−
                <p><a href="http://parts.igem.org/Part:BBa_K1722006">BBa_K1722006</a><br>
+
         </div>
−
Different from the SV40 promoter distributed by iGEM13_Freiburg(<a href="http://parts.igem.org/Part:BBa_K1150011">BBa_K1150011</a>), the promoter we are submitting this year includes an enhancer sequence(74bp) upstream of the promoter gene. It is a widely used strong promoter that can improve the gene expression level of many host cells. the therapeutic gene out.
+
       
−
</p>
+
       
−
            </div>
+
         <!-- /.row -->
−
            </div>
+
       
−
           
+
        <!-- /.container -->
−
     
+
−
           
+
−
            </div>
+
−
         <div class="other">
+
−
            <h3>Other parts</h3>
+
−
            <p><strong>part 4:</strong></p><br>
+
−
                <p>ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT</p>
+
−
               
+
−
                  <p><strong>part 5:</strong></p><br>
+
−
                <p>ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT</p>
+
−
            </div>
+
−
         
+
−
</div>
+
−
 
+
−
     
+
−
          
+
−
 
+
−
   
+
−
 
+
−
 
+
−
      </div><!-- /.row -->
+
−
 
+
−
    </div><!-- /.container -->
+
−
 
+
−
<script src="https://2015.igem.org/Template:SZU_China/bootstrap/Javascript?action=raw&ctype=text/javascript"></script>
+
−
</body>
+
−
</html>
+

Revision as of 14:06, 18 September 2015


       <link rel="stylesheet" type="text/css" href="https://2015.igem.org/Template:SZU_China/Playground/bootstrap/CSS?action=raw&ctype=text/css">
        
       <link href="https://2015.igem.org/Template:SZU_China/Playground/custom/CSS?action=raw&ctype=text/css" rel="stylesheet">
       <link href="https://2015.igem.org/Template:SZU_China/Playground/title/CSS?action=raw&ctype=text/css" rel="stylesheet">

Improved parts

New Basic Part : hUPll

<a href="http://parts.igem.org/Part:BBa_K1722000">BBa_K1722000</a>
hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells. 2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized.

Another Basic Part : hTERT

<a href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a>
hTERT, which is short for human telomerase reverse transcriptase, is recognized as a cancer specific promoter for various cancers. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells.

Another Basic Part : tRNA

<a href="http://parts.igem.org/Part:BBa_K1722004">BBa_K1722004</a>
This tRNA gene can produce an tRNA with CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Only with this tRNA can the mRNA chain with UAG terminator being fully translated. The aminoacyl-tRNA came from barchaebacteria, and it is generally applied to unnatural amino acid orthogonal system.