Team:Paris Bettencourt/Notebook/VitaminB2

13/07
  • Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT.
    • Dilution in water and PCR amplification, using the following protocol:
    • 1 μL gBlock (0.1 to 1ng)
    • 1 μL forward primer (10 μM)
    • 1 μL reverse primer (10 μM)
    • 22 μL DNAse/RNAse free water
    • 25 μL LifeTech MasterMix (2X)

    RibA + o15.001 (GCGCCCGAAGACTTATGCAG) + o15.002(GGCCCCGCGCATATGAAG)
    RibD + o15.003(CGCTATAGAAGACTTGAGAAGATCTG) + o15.004(GCGCGGCACCACATATGAAG)
    RibE + o15.005(CGGCTATAGAAGACTTGCGC) + o15.006(CGCGCCGGCATATGAAGA)
    RibT25 + o15.007(CCGCGTATAGAAGACTGCTAGA) + o15.008(CAGCAGCATATGAAGACAACCC)
    RibT48 + o15.009(GCGGTATAGAAGACTGCTAGAGA) + o15.010(CAGCAGCATATGAAGACAACCC)

    For each PCR reaction, a negative control without matrix DNA was prepared.


    12 cycles amplification, using the following parameters:
    time (min) temperature (°C) function
    3:00 98 melting
    0:30 98 melting
    0:30 52 annealing
    1:00 72 extension
    10:00 72 extension
    forever 12 storage
    PCR purification using QIAGEN kit
      PCR purification protocol
    • Add 5 volumes of resuspension buffer to 1 volume of PCR product in an 1.5mL microcentrifuge tube, mix by pipetting up and down
    • Transfer in a centrifugation column
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Add 700μL of washing solution
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Add 500μL of washing solution
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Centrifuge 1 min at 14000 rpm
    • Throw the filtration product
    • Put the column in a sterile 1.5mL microcentrifuge tube
    • Add 45μL of DNAse/RNAse free water on the membrane
    • Wait 2 minutes
    • Centrifuge 2min at 10000rpm
    • Discard the column, DNA is saved in water

Concentrations measured with a Nanodrop:
[PCR product with gBlock] (ng/μL) [PCR product without gBlock] (ng/μL)
RibA 3.5 3.4
RibD 6.4 3.3
RibE 5.0 3.7
RibT25 3.5 3.8
RibT48 8.7 3.3
Almost no difference between the PCR and their corresponding negative control.
It could be the fallout of the limited number of cycles. (We only used 12 cycles, as advised by IDT)
NEB Tm calculator gave really different Tm for the PCR primers than Geneious and IDT.
We decided to launch two PCR, both with 35 cycles, but with two different annealing
temperature: 52 and 64°C.

14/07
Launched the two different PCR with different Tm.

PCR with high annealing temperature, 35 cycles:
time (min) temperature (°C) function
3:00 98 melting
0:30 98 melting
0:30 64 annealing
1:00 72 extension
10:00 72 extension
forever 12 storage

PCR with low annealing temperature, 35 cycles:
time (min) temperature (°C) function
3:00 98 melting
0:30 98 melting
0:30 64 annealing
1:00 72 extension
10:00 72 extension
forever 12 storage

After PCR, we ran the PCR products on a TAE - 1% agarose gel (100V, 20min) to check
if the amplification product correspond to the expected size of the gBlocks.
From left to right:
1kb Ladder, RibA, D, E, T25 and T48 amplified at 52°C
and Rib A, D, E, T25 and T48 amplified at 64°C