Difference between revisions of "Team:Sherbrooke/Design"

m
 
(44 intermediate revisions by 4 users not shown)
Line 2: Line 2:
 
<html>
 
<html>
  
−
<h1>Design</h1>
+
<h1>Hardware Design</h1>
 
<br/>
 
<br/>
−
<p>Our robotic platform is composed of many modules, each with their own specifications, concept and functionalities. Each module is designed to be independent so they can be operated alone or jointly with other modules. The teamwork between every module is managed by the Main Administrator that communicates and controls them via a CAN communication bus and custom controller boards, named BananaBoard. In its entirety, the project has eight distinct modules: The platform, the tool holder, custom pipettes, the gripper, the centrifuge, the magneto caloric module for 96-well plate, the magneto caloric module for 1.5mL tube and the turbido agitator caloric module for glass tube. Additionally, most of these module are controlled by our custom controller board. The global architecture of the robotic platform is as follows:
+
<p>Our robotic platform consists of many modules, each with their own design, specifications and functionalities. Each module is independent and can either be operated alone or in combination with other modules. The teamwork between every module is managed by the Main Administrator, which communicates and controls them via a CAN communication bus and custom controller boards created by our team, that we named "BananaBoard. Currently, the project comprises nine distinct modules: the platform, the tool holder, custom pipettes (one single and one multi-channel), the gripper, the centrifuge, and the turbido agitator caloric module for glass tube (TAC), the magneto caloric module for 1.5mL tube (MC1.5), and the magneto caloric module for 96-well plate (MC96). Most of our modules are controlled by our "BananaBoard". There is also a controller interface for the user so he can create and automate his protocols. The global architecture of the robotic platform is as follows:
 
</p>
 
</p>
 
<br/>
 
<br/>
 
<div class="imageContainer">
 
<div class="imageContainer">
 
<img width="100%" height="100%" src="https://static.igem.org/mediawiki/2015/5/55/Team_Sherbooke_Global_Architecture.png" /><br/>
 
<img width="100%" height="100%" src="https://static.igem.org/mediawiki/2015/5/55/Team_Sherbooke_Global_Architecture.png" /><br/>
−
<p>Biobot Project Global Architecture</p>
+
<p>BIOBOT: Global Project Architecture</p>
 
</div>
 
</div>
 
<p>
 
<p>
Line 21: Line 21:
 
<li><a href="#Gripper">Gripper</a></li>
 
<li><a href="#Gripper">Gripper</a></li>
 
<li><a href="#Centrifuge">Centrifuge</a></li>
 
<li><a href="#Centrifuge">Centrifuge</a></li>
−
<li><a href="#MC96">Magneto Caloric 96 (MC96)</a></li>
 
 
<li><a href="#MC15">Magneto Caloric 1.5 (MC1.5)</a></li>
 
<li><a href="#MC15">Magneto Caloric 1.5 (MC1.5)</a></li>
 
<li><a href="#TAC">Turbido Agitator Caloric (TAC)</a></li>
 
<li><a href="#TAC">Turbido Agitator Caloric (TAC)</a></li>
 +
<li><a href="#MC96">Magneto Caloric 96 (MC96)</a></li>
 
<li><a href="#BB">BananaBoard</a></li>
 
<li><a href="#BB">BananaBoard</a></li>
−
<li><a href="#Controller">Controller</a></li>
+
<li><a href="#ControllerInterface">Controller Interface</a></li>
−
<li><a href="#Primers">Primers</a></li>
+
 
</ul>
 
</ul>
  
Line 35: Line 34:
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
The physical platform consists of everything related to the structure on which the movements take place. It also acts as the reference surface area for the labware used during a protocol. It is equipped with motors and traction mechanisms for movement on the horizontal plane, as well as indicators to locate the home position of each axis. Atop the structure is a travelling bridge and a trolley with the tool holder attached to it. The movements and limits detection of the platform are supervised by a well known controller board: <span style="color:red"> the SmoothieBoard.</span> The robot does smooth and precise movements and gives feedback on its position on demand. We started with a small model as the first draft of our platform. Since the beginning of the project, we build a completely new platform, which is bigger and stronger. The redesigned platform was quadrupled in size, the motors was changed for a stronger and faster model, and the original work area with rails was changed for a pegboard for easier placement of the modules.
+
The physical platform consists of everything related to the structure on which the movements take place. It also acts as the reference surface area for the labware and modules used during a protocol. It is equipped with motors and traction mechanisms for movement on the horizontal plane, as well as indicators to locate the home position of each axis. The top of the structure is a travelling bridge for a trolley with the tool holder attached to it. The movements and limit detection of the platform are supervised by an Arduino controller board with a Marlin Ramps 1.4 shield coded a custom firmware in it. The platform motors are driven in current by 2 MKS TB6600 V1.1. The robot does smooth and precise movements and gives feedback on its position on demand.
 
</p>
 
</p>
 +
 
<div class="imageContainer">
 
<div class="imageContainer">
−
<img height="100%" src="https://static.igem.org/mediawiki/2015/0/04/Team_Sherbrooke_Platform.jpg" /><br/>
+
<img width="100%" height="100%" src="https://static.igem.org/mediawiki/2015/0/0a/Team_Sherbrooke_3D_Platform.PNG" /><br/>
−
<p>Biobot Project Physical Platform (La changer pour une récente avec les modifications)</p>
+
<p>Robotic Platform</p>
 
</div>
 
</div>
 +
 
<p>
 
<p>
−
The frame is made up of aluminium extrusions. This material was selected due to its lightness, rather low cost and simplicity to sterilize, which is a great advantage for a platform used in a biology lab. When designing the platform, we sometimes created a first version using a 3D printer to validate our concept. After validation, most of those parts were replaced by a machined aluminium version.
+
The frame is made up of aluminum extrusions. This material was selected due to its lightweightness, rather low cost, easy of manipulation, and simplicity to sterilize. When designing the platform, we sometimes created a first version of some parts using a 3D printer to validate our concept. After validation, most of those parts were replaced by a machined aluminum version.
 
</p>
 
</p>
 
<p>
 
<p>
−
Movements of the different axes are ensured by stepper motors to perform translations of the travelling bridge and of the trolley. For movements relative to the horizotal plane, two NEMA 23 stepper motors, model <span style="color:red">17HS3001-20B</span>, were used. They offer fast speeds, while still being precise as to <span style="color:red">200 microns</span>, which is useful to move the tools to a precise position without slowing down the whole process. These motors are coupled with an endless screw which makes the assembly moves as it spins. The are also used because they are durable and reliable. Those two assets are significant since a lot of repetitive movements occur in the horizontal plane, which consequently deals more wear and tear.
+
Movements of the different axes are driven by stepper motors to perform translations of the travelling bridge and of the trolley. For movements relative to the horizontal plane, two NEMA 23 stepper motors, model 17HS3001-20B, were used. They offer fast speeds, while still being precise to 0.008 mm, which is useful to move the tools to a precise position without slowing down the whole process. They were also chosen because of their durability and reliability. Those two assets are significant since a lot of repetitive movements occur in the horizontal plane, which consequently deals with more wear and tear. These motors are coupled with an endless screw which makes the assembly move as the motors spin.
 
</p>
 
</p>
 
<br/>
 
<br/>
Line 58: Line 59:
 
<tr>
 
<tr>
 
<td>Frame material</td>
 
<td>Frame material</td>
−
<td>Aluminium extrusions</td>
+
<td>Aluminum extrusions</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
Line 70: Line 71:
 
<tr>
 
<tr>
 
<td>X axis movement precision</td>
 
<td>X axis movement precision</td>
−
<td style="color:red">0.25 mm</td>
+
<td>0.127 mm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>X axis movement speed</td>
 
<td>X axis movement speed</td>
−
<td style="color:red">50 mm/s</td>
+
<td>0 to 500 mm/s</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Y axis movement precision</td>
 
<td>Y axis movement precision</td>
−
<td style="color:red">0.25 mm</td>
+
<td>0.127 mm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Y axis movement speed</td>
 
<td>Y axis movement speed</td>
−
<td style="color:red">50 mm/s</td>
+
<td>0 to 500 mm/s</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 94: Line 95:
 
<tr>
 
<tr>
 
<td>Motors' input voltage</td>
 
<td>Motors' input voltage</td>
−
<td style="color:red">24V</td>
+
<td>24V</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 106: Line 107:
 
<tr>
 
<tr>
 
<td>Language</td>
 
<td>Language</td>
−
<td style="color:red">C++</td>
+
<td>C++</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 129: Line 130:
 
<h2 class="subTitle">Tool Holder</h2>
 
<h2 class="subTitle">Tool Holder</h2>
 
<hr/>
 
<hr/>
 +
<div class="imageContainer">
 +
<img width="50%" src="https://static.igem.org/mediawiki/2015/e/e0/Team_Sherbrooke_3D_Tool_Holder_Front.png" /><br/>
 +
<p>Tool Holder Front View</p>
 +
</div>
 +
<div class="imageContainer">
 +
<img width="50%" src="Team_Sherbrooke_3D_Tool_Holder_Back.png" /><br/>
 +
<p>Tool Holder Back View</p>
 +
</div>
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
One of the main scope of the platform is to perform pipetting operations using different type of pipettes, namely, single-channel and multi-channel pipette as needed by the lab protocol. To hold and use them, a custom tool holder was designed and built. The holder is fixed on the trolley which is fixed on the travelling bridge. The tool holder have three independent <a href="http://openbuildspartstore.com/c-beam-linear-rail/">C-Beam by OpenBuilds</a> to perform movement along the vertical axis. The two first C-Beams are used for pipettes. The third one is used for the gripper. Pipettes' C-Beam are equipped with a pipette holder, made of actuators to press the piston and the tip release push-button.  
+
One of the main objective of the platform is to perform pipetting operations using different type of pipettes, namely, single-channel and multi-channel pipette. To hold and use them, a custom tool holder was designed and built. The holder is fixed on the trolley which is fixed on the travelling bridge. The tool holder has three independent <a href="http://openbuildspartstore.com/c-beam-linear-rail/">C-Beam by OpenBuilds </a>to perform movement along the vertical axis. The two first C-Beams are used for pipette and the third one is used for the gripper. Pipettes' C-Beams are equipped with a syringe holder, made of stepper motors to press or pull the syringe's piston and aslo to hold the BananaBoard. All the C-Beams' motors are controlled and driven in current like the platform's motor: with an Arduino controller board with a Marlin Ramps 1.4 shield which is programmed with our custom firmware in it.
 
</p>
 
</p>
 
<br/>
 
<br/>
Line 144: Line 153:
 
<tr>
 
<tr>
 
<td>Frame material</td>
 
<td>Frame material</td>
−
<td>Aluminium extrusions</td>
+
<td>Aluminum extrusions</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Dimensions</td>
 
<td>Dimensions</td>
−
<td style="color:red">X cm x X cm x X cm</td>
+
<td>X cm x X cm x X cm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
Line 156: Line 165:
 
<tr>
 
<tr>
 
<td>Z axis movement precision</td>
 
<td>Z axis movement precision</td>
−
<td style="color:red">0.25mm</td>
+
<td>0.4 mm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Z axis movement speed</td>
 
<td>Z axis movement speed</td>
−
<td style="color:red">50mm/s</td>
+
<td>156 mm/s</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 172: Line 181:
 
<tr>
 
<tr>
 
<td>Motors' input voltage</td>
 
<td>Motors' input voltage</td>
−
<td style="color:red">24V</td>
+
<td>24V</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 184: Line 193:
 
<tr>
 
<tr>
 
<td>Language</td>
 
<td>Language</td>
−
<td style="color:red">C++</td>
+
<td>C++</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 216: Line 225:
 
<span id="Pipettes"> &nbsp; </span>
 
<span id="Pipettes"> &nbsp; </span>
 
<h2 class="subTitle">Pipettes</h2>
 
<h2 class="subTitle">Pipettes</h2>
−
<hr/>
+
<hr>
 +
<div class="imageContainer">
 +
<img width="40%" src="https://static.igem.org/mediawiki/2015/c/cd/Team_Sherbrooke_Single_Pipette_Assembly.png" /><br/>
 +
<p>Single-Channel Pipette</p>
 +
</div>
 +
<div class="imageContainer">
 +
<img width="40%" src="https://static.igem.org/mediawiki/2015/5/52/Team_Sherbrooke_3D_Multi_Channel.png" /><br/>
 +
<p>Multi-Channel Pipette</p>
 +
</div>
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
Pipetting will be one of our platform major functionality. To do so, we designed custom pipette modules using syringes instead of using normal pipettes. This will give our pipette system more versatility. It will also ease the design of the mechanical interface between our pipettes and the tool-holder. We designed a single-channel pipette as well as a multi-channel one.
+
Pipetting is one of our platform major functionality. To do so, we designed custom pipette modules using syringes equipped with a versatile tip adapter capable of loading tips of different size (2&mul, 200&mul and 1000&mul) on the same adapter. This will give our pipette system more versatility. Using custom pipette modules has ease the design of the mechanical interface between our pipettes and the tool-holder. We designed a single-channel pipette as well as a multi-channel one (8 channels).
 
</p>
 
</p>
 
<p>
 
<p>
−
The system is somewhat simple. A custom support was designed and machined in <span style="color:red">aluminium</span> pieces to hold the different parts of the whole pipette system. Starting at the bottom, a pipette tip is fixed on adapter. This adapter is needed because pipette tips are not design to fit on syringe and vice versa. Attached on top of the adapter is the syringe. The syringe piston is grabbed by a mechanical piece that is coupled on an endless screw, which is coupled on a stepper motor. As the motor spins, the piston moves in the syringe, and doing so, vacuuming the liquid in and out of the pipette tip. The amount of liquid in the pipette is known and controlled by the number of step the motor spins. The whole pipette assembly is then fixed on the tool-holder and is controlled by a BananaBoard.
+
The system is somewhat simple. A custom support was designed and machined in aluminum pieces to hold the different parts of the whole pipette system. Starting at the bottom, a pipette tip is fixed on adapter. This adapter is needed because pipette tips are not design to fit on syringe and vice versa. Attached on top of the adapter is the syringe. The syringe piston is grabbed by a mechanical piece that is coupled on an endless screw, which is coupled on a stepper motor. As the motor spins, the piston moves in the syringe, and doing so, vacuuming the liquid in and out of the pipette tip. The amount of liquid in the pipette is known and controlled by the number of step the motor spins. The whole pipette assembly is then fixed on the tool-holder and is controlled by a BananaBoard.
 
</p>
 
</p>
 
<p>
 
<p>
−
The multi-channel pipette system has a minor difference, beside the number of syringe and tip of course. Because it was not possible to assemble the syringes close enough so they would fit the width of a standard 96-well plate, we had to add a tube between the syringe and the pipette tip adaptor. That way, tips are close enough, and there is enough space to attached the syringes side-by-side. Take a look at the assembly section of the pipette to have a better idea of the system.
+
The multi-channel pipette system has a minor difference, beside the number of syringe and tip of course. Because it was not possible to assemble the syringes close enough so they would fit the width of a standard 96-well plate, we had to add tubing between the syringe and the pipette tip adaptor. That way, the tip adaptor is close enough to fit a standard 96 tips box, and there is enough space to attach the larger syringes side-by-side. Take a look at the assembly section of the pipette to have a better idea of the system.
 
<br/>
 
<br/>
  
−
<h3 style="color:red">Specifications</h3>
+
<h3>Specifications</h3>
 
<h4>Mechanical</h4>
 
<h4>Mechanical</h4>
 
<table>
 
<table>
Line 236: Line 253:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
−
<td>Dimensions</td>
+
<td>Dimensions (Height Width x Depth)</td>
−
<td>258 mm x 75 mm x 97 cm</td>
+
<td><strong>Single channel: </strong> 283 mm X 80 mm X 52 mm <br>
 +
<strong>Multi channel: </strong> 224.2 mm X 175 mm X 99 mm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Vacuuming range</td>
 
<td>Vacuuming range</td>
−
<td>0 to XXX &mu;L </td>
+
<td>0 to 1000 &mu;l </td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Vacuuming precision</td>
 
<td>Vacuuming precision</td>
−
<td>XX &mu;L </td>
+
<td>0.2 &mu;l </td>
−
</tr>
+
−
<tr>
+
−
<td>Vacuuming speed</td>
+
−
<td>XX &mu;L/sec </td>
+
 
</tr>
 
</tr>
 
 
Line 274: Line 288:
 
<tr>
 
<tr>
 
<td>Language</td>
 
<td>Language</td>
−
<td style="color:red">C++</td>
+
<td>C++</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 282: Line 296:
 
<p>
 
<p>
 
<ul>
 
<ul>
−
<li>Idex P-420 Super Flangeless Female Nut PEKK Natural for 1/16 (<a href="https://www.idex-hs.com/super-flangelesstm-female-nut-peek-natural-for-1-16.html">link</a>)</li>
+
<li>Idex P-420 Super Flangeless Female Nut PEKK Natural for 1/16" OD (<a href="https://www.idex-hs.com/super-flangelesstm-female-nut-peek-natural-for-1-16.html">link</a>)</li>
 
<li>Idex P-259 Super Flangeless Ferrule w/SST Ring, Tefzel (ETFE), 1/4-28 Flat-Bottom, for 1/16" OD (<a href="https://www.idex-hs.com/super-flangelesstm-ferrule-w-sst-ring-tefzelr-etfe-10-32-flat-bottom-for-1-16-od.html">link</a>)</li>
 
<li>Idex P-259 Super Flangeless Ferrule w/SST Ring, Tefzel (ETFE), 1/4-28 Flat-Bottom, for 1/16" OD (<a href="https://www.idex-hs.com/super-flangelesstm-ferrule-w-sst-ring-tefzelr-etfe-10-32-flat-bottom-for-1-16-od.html">link</a>)</li>
 
<li>Idex XP-286 Flangeless Fitting Headless, PEEK, Natural, 1/4-28 Flat-Bottom, for 1/16" OD (<a href="https://www.idex-hs.com/flangeless-fitting-headless-peek-natural-1-4-28-flat-bottom-for-1-16-od.html">link</a>)</li>
 
<li>Idex XP-286 Flangeless Fitting Headless, PEEK, Natural, 1/4-28 Flat-Bottom, for 1/16" OD (<a href="https://www.idex-hs.com/flangeless-fitting-headless-peek-natural-1-4-28-flat-bottom-for-1-16-od.html">link</a>)</li>
Line 289: Line 303:
 
<br/>
 
<br/>
  
−
<h3 style="color:red">Assembly</h3>
+
<h3 style="color:red">Assembly and Bill of Material</h3>
−
<p>
+
<!--<div class="imageContainer">
−
...
+
<img width="100%" height="100%" src="https://static.igem.org/mediawiki/2015/d/d2/Team_Sherbrooke_Single_Assembly.PNG" /><br/>
−
</p>
+
<p>Single Channel Pipette Assembly and BOM</p>
 +
</div>
 +
<br>
 +
<div class="imageContainer">
 +
<img width="100%" height="100%" src="https://static.igem.org/mediawiki/2015/d/d2/Team_Sherbrooke_Single_Assembly.PNG" /><br/>
 +
<p>Multi-Channel Pipette Assembly and BOM</p>
 +
</div>-->
 
<br/>
 
<br/>
 
<br/>
 
<br/>
Line 300: Line 320:
 
<h2 class="subTitle">Gripper</h2>
 
<h2 class="subTitle">Gripper</h2>
 
<hr/>
 
<hr/>
 +
<div class="imageContainer">
 +
<img width="50%" src="https://static.igem.org/mediawiki/2015/9/90/Team_Sherbrooke_3D_Gripper.png" /><br/>
 +
<p>Gripper</p>
 +
</div>
 +
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
The finger-like gripper is design to allow the handling of lab-ware around the work area. It can moves tubes, micro-plate and different type of boxes such as pipette tip box around as needed. The gripper is fixed to one of the three z-axis of the tool holder. It can therefore be used independently of the other tools on the holder. The gripper is first composed of a Dual Gripper Kit from <a href="http://www.crustcrawler.com/">Crust Crawler Robotics</a>. This kit uses two <a href="http://www.trossenrobotics.com/">Trossen Robotics'</a> Dynamixel AX-12A servomotors for the finger-like motion. We then added a third AX-12A servo to give the gripper wrist-like capabilities, adding flexion and extension movement. Lastly, a MX-12W servo was also added so the gripper can rotate around a vertical axis on 360°.
+
The finger-like gripper is design to allow the handling of lab-ware around the work area. It can moves tubes, micro-plate and different type of containers or boxes such as pipette tip box around as needed. The gripper is fixed to one of the three z-axis of the tool holder. It can therefore be used independently of the other tools on the holder. The gripper first consists of a Dual Gripper Kit obtained from <a href="http://www.crustcrawler.com/">Crust Crawler Robotics</a>. This kit uses two <a href="http://en.robotis.com/">Robotis'</a> Dynamixel AX-12A servomotors for the finger-like motion. We then added a third AX-12A servo to give the gripper wrist-like capabilities, adding flexion and extension movement. Lastly, a MX-12W servo was also added so the gripper can rotate around a vertical axis on 360°.
 
</p>
 
</p>
 
<p>
 
<p>
−
This gripper kit was chosen because it uses Trossen Robotics' Dynamixel servomotors. Those servos are easy to control and their precision in movement allowed us to fall within the specification we needed for our gripper. They offer various options to monitor and use different operating values of the servo even during live operation, allowing us to use them at our will to control the gripping function of our platform. The most useful Dynamxiel's control function is the torque limit that we can set to a custom value corresponding to the object we desire to grip. Also, the MX-12W was chosen for the gripper rotation because the angle of the servo can be monitored over 360°, unlike AX-12A Dynamixel which can only be monitored from -150° to 150°. The servos assembly gives the gripper the ability to take narrow objects as well as wider ones, and it can grip them from top or from the side. It can also rotate on 360°. The gripper is controlled by a dedicated BananaBoard.
+
This gripper kit was chosen because it uses Robotis' Dynamixel servomotors. Those servos are easy to control and their precision in movement allows the gripper to access almost any components. They offer various options to monitor and use different operating values of the servo even during live operation, allowing us to use them at our will to control the gripping function of our platform. The most useful Dynamxiel's control function is the torque limit that we can set to a custom value corresponding to the object we desire to grip. Also, the MX-12W was chosen for the gripper rotation because the angle of the servo can be monitored over 360°, unlike AX-12A Dynamixel which can only be monitored from -150° to 150°. The servos assembly gives the gripper the ability to take narrow objects as well as wider ones, and it can grip them from top or from the side. It can also rotate on 360°. The gripper is controlled by a dedicated BananaBoard.
 
</p>
 
</p>
 
<br/>
 
<br/>
Line 318: Line 343:
 
<tr>
 
<tr>
 
<td>Dimensions</td>
 
<td>Dimensions</td>
−
<td style="color:red">258 mm x 75 mm x 97 cm</td>
+
<td>258 mm x 75 mm x 97 cm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
Line 366: Line 391:
 
<tr>
 
<tr>
 
<td>Language</td>
 
<td>Language</td>
−
<td style="color:red">C++</td>
+
<td>C++</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 397: Line 422:
 
<h2 class="subTitle">Centrifuge</h2>
 
<h2 class="subTitle">Centrifuge</h2>
 
<hr/>
 
<hr/>
 +
<div class="imageContainer">
 +
<img width="50%" src="https://static.igem.org/mediawiki/2015/c/c3/Team_Sherbrooke_3D_Centrifuge.PNG" /><br/>
 +
<p>Centrifuge</p>
 +
</div>
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
Centrifugation operations are often required for protocols in cellular biology lab. Our client therefore asked us to design an automated centrifuge that can be operated with the platform and the gripper.  
+
Centrifugation operations are often required for protocols in molecular biology labs and that is why we wanted to build a custom automated centrifuge that can be operated with the platform and the gripper.  
 
</p>
 
</p>
 
<p>
 
<p>
−
The centrifuge is able to fit up to eight 1.5mL tubes and up to four 5mL tubes. The rotating plate, which hold the tubes, is fabricated with polyoxymethylene, a lightweight and strong thermoplastic. It is coupled on a Quanum MT series 2208 brush-less DC motor. Such motors offer high rotation speed and compact size, two characteristics profitable for the whole design. Tube slots allow tube to be vertical when resting, to ease manipulation with the gripper, and force tube to tilt to a 45° angle during centrifugation. To detect high vibrations, a warning of potential problems during run-time, an accelerometer is added to the module. The centrifuge is equipped with an automated lid which is secured by a lock mechanism during running time. Because the lid only opens over one tube slot, we need to rotate the plate from slot to slot when the centrifuge is being loaded by the gripper. To do so, a magnetic sensor is positioned on the axis of rotation so the absolute angular position is known. That way, it is possible to rotate the plate to place a tube slot under the opening in the lid so the gripper can load and unload tubes. And of course, the whole centrifuge case is built with a sturdy construction, using material such as X and Y to prevent any external damage should there be any internal problems. The centrifuge is controlled by a dedicated BananaBoard.
+
The centrifuge is able to fit up to eight 1.5 ml tubes and up to four 5 ml tubes. The rotating plate, which hold the tubes, is made of polyoxymethylene, a lightweight and strong thermoplastic. It is coupled on a Quanum MT series 2208 brush-less DC motor. Such motors offer high rotation speed and compact size, two characteristics important for the whole design. Swinging bucket tube holders allow tube to be in a vertical position when resting, to ease manipulation with the gripper, and force tube to tilt to a 45° angle during centrifugation so the pellet forms at the bottom of the tube and not on the side. To detect high vibrations, a warning of potential problems during run-time, an accelerometer is added to the module and stops the centrifuge if needed to prevent any accident. The centrifuge is equipped with an automated lid which is secured by a lock mechanism during running time. Because the lid only opens over one tube slot, we need to rotate the plate from slot to slot when the centrifuge is being loaded by the gripper. To do so, a magnetic sensor is positioned on the axis of rotation so the absolute angular position is known. That way, it is possible to rotate the plate to place a tube slot under the opening in the lid so the gripper can load and unload tubes. The magnetic sensor is also use to measure the rotation speed of the centrifuge. And of course, the whole centrifuge case is built with a sturdy construction, using material such as aluminum and polycarbonate to prevent any external damage should there be any internal problems. The centrifuge is controlled by a dedicated BananaBoard.
 
</p>
 
</p>
 
<br/>
 
<br/>
Line 414: Line 443:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
−
<td>Dimensions (Length x Width x Heigth)</td>
+
<td>Dimensions (Length x Width x Height)</td>
−
<td style="color:red">À valider Xmm x Ymm x Ymm</td>
+
<td>209 mm x 209 mm x 182 mm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
 
<td>Rotation Speed</td>
 
<td>Rotation Speed</td>
−
<td>X rpm</td>
+
<td>16 500 rpm</td>
 
</tr>
 
</tr>
 
<tr>
 
<tr>
Line 438: Line 467:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
−
<td>Servos' input voltage</td>
+
<td>Motor's input voltage</td>
 
<td>12V</td>
 
<td>12V</td>
 
</tr>
 
</tr>
Line 451: Line 480:
 
<tr>
 
<tr>
 
<td>Language</td>
 
<td>Language</td>
−
<td style="color:red">C++</td>
+
<td>C++</td>
 
</tr>
 
</tr>
 
</table>
 
</table>
Line 471: Line 500:
 
<br/>
 
<br/>
  
−
<span id="MC96"> &nbsp; </span>
+
<span id="MC15"> &nbsp; </span>
−
<h2 class="subTitle">Magneto Caloric 96 (MC96)</h2>
+
<h2 class="subTitle">Magneto Caloric 1.5 (MC1.5)</h2>
 
<hr/>
 
<hr/>
 
<h3>Description</h3>
 
<h3>Description</h3>
−
<p>
 
 
<div class="imageContainer">
 
<div class="imageContainer">
−
<img height="75%" width="75%"src="https://static.igem.org/mediawiki/2015/b/b3/Sherbrooke_MC96_3D.png" /><br/>
+
<img width="50%" src="https://static.igem.org/mediawiki/2015/5/56/Team_Sherbrooke_3D_MC15.png" /><br/>
−
<p>MC96 3D Plan</p>
+
<p>MC1.5 3D Plan</p>
 
</div>
 
</div>
  
−
<p>
+
</br>
−
This module is called Magneto Caloric 96 (MC96) because it has to manage magnetism and temperature cycling (caloric) of a 96-well plate. The main use of the MC96 is to apply a specific temperature on different liquids (e.g. cell cultures) in the context of biological research.  
+
<a href="https://static.igem.org/mediawiki/2015/3/30/Sherbrooke_MC1.5_SolidWorks_File.zip">Download SolidWorks File</a>
−
</p>
+
</br>
  
 
<p>
 
<p>
−
The module has the possibility to concentrate particles in a solutions by applying an electromagnetic field that will bring particles on the wall of the well. This is explained by the magnetic attraction of microscopic magnetic beads to which particles are agglomerated. The beads are to be introduced into the well during the procedure and this can also be automated.
+
The other module that can control temperature and magnetic field is called Magneto Caloric 1.5 (MC1.5) and has the same functionalities as the MC96, but for tubes containing an amount of liquid as high as 1.5mL, which is more than the capacity of a MC96 well. The MC1.5 consists of two independent sub-modules. So, each sub-module could have its own sequence.  
 
</p>
 
</p>
−
 
−
<p>
 
−
To apply the electromagnetic field, neodymium magnets are moved to the side of the wells. To do so, the magnets are assembled in a frame that is moved by a linear actuator. So, when the actuator raises the frame, the magnets are moved near the wells and the beads are brought on the well’s wall. 
 
−
</p>
 
−
To implement thermal cycling, a Peltier element is used because it can heat or cool the 96-well plate depending on the current’s direction. A heat sink is stick to the other side of the Peltier element to eliminate the heat produced by it. The fan is used to create a forced convection, thus increasing the efficiency of the heat sink.
 
−
</p>
 
−
 
 
<br/>
 
<br/>
 
<h3>Specifications</h3>
 
<h3>Specifications</h3>
−
<p>
+
 
−
These characteristics are the specifications required by the client or part’s characteristics because no prototype has been built yet.
+
−
</p>
+
 
<h4>Thermal</h4>
 
<h4>Thermal</h4>
 
<table>
 
<table>
Line 508: Line 527:
 
     <tr>
 
     <tr>
 
         <td>Range</td>
 
         <td>Range</td>
−
         <td>4 to 80&#176;C</td>
+
         <td>Achieved 4 to 80&#176;C</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Precision</td>
 
         <td>Precision</td>
−
         <td>&plusmn;1.5&#176;C</td>
+
         <td>Achieved &plusmn;1.5&#176;C</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Heating speed</td>
 
         <td>Heating speed</td>
−
         <td>0.5-1&#176;C&#47;s</td>
+
         <td>Achieved 1.81&#176;C&#47;s</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Cooling speed</td>
 
         <td>Cooling speed</td>
−
         <td>0.5-1&#176;C&#47;s </td>
+
         <td>Achieved 0.5&#176;C&#47;s </td>
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 532: Line 551:
 
     <tr>
 
     <tr>
 
         <td>Material</td>
 
         <td>Material</td>
−
         <td><strong>96-well mold : </strong> Aluminium </br> <strong>Frames and Module base : </strong> Plastic</td>
+
         <td><strong>1.5ml test tube mold : </strong> Aluminium </br> <strong>Frames and Module base : </strong> Plastic</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Dimensions</td>
 
         <td>Dimensions</td>
−
         <td style="color:red">Width x Length x Heigth cm</td>
+
         <td>8.5cm x 12.8cm x 22 cm</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 560: Line 579:
 
     <tr>
 
     <tr>
 
         <td>Maximal power consumption</td>
 
         <td>Maximal power consumption</td>
−
         <td>&#8776;800 Watts</td>
+
         <td>&#8776;400 Watts</td>
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 579: Line 598:
 
<h3>Parts list</h3>
 
<h3>Parts list</h3>
 
<p>
 
<p>
−
...
+
<a href="https://static.igem.org/mediawiki/2015/f/fe/Sherbrooke_MC1.5_BOM_V2.pdf">Download Bill of Material File</a>
 
</p>
 
</p>
−
<br/>
 
  
−
<h3>Assembly</h3>
 
−
<p>
 
−
...
 
−
</p>
 
 
<br/>
 
<br/>
 
<br/>
 
<br/>
Line 592: Line 606:
 
<br/>
 
<br/>
  
−
<span id="MC15"> &nbsp; </span>
+
<span id="TAC"> &nbsp; </span>
−
<h2 class="subTitle">Magneto Caloric 1.5 (MC1.5)</h2>
+
<h2 class="subTitle">Turbido Agitator Caloric (TAC)</h2>
 
<hr/>
 
<hr/>
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<div class="imageContainer">
 
<div class="imageContainer">
−
<img height="75%" width="75%"src="https://static.igem.org/mediawiki/2015/f/fc/Sherbrooke_MC1.5_3D.png" /><br/>
+
<img width="50%" src="https://static.igem.org/mediawiki/2015/e/e9/Team_Sherbrooke_3D_TAC.png" /><br/>
−
<p>MC1.5 3D Plan</p>
+
<p>TAC 3D Plan</p>
 
</div>
 
</div>
 +
 +
</br>
 +
<a href="https://static.igem.org/mediawiki/2015/b/b9/Sherbrooke_TAC_SolidWorks_File.zip">Download SolidWorks File</a>
 +
</br>
 
<p>
 
<p>
−
The other module that can control temperature and megnetic field is called Magneto Caloric 1.5 (MC1.5) and has the same functionalities as the MC96, but for tubes containing an amount of liquid as high as 1.5mL, which is more than the capacity of a MC96 well. The MC1.5 is composed of two independent sub-modules. So, each sub-module could have its own sequence.  
+
The main function of this module is to grow cell culture in a 25mm test tube. To do so, the module must regulate the tube temperature, be able to agitate the liquid and to measure the amount of cells in the culture. The TAC module enables the automation of repetitive steps that are performed on a daily basis in laboratories around the world. It can be reprogrammed to meet specifications of different protocols for molecular biology or microbiology experiments.  
 
</p>
 
</p>
−
<br/>
+
 
−
<h3>Specifications</h3>
+
<p>
 +
One possible application of the TAC module would be the insertion of DNA into a micro-organism. This manipulation requires the growth of the micro-organism at the optimal temperature until a specific optical density is reached. This is required for the observed colony to enter its stationary phase as we can observe in the following figure.
 +
</p>
 +
 
 +
<p>
 +
<div class="imageContainer">
 +
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/6/6c/Sherbrooke_Cell_Culture_Phase.png" /><br/> <p>Cell density of a culture vs time</p>
 +
</div>
 +
</p>
 +
 
 +
<p>
 +
Once the optical density has been reached, the cells have to be washed a couple times to eliminate the residual growing media. Afterwards, the DNA is added to the mix and the cells are perforated to allow its transfer. This stressful operation kills most of them. Therefore, we have to replicate them quickly in a proper medium and at the right temperature.
 +
</p>
 +
 
 +
<p>
 +
To regulate the temperature between 0 and 37°C, a Peltier element is used because it can heat or cool the tube depending on the current’s direction. An heat sink is stick to the other side of the Peltier element to eliminate the heat produced by the Peltier element. The fan is used to create a forced convection, thus increasing the efficiency of the heat sink.
 +
</p>
 +
 
 +
<p>
 +
To agitate the liquid, the same principle as a magnetic stirrer is used. First, a magnetic stirrer bar must be inserted into the test tube. Then, a magnet stuck on a DC motor attracted the magnetic stirrer bar. So, when the DC motor rotates the magnetic stirrer bar inside the test tube rotates at the same speed and thus, agitating the liquid.
 +
</p>
 +
 
 
<p>
 
<p>
−
These characteristics are the specifications required by the client or parts’ characteristics because no prototype have not been completed yet.
+
To measure the amount of cells in the culture, a system has previously been developed by the lab of professor Rodrigue. This system used the transmittance of the liquid to measure the amount of cells in a 25mm test tube. To measure it, a LED (light-emitting diode) is placed on one side of the test tube and a photodiode is placed on the other side. The LED blinks and this blink is received on the photodiode, generating a square signal as shown in the folowing Figure.  
 
</p>
 
</p>
 +
 +
<p>
 +
<div class="imageContainer">
 +
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/a/ae/Sherbrooke_TAC_Turbidity_Input_Signal.png" /><br/><p>Photodiode signal voltage vs time</p>
 +
</div>
 +
</p>
 +
 +
<p>
 +
The amplitude difference between the signal high and the signal low increase as the transmittance increased and decreased as the transmittance decreased. A calibration graph has been calculated and is shown in the folowing Figure.
 +
</p>
 +
 +
<p>
 +
<div class="imageContainer">
 +
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/4/47/Sherbrooke_Optical_density_vs_Amplitude_difference.png" /><br/><p>Optical density vs Amplitude difference</p>
 +
</div>
 +
</p>
 +
<br/>
 +
 +
<h3>Specifications</h3>
 
<h4>Thermal</h4>
 
<h4>Thermal</h4>
 
<table>
 
<table>
Line 616: Line 674:
 
     <tr>
 
     <tr>
 
         <td>Range</td>
 
         <td>Range</td>
−
         <td>Achieved 4 to 80&#176;C</td>
+
         <td>0 to 37&#176;C</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Precision</td>
 
         <td>Precision</td>
−
         <td>Achieved &plusmn;1.5&#176;C</td>
+
         <td>&plusmn;1.5&#176;C</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Heating speed</td>
 
         <td>Heating speed</td>
−
         <td>Achieved 1&#176;C&#47;s</td>
+
         <td>Achieved 1.2&#176;C&#47;s</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Cooling speed</td>
 
         <td>Cooling speed</td>
−
         <td>Achieved 0.5&#176;C&#47;s </td>
+
         <td>Achieved 0.3&#176;C&#47;s if tube temperature above room temperature </br>Achieved 0.21&#176;C&#47;s if tube temperature below room temperature</td>
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 640: Line 698:
 
     <tr>
 
     <tr>
 
         <td>Material</td>
 
         <td>Material</td>
−
         <td><strong>1.5ml test tube mold : </strong> Aluminium </br> <strong>Frames and Module base : </strong> Plastic</td>
+
         <td><strong>25mm test tube mold : </strong> Aluminium </br> <strong>Frames and Module base : </strong> Plastic</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
         <td>Demensions</td>
+
         <td>Dimensions</td>
−
         <td style="color:red">Width x Length x Heigth cm</td>
+
         <td>8.5cm x 12.8cm x 21.8cm</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
         <td>Linear actuator speed</td>
+
         <td>DC motor speed</td>
−
         <td>12mm&#47;s</td>
+
         <td>60 to 600 rpm</td>
−
    </tr>
+
−
    <tr>
+
−
        <td>Linear actuator stroke</td>
+
−
        <td>2cm </td>
+
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 669: Line 723:
 
         <td>Maximal power consumption</td>
 
         <td>Maximal power consumption</td>
 
         <td>&#8776;400 Watts</td>
 
         <td>&#8776;400 Watts</td>
 +
    </tr>
 +
    <tr>
 +
        <td>Turbidity measurement precision </td>
 +
        <td>&plusmn;5&#37; from a reference turbidimeter</td>
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 687: Line 745:
 
<h3>Parts list</h3>
 
<h3>Parts list</h3>
 
<p>
 
<p>
−
...
+
<a href="https://static.igem.org/mediawiki/2015/d/d7/Sherbrooke_TAC_BOM_V2.pdf">Download Bill of Material File</a>
−
</p>
+
−
<br/>
+
−
 
+
−
<h3>Assembly</h3>
+
−
<p>
+
−
...
+
 
</p>
 
</p>
 
<br/>
 
<br/>
Line 700: Line 752:
 
<br/>
 
<br/>
  
−
<span id="TAC"> &nbsp; </span>
+
<span id="MC96"> &nbsp; </span>
−
<h2 class="subTitle">Turbido Agitator Caloric (TAC)</h2>
+
<h2 class="subTitle">Magneto Caloric 96 (MC96)</h2>
 
<hr/>
 
<hr/>
 
<h3>Description</h3>
 
<h3>Description</h3>
−
<div class="imageContainer">
 
−
<img height="75%" width="75%"src="https://static.igem.org/mediawiki/2015/archive/2/26/20150912145815!Sherbrooke_TAC_3D.png" /><br/>
 
−
<p>TAC 3D Plan</p>
 
−
</div>
 
−
 
−
<p>
 
−
The main function of this module is to grow cell culture in a 25mm test tube. To do so, the module must regulate the tube temperature, be able to agitate the liquid and to measure the amount of cells in the culture. The TAC module enables the automation of repetitive steps that are performed on a daily basis in laboratories around the world. It can be reprogrammed to meet specifications of different protocols for molecular biology or microbiology experiments.
 
−
</p>
 
−
 
−
<p>
 
−
One possible application of the TAC module would be the insertion of DNA into a micro-organism. This manipulation requires the growth of the micro-organism at the optimal temperature until a specific optical density is reached. This is required for the observed colony to enter its stationary phase as we can observe in the following figure.
 
−
</p>
 
−
 
 
<p>
 
<p>
 
<div class="imageContainer">
 
<div class="imageContainer">
−
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/6/6c/Sherbrooke_Cell_Culture_Phase.png" /><br/> <p>Cell density of a culture vs time</p>
+
<img width="50%" src="https://static.igem.org/mediawiki/2015/8/85/Team_Sherbrooke_3D_MC96.png" /><br/>
 +
<p>MC96 3D Plan</p>
 
</div>
 
</div>
−
</p>
 
  
−
<p>
+
</br>
−
Once the optical density has been reached, the cells have to be washed a couple times to eliminate the residual growing media. Afterwards, the DNA is added to the mix and the cells are perforated to allow its transfer. This stressful operation kills most of them. Therefore, we have to replicate them quickly in a proper medium and at the right temperature.
+
<a href="https://static.igem.org/mediawiki/2015/0/08/Sherbrooke_MC96_SolidWorks_File.zip">Download SolidWorks File</a>
−
</p>
+
</br>
  
 
<p>
 
<p>
−
To regulate the temperature between 0 and 37°C, a Peltier element is used because it can heat or cool the tube depending on the current’s direction. An heat sink is stick to the other side of the Peltier element to eliminate the heat produced by the Peltier element. The fan is used to create a forced convection, thus increasing the efficiency of the heat sink.
+
This module is called Magneto Caloric 96 (MC96) because it has to manage magnetism and temperature cycling (caloric) of a 96-well plate. The main use of the MC96 is to apply a specific temperature on different liquids (e.g. cell cultures) in the context of biological research.  
 
</p>
 
</p>
  
 
<p>
 
<p>
−
To agitate the liquid, the same principle as a magnetic stirrer is used. First, a magnetic stirrer bar must be inserted into the test tube. Then, a magnet stuck on a DC motor attracted the magnetic stirrer bar. So, when the DC motor rotates the magnetic stirrer bar inside the test tube rotates at the same speed and thus, agitating the liquid.  
+
The module has the possibility to concentrate particles in a solutions by applying an electromagnetic field that will bring particles on the wall of the well. This is explained by the magnetic attraction of microscopic magnetic beads to which particles are agglomerated. The beads are to be introduced into the well during the procedure and this can also be automated.
 
</p>
 
</p>
  
 
<p>
 
<p>
−
To measure the amount of cells in the culture, a system has previously been developed by the lab of professor Rodrigue. This system used the transmittance of the liquid to measure the amount of cells in a 25mm test tube. To measure it, a LED (light-emitting diode) is placed on one side of the test tube and a photodiode is placed on the other side. The LED blinks and this blink is received on the photodiode, generating a square signal as shown in the folowing Figure.  
+
To apply the electromagnetic field, neodymium magnets are moved to the side of the wells. To do so, the magnets are assembled in a frame that is moved by a linear actuator. So, when the actuator raises the frame, the magnets are moved near the wells and the beads are brought on the well’s wall.
 
</p>
 
</p>
−
 
+
To implement thermal cycling, a Peltier element is used because it can heat or cool the 96-well plate depending on the current’s direction. A heat sink is stick to the other side of the Peltier element to eliminate the heat produced by it. The fan is used to create a forced convection, thus increasing the efficiency of the heat sink.
−
<p>
+
−
<div class="imageContainer">
+
−
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/a/ae/Sherbrooke_TAC_Turbidity_Input_Signal.png" /><br/><p>Photodiode signal voltage vs time</p>
+
−
</div>
+
 
</p>
 
</p>
  
 +
<br/>
 +
<h3>Specifications</h3>
 
<p>
 
<p>
−
The amplitude difference between the signal high and the signal low increase as the transmittance increased and decreased as the transmittance decreased. A calibration graph has been calculated and is shown in the folowing Figure.
+
These characteristics are the desired specifications or part’s characteristics because no prototype has been built yet.
 
</p>
 
</p>
−
 
−
<p>
 
−
<div class="imageContainer">
 
−
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/4/47/Sherbrooke_Optical_density_vs_Amplitude_difference.png" /><br/><p>Optical density vs Amplitude difference</p>
 
−
</div>
 
−
</p>
 
−
<br/>
 
−
 
−
<h3>Specifications</h3>
 
 
<h4>Thermal</h4>
 
<h4>Thermal</h4>
 
<table>
 
<table>
Line 765: Line 793:
 
     <tr>
 
     <tr>
 
         <td>Range</td>
 
         <td>Range</td>
−
         <td>0 to 37&#176;C</td>
+
         <td>4 to 80&#176;C</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 773: Line 801:
 
     <tr>
 
     <tr>
 
         <td>Heating speed</td>
 
         <td>Heating speed</td>
−
         <td>Achieved 1.2&#176;C&#47;s</td>
+
         <td>0.5-1&#176;C&#47;s</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Cooling speed</td>
 
         <td>Cooling speed</td>
−
         <td>Achieved 0.3&#176;C&#47;s if tube temperature above room temperature </br>Achieved 0.21&#176;C&#47;s if tube temperature below room temperature</td>
+
         <td>0.5-1&#176;C&#47;s </td>
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 789: Line 817:
 
     <tr>
 
     <tr>
 
         <td>Material</td>
 
         <td>Material</td>
−
         <td><strong>25mm test tube mold : </strong> Aluminium </br> <strong>Frames and Module base : </strong> Plastic</td>
+
         <td><strong>96-well mold : </strong> Aluminium </br> <strong>Frames and Module base : </strong> Plastic</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
         <td>Demensions</td>
+
         <td>Dimensions</td>
−
         <td style="color:red">Width x Length x Heigth cm</td>
+
         <td>12.8cm x 13.34cm x 18.43cm</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
         <td>DC motor speed</td>
+
         <td>Linear actuator speed</td>
−
         <td>60 to 600 rpm</td>
+
         <td>12mm&#47;s</td>
 +
    </tr>
 +
    <tr>
 +
        <td>Linear actuator stroke</td>
 +
        <td>2cm </td>
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 813: Line 845:
 
     <tr>
 
     <tr>
 
         <td>Maximal power consumption</td>
 
         <td>Maximal power consumption</td>
−
         <td>&#8776;400 Watts</td>
+
         <td>&#8776;800 Watts</td>
−
    </tr>
+
−
    <tr>
+
−
        <td>Turbidity measurement precision </td>
+
−
        <td>&plusmn;5&#37; from a reference turbidimeter</td>
+
 
     </tr>
 
     </tr>
 
</table>
 
</table>
Line 834: Line 862:
 
<br/>
 
<br/>
  
−
<h3>Parts list</h3>
 
−
<p>
 
−
...
 
−
</p>
 
−
<br/>
 
  
−
<h3>Assembly</h3>
+
 
−
<p>
+
−
...
+
−
</p>
+
−
<br/>
+
 
<br/>
 
<br/>
 
<a href="#top_menu_under">Back to top</a>
 
<a href="#top_menu_under">Back to top</a>
Line 852: Line 871:
 
<h2 class="subTitle">BananaBoard</h2>
 
<h2 class="subTitle">BananaBoard</h2>
 
<hr/>
 
<hr/>
 +
<div class="imageContainer">
 +
<img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/8/8f/Team_Sherbrooke_Banana_Board_2.png"/><img height="50%" width="50%" src="https://static.igem.org/mediawiki/2015/5/50/Team_Sherbrooke_Banana_Board.png"/><br/><p>BananaBoard Top and Bottom view</p>
 +
</div>
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
With so many different independent modules, it would have been a real struggle to design a Printed Circuit Board (PCB) for each of them. Yet, when you compare modules to each other, you can notice that there are similarities between them. We therefore decided to design a single PCB (that we named BananaBoard) that has all the electrical and software capabilities to supply every modules individually. Yet, the PCB is still functional even if some component are not soldered on it. For example, the BananaBoard has a 24V output connectors. The gripper doesn't need this electrical supply but the MC1.5 and the TAC need it. So the component for this output will not be soldered on the PCB for the gripper, but they will be for the MC1.5 and the TAC's PCB. This allowed us to save design time and reduce complexity during the PCB assembly and debugging.
+
With so many different independent modules, it would have been a real struggle to design a Printed Circuit Board (PCB) for each of them. Yet, when you compare modules to each other, you can notice that there are similarities between them. We therefore decided to design a single PCB (that we named BananaBoard) that has all the electrical and software capabilities to supply every modules individually. The components soldered on te BananaBoard depend on the module interfaced with the PCB. For example, the BananaBoard has a 24V output connectors. The gripper doesn't need this electrical supply but the MC1.5 and the TAC need it. So the component for this output will not be soldered on the PCB for the gripper, but they will be for the MC1.5 and the TAC's PCB. This allowed us to save design time and reduce complexity during the PCB assembly and debugging. The BananaBoard is also versatile enough so it could be used if new modules are design or if existing equipment from third party must be integrated on the platform.
 
</p>
 
</p>
 
<br/>
 
<br/>
Line 878: Line 900:
 
     <tr>
 
     <tr>
 
         <td>Input voltage</td>
 
         <td>Input voltage</td>
−
         <td style="color:red">24V</td>
+
         <td>12-24 V</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
 
         <td>Output voltages</td>
 
         <td>Output voltages</td>
−
         <td><strong>12-24V / 60A:</strong> Half H-Bridges and Stepper Motors<br/>
+
         <td><strong>12-24 V / 60 A:</strong> Half H-Bridges and Stepper Motors<br/>
−
<strong>5V / 1A:</strong> Logic Circuit, LED, Sensors<br/>
+
<strong>5 V / 1 A:</strong> Logic Circuit, LED, Sensors<br/>
−
<strong>3.3V / 100mA:</strong> Accelerometer</td>
+
<strong>3.3 V / 100 mA:</strong> Accelerometer</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 929: Line 951:
 
<br/>
 
<br/>
  
−
<span id="Controller"> &nbsp; </span>
+
<span id="ControllerInterface"> &nbsp; </span>
−
<h2 class="subTitle">Controller</h2>
+
<h2 class="subTitle">Controller Interface</h2>
 
<hr/>
 
<hr/>
 
<h3>Description</h3>
 
<h3>Description</h3>
 
<p>
 
<p>
−
...
+
The controller interface is used to control the platform as well
 +
as the modules installed on it. The controller interface is hosted
 +
on a PC connected to the platform via a USB to CAN converter.  
 +
The following figure shows the interface:
 
</p>
 
</p>
 
<br/>
 
<br/>
 +
<div class="imageContainer">
 +
<img height="100%" width="100%" src="https://static.igem.org/mediawiki/2015/c/c5/Sherbrooke_User_Interface.png" /><br/>
 +
<p>Controller Interface</p>
 +
</div>
 +
 +
<table>
 +
<tr>
 +
<th>#</th>
 +
<th>Close-up</th>
 +
<th>Desciption</th>
 +
</tr>
 +
<tr>
 +
<td>1</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/c/c2/Sherbooke_User_Interface_Menus_close_up.png" /><br/></th>
 +
<td><p>This is the menus of the interface. The <b>File</b> menu allows the user to
 +
import and save protocols, module definition, deck layout and more.
 +
The <b>Options</b> menu allows the user to is to modify and configure
 +
USB communication, platform and modules variable and more. </p></td>
 +
</tr>
 +
<tr>
 +
<td>2</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/b/bb/Sherbooke_User_Interface_Protocols_close_up.png" /><br/></th>
 +
<td><p>This is a list of selected protocols.
 +
This allows the user to start and stop the selected protocol.
 +
To add a protocol simply drag the protocol from <b>Steps</b> to <b>Protocols.</b></p></td>
 +
</tr>
 +
<tr>
 +
<td>3</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/7/7e/Sherbooke_User_Interface_Steps_close_up.png" /><br/></th>
 +
<td><p>This is a list of protocols that have been created or have been
 +
imported. A protocol is a collection of commands (steps) that can be sent
 +
to the platform. A protocol could also contain another protocol.
 +
For example, there is  protocol named <span style="background-color: #FFFF00">“Grow”</span>
 +
and another protocol named <span style="background-color: #00FFFF">“Pipetting”</span>.
 +
The user can then create a new protocol named <span style="background-color: #00FF00">“Grow and Pipetting”</span>
 +
containing <span style="background-color: #FFFF00">“Grow”</span> and <span style="background-color: #00FFFF">”Pipetting”</span>.
 +
It is possible to add a protocol by clicking on <b>Add</b>. </p></td>
 +
</tr>
 +
<tr>
 +
<td>4</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/8/8a/Sherbooke_User_Interface_Tools_close_up.png" /></th>
 +
<td><p>This is a list of available tools on the platform.
 +
This allows the user to edit the parameters of the modules
 +
present on the platform by clicking on <b>Edit</b>.
 +
The user can also access this feature in the <b>Options</b> menus.</p></td>
 +
</tr>
 +
<tr>
 +
<td>5</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/e/e9/Sherbrooke_User_Interface_Deck_close_up.png" /></th>
 +
<td><p>This is the deck layout. This allows the user to
 +
represent the actual position of different modules on the platform.
 +
To add a module on the deck, it has been planned to drag it from
 +
the tools list. </p></td>
 +
</tr>
 +
<tr>
 +
<td>6</td>
 +
<th><img height=auto width=50px src="https://static.igem.org/mediawiki/2015/6/67/Sherbrooke_User_Interface_Connection_close_up.png" /><br/></th>
 +
<td><p>This is the connection indicator. This allows the user to
 +
know whether or not the host PC is connected to the platform.</p></td>
 +
</tr>
 +
<tr>
 +
<td>7</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/0/0f/Sherbrooke_User_Interface_Labware_close_up.png" /><br/></th>
 +
<td><p>The is the labware list. This list allows the user to register
 +
all labware item, like 96-wells plate, 25mm test tube or pipette tips.</p></td>
 +
</tr>
 +
<tr>
 +
<td>8</td>
 +
<th><img height=auto width=200px src="https://static.igem.org/mediawiki/2015/8/81/Sherbrooke_User_Interface_Console_close_up.png" /><br/></th>
 +
<td><p>This is the console. The console allows the user to see
 +
every important events occurring on the platform. This also allows
 +
the user to directly send a message to the platform by typing it
 +
into the field under the log then click on the <b>Send</b> button.
 +
It is planned to implement this feature after the competition.</p></td>
 +
</tr>
 +
</table>
 +
  
 
<h3>Specifications</h3>
 
<h3>Specifications</h3>
−
<p>
 
−
...
 
−
</p>
 
 
<br/>
 
<br/>
  
−
<h3>Parts list</h3>
+
<h4>Software</h4>
−
<p>
+
<table>
−
...
+
    <tr>
−
</p>
+
        <th>Specification</th>
 +
        <th>Value</th>
 +
    </tr>
 +
    <tr>
 +
        <td>Language</td>
 +
        <td>C#</td>
 +
    </tr>
 +
</table>
 
<br/>
 
<br/>
  
−
<h3>Assembly</h3>
+
 
−
<p>
+
−
...
+
−
</p>
+
 
<br/>
 
<br/>
 
<br/>
 
<br/>
 
<a href="#top_menu_under">Back to top</a>
 
<a href="#top_menu_under">Back to top</a>
−
<br/>
 
−
 
−
<br/>
 
−
<hr/>
 
−
<span id="Primers"> &nbsp; </span>
 
−
<h2 class="subTitle">Primers</h2>
 
−
<head>
 
−
<style>
 
−
table {
 
−
    width:30%;
 
−
}
 
−
table, th, td {
 
−
    border: 1px solid black;
 
−
    border-collapse: collapse;
 
−
}
 
−
th, td {
 
−
    padding: 1px;
 
−
    text-align: left;
 
−
}
 
−
table#t01 tr:nth-child(even) {
 
−
    background-color: #fff;
 
−
}
 
−
table#t01 tr:nth-child(odd) {
 
−
  background-color:#A6D785;
 
−
}
 
−
table#t01 th {
 
−
    background-color: #009647;
 
−
    color: black;
 
−
}
 
−
</style>
 
−
</head>
 
−
 
−
<table id="t01">
 
−
  <tr>
 
−
    <th>Primer Name</th>
 
−
    <th>Primer sequence</th>
 
−
    <th>Annealing temperature</th>
 
−
    <th>Anneal to</th>
 
−
    <th>Goal</th>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>vcrx028-pBAD30-F</td>
 
−
    <td>TCTCCATACCCGTTTTTTTGGGCTAGCGTAGGAGGCAAAAATGTGGGTCATCGAGACAA</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 vcrx028</td>
 
−
    <td>Build pBAD30-vcrx028</td>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>vcrx028-pBAD30-R</td>
 
−
    <td>ACTCTAGAGGATCCCCGGGTACCGAGCTCGTCACTCCTTCTTCAATTTATCCAAG</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 vcrx028</td>
 
−
    <td>Build pBAD30-vcrx028</td>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>ccdB-pBAD30-F</td>
 
−
    <td>TCCATACCCGTTTTTTTGGGCTAGCGTAGGAGGCAAAAATGCAGTTTAAGGTTTACACCT</td>
 
−
    <td>50</td>
 
−
    <td>ptac-ccdb-casette(gBlock)</td>
 
−
    <td>Build pBAD30-ccdB</td>
 
−
 
−
  </tr>
 
−
  <tr>
 
−
    <td>ccdB-pBAD30-R</td>
 
−
    <td>ACTCTAGAGGATCCCCGGGTACCGAGCTCGTTATATTCCCCAGAACATCAGGT</td>
 
−
    <td>50</td>
 
−
    <td>ptac-ccdb-casette(gBlock)</td>
 
−
    <td>Build pBAD30-ccdB</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>mosT-pBAD30-F</td>
 
−
    <td>CCCGTTTTTTTGGGCTAGCGTAGGAGGCAAAAGTGAACAACATAATGGATAAAGATAGCC</td>
 
−
    <td>50</td>
 
−
    <td>pSXT</td>
 
−
    <td>Build pBAD30-mosT</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>mosT-pBAD30-R</td>
 
−
    <td>ACTCTAGAGGATCCCCGGGTACCGAGCTCGTTACTCGGCGTTTGCGTT</td>
 
−
    <td>50</td>
 
−
    <td>pSXT</td>
 
−
    <td>Build pBAD30-mosT</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>mazF-pBAD30-F</td>
 
−
    <td>TTCTCCATACCCGTTTTTTTGGGCTAGCGTAGGAGGCAAAAATGGTCTCACGCTATGTCC</td>
 
−
    <td>50</td>
 
−
    <td>gBlock-FG1</td>
 
−
    <td>Build pBAD30-mazF</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>mazF-pBAD30-R</td>
 
−
    <td>ACTCTAGAGGATCCCCGGGTACCGAGCTCGTTAGCCGATCAGGACATTAATTTTAG</td>
 
−
    <td>50</td>
 
−
    <td>gBlock-FG1</td>
 
−
    <td>Build pBAD30-mazF</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-KanR-del-F</td>
 
−
    <td>TTCTGTTGCCAGCATTTGGTCAAGAGTTCTTGCCATAACGGTGTAGGCTGGAGCTGCTTC</td>
 
−
    <td>55</td>
 
−
    <td>pKD3</td>
 
−
    <td>Remove vcrx028 from pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-KanR-del-R</td>
 
−
    <td>TTTTAGTCACATGACTACTTACTGACATTTCGGCCCCCATATGGGAATTAGCCATGGTCC</td>
 
−
    <td>55</td>
 
−
    <td>pKD3</td>
 
−
    <td>Remove vcrx028 from pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-del-F</td>
 
−
    <td>AGCAAGAGAAGTAATACGCCCCATAACGGGGCGTATCGAGATTGTCTGATTCGTTACCAA</td>
 
−
    <td>50</td>
 
−
    <td>pBAD30-vcrx028</td>
 
−
    <td>Remove vcrx027 (anti-toxin) and previous KanR from pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-del-R</td>
 
−
    <td>TTTTAGTCACATGACTACTTACTGACATTTCGGCCCCCATTCGAGTAAACTTGGTCTGACAG</td>
 
−
    <td>50</td>
 
−
    <td>pBAD30-vcrx028</td>
 
−
    <td>Remove vcrx027 (anti-toxin) and previous KanR from pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-28-clean-del-5'-F</td>
 
−
    <td>TCACTGGGTTTGGTACTTTC </td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 upstream vcrx027</td>
 
−
    <td>Clean deletion homology and cassette assembly</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-28-clean-del-5'-R</td>
 
−
    <td>TTTTAGTCACATGACTACTTACTGACATTTCGGCCCCCATCGATACGCCCCGTTATGGG</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 upstream vcrx027</td>
 
−
    <td>Clean deletion homology and cassette assembly</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-28-clean-del-3'-F</td>
 
−
    <td>GTATATGGGGCGACTGCACGTATGGGGGCCGAAATGTCAG</td>
 
−
    <td>55</td>
 
−
    <td>pVCR94 downstream vcrx028</td>
 
−
    <td>Clean deletion homology and cassette assembly</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-28-clean-del-3'-R</td>
 
−
    <td>CCTGTTGAATGCCAAGCGG</td>
 
−
    <td>55</td>
 
−
    <td>pVCR94 downstream vcrx028</td>
 
−
    <td>Clean deletion homology and cassette assembly</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-28-del-verif-F</td>
 
−
    <td>ACATTCCTGGGTTCAAAGC</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 vcrx027-28 region</td>
 
−
    <td>Deletion verification primer</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx027-28-del-verif-R</td>
 
−
    <td>
 
−
GATTATTTGCCCGCTCGTG
 
−
</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 vcrx027-28 region</td>
 
−
    <td>Deletion verification primer</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>pBAD30-vcrx028-igem-ship-F</td>
 
−
    <td>CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGCAATTGTCTGATTCGTTACC</td>
 
−
    <td>50</td>
 
−
    <td>pBAD30-vcrx028</td>
 
−
    <td>Build BBa_K1744000 + BBa_K1744002</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>pBAD30-vcrx028-igem-ship-R</td>
 
−
    <td>CTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTAGAGTAAACTTGGTCTGACAG</td>
 
−
    <td>50</td>
 
−
    <td>pBAD30-vcrx028</td>
 
−
    <td>Build BBa_K1744000</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>kanR-amilCP-igem-ship-F1</td>
 
−
    <td>CGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTTAGAAAAACTCATCGAGCA</td>
 
−
    <td>50</td>
 
−
    <td>pOK12 for KanR</td>
 
−
    <td>Build BBa_K1744001</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>kanR-amilCP-igem-ship-R1</td>
 
−
    <td>TGAAATTTCCATTGCACGCAAACCTGTGGTCGCCTAATAAATGAGCCATATTCAACGGGA</td>
 
−
    <td>50</td>
 
−
    <td>pOK12 for KanR</td>
 
−
    <td>Build BBa_K1744001</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>kanR-amilCP-igem-ship-F2</td>
 
−
    <td>TTATTAGGCGACCACAGGTT</td>
 
−
    <td>50</td>
 
−
    <td>gBlock_IGEM_2015_2</td>
 
−
    <td>Build BBa_K1744001</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>kanR-amilCP-igem-ship-R2</td>
 
−
    <td>CTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTTACAGCTAGCTCAGTCCT</td>
 
−
    <td>50</td>
 
−
    <td>gBlock_IGEM_2015_2</td>
 
−
    <td>Build BBa_K1744001</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-kan-amilCP-IGEM-ship-F1</td>
 
−
    <td>TTTCAAAGCTAGCATAATACCTAGGACTGAGCTAGCTGTAAACTAGAGGATCCCCGGGTA</td>
 
−
    <td>50</td>
 
−
    <td>pBAD30-vcrx028</td>
 
−
    <td>Build BBa_K1744002 plasmid + genomic cassette assembly</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-kan-amilCP-IGEM-ship-F2</td>
 
−
    <td>TTTACAGCTAGCTCAGTCCTAG</td>
 
−
    <td>50</td>
 
−
    <td>BBa_K1744001</td>
 
−
    <td>Build BBa_K1744002 plasmid + genomic cassette assembly</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-kan-amilCP-IGEM-ship-R2</td>
 
−
    <td>CTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTAGAAAAACTCATCGAGCA</td>
 
−
    <td>50</td>
 
−
    <td>BBa_K1744001</td>
 
−
    <td>Build BBa_K1744002</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>kanR-amilCP-lacZ-ins-F</td>
 
−
    <td>TTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGTTTACAGCTAGCTCAGTCCT</td>
 
−
    <td>50</td>
 
−
    <td>BBa_K1744001</td>
 
−
    <td>BBa_K1744001 insertion in lacZ</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>kanR-amilCP-lacZ-ins-R</td>
 
−
    <td>GGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGATTAGAAAAACTCATCGAGCA</td>
 
−
    <td>50</td>
 
−
    <td>BBa_K1744001</td>
 
−
    <td>BBa_K1744001 insertion in lacZ</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-kan-amilCP-lacZ-ins-F</td>
 
−
    <td>TTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGCAATTGTCTGATTCGTTACC</td>
 
−
    <td>50</td>
 
−
    <td>BBa_K1744002</td>
 
−
    <td>BBa_K1744002 insertion in lacZ</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>vcrx028-kan-amilCP-lacZ-ins-R</td>
 
−
    <td>GGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGATTAGAAAAACTCATCGAGCA</td>
 
−
    <td>50</td>
 
−
    <td>BBa_K1744002</td>
 
−
    <td>BBa_K1744002 insertion in lacZ</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>lacZ-homology-ext-F</td>
 
−
    <td>C*G*CGAAATACGGGCAGACATGGCCTGCCCGGTTATTATTATTTTTGACACCAGACCAACT</td>
 
−
    <td>55</td>
 
−
    <td>lacZ insertion cassette</td>
 
−
    <td>Insertion in lacZ homology extension</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>lacZ-homology-ext-R</td>
 
−
    <td>G*A*ATTCTCATGTTTGACAGCTTATCATCGGAGCTCCTGCACTGGATGGTGGCGCTGGATG</td>
 
−
    <td>55</td>
 
−
    <td>lacZ insertion cassette</td>
 
−
    <td>Insertion in lacZ homology extension</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>5'_pVCR94_del_verif_F</td>
 
−
    <td>ACATTCCTGGGTTCAAAGC</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 vcrx26 region</td>
 
−
    <td>Verification of the insertion of BBa_K1744000 in pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>3'_pVCR94_del_verif_R</td>
 
−
    <td>CATGACTACTTACTGACATTTCGGC</td>
 
−
    <td>50</td>
 
−
    <td>pVCR94 vcrx29 region</td>
 
−
    <td>Verification of the insertion of BBa_K1744000 in pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>5'_pVCR94_del_verif_R</td>
 
−
    <td>CGCCAGCAGTTAGGGATTAG</td>
 
−
    <td>55</td>
 
−
    <td>BBa_K1744000</td>
 
−
    <td>Verification of the insertion of BBa_K1744000 in pVCR94</td>
 
−
 
−
  </tr>
 
−
<tr>
 
−
    <td>3'_pVCR94_del_verif_F</td>
 
−
    <td>GGCGGATAAAGTTGCAGGAC</td>
 
−
    <td>55</td>
 
−
    <td>BBa_K1744000</td>
 
−
    <td>Verification of the insertion of BBa_K1744000 in pVCR94</td>
 
−
 
−
  </tr>
 
−
 
−
 
−
</table>
 
 
<br/>
 
<br/>
 
<hr/>
 
<hr/>

Latest revision as of 03:51, 19 September 2015

Hardware Design


Our robotic platform consists of many modules, each with their own design, specifications and functionalities. Each module is independent and can either be operated alone or in combination with other modules. The teamwork between every module is managed by the Main Administrator, which communicates and controls them via a CAN communication bus and custom controller boards created by our team, that we named "BananaBoard. Currently, the project comprises nine distinct modules: the platform, the tool holder, custom pipettes (one single and one multi-channel), the gripper, the centrifuge, and the turbido agitator caloric module for glass tube (TAC), the magneto caloric module for 1.5mL tube (MC1.5), and the magneto caloric module for 96-well plate (MC96). Most of our modules are controlled by our "BananaBoard". There is also a controller interface for the user so he can create and automate his protocols. The global architecture of the robotic platform is as follows:



BIOBOT: Global Project Architecture

In this page you will learn all there is to know about each module, whether it is for the electrical, mechanical or software design. Scroll down or choose one module in the following list to learn about it.

Modules

 

Platform

Description

The physical platform consists of everything related to the structure on which the movements take place. It also acts as the reference surface area for the labware and modules used during a protocol. It is equipped with motors and traction mechanisms for movement on the horizontal plane, as well as indicators to locate the home position of each axis. The top of the structure is a travelling bridge for a trolley with the tool holder attached to it. The movements and limit detection of the platform are supervised by an Arduino controller board with a Marlin Ramps 1.4 shield coded a custom firmware in it. The platform motors are driven in current by 2 MKS TB6600 V1.1. The robot does smooth and precise movements and gives feedback on its position on demand.


Robotic Platform

The frame is made up of aluminum extrusions. This material was selected due to its lightweightness, rather low cost, easy of manipulation, and simplicity to sterilize. When designing the platform, we sometimes created a first version of some parts using a 3D printer to validate our concept. After validation, most of those parts were replaced by a machined aluminum version.

Movements of the different axes are driven by stepper motors to perform translations of the travelling bridge and of the trolley. For movements relative to the horizontal plane, two NEMA 23 stepper motors, model 17HS3001-20B, were used. They offer fast speeds, while still being precise to 0.008 mm, which is useful to move the tools to a precise position without slowing down the whole process. They were also chosen because of their durability and reliability. Those two assets are significant since a lot of repetitive movements occur in the horizontal plane, which consequently deals with more wear and tear. These motors are coupled with an endless screw which makes the assembly move as the motors spin.


Specifications

Mechanical

Specification Value
Frame material Aluminum extrusions
Dimensions 160 cm x 120 cm x 130 cm
Motion mean Stepper motors coupled with endless screws
X axis movement precision 0.127 mm
X axis movement speed 0 to 500 mm/s
Y axis movement precision 0.127 mm
Y axis movement speed 0 to 500 mm/s

Electrical

Specification Value
Motors' input voltage 24V

Software

Specification Value
Language C++

Parts list

...


Assembly

...



Back to top
 

Tool Holder


Tool Holder Front View


Tool Holder Back View

Description

One of the main objective of the platform is to perform pipetting operations using different type of pipettes, namely, single-channel and multi-channel pipette. To hold and use them, a custom tool holder was designed and built. The holder is fixed on the trolley which is fixed on the travelling bridge. The tool holder has three independent C-Beam by OpenBuilds to perform movement along the vertical axis. The two first C-Beams are used for pipette and the third one is used for the gripper. Pipettes' C-Beams are equipped with a syringe holder, made of stepper motors to press or pull the syringe's piston and aslo to hold the BananaBoard. All the C-Beams' motors are controlled and driven in current like the platform's motor: with an Arduino controller board with a Marlin Ramps 1.4 shield which is programmed with our custom firmware in it.


Specifications

Mechanical

Specification Value
Frame material Aluminum extrusions
Dimensions X cm x X cm x X cm
Motion mean Stepper motors coupled with endless screws
Z axis movement precision 0.4 mm
Z axis movement speed 156 mm/s

Electrical

Specification Value
Motors' input voltage 24V

Software

Specification Value
Language C++

Parts list

  • 3x C-Beam Linear Rail, 500mm
    • 3x NEMA 23 Stepper Motor, Model: Motech Motor, MT-2303Hs280AW-0B, 1.8°/Step
    • 3x C shaped rails, 500mm
    • 3x Endless screw, 500mm
  • 2x XX Motor pour le pipettage


Assembly

...



Back to top
 

Pipettes


Single-Channel Pipette


Multi-Channel Pipette

Description

Pipetting is one of our platform major functionality. To do so, we designed custom pipette modules using syringes equipped with a versatile tip adapter capable of loading tips of different size (2&mul, 200&mul and 1000&mul) on the same adapter. This will give our pipette system more versatility. Using custom pipette modules has ease the design of the mechanical interface between our pipettes and the tool-holder. We designed a single-channel pipette as well as a multi-channel one (8 channels).

The system is somewhat simple. A custom support was designed and machined in aluminum pieces to hold the different parts of the whole pipette system. Starting at the bottom, a pipette tip is fixed on adapter. This adapter is needed because pipette tips are not design to fit on syringe and vice versa. Attached on top of the adapter is the syringe. The syringe piston is grabbed by a mechanical piece that is coupled on an endless screw, which is coupled on a stepper motor. As the motor spins, the piston moves in the syringe, and doing so, vacuuming the liquid in and out of the pipette tip. The amount of liquid in the pipette is known and controlled by the number of step the motor spins. The whole pipette assembly is then fixed on the tool-holder and is controlled by a BananaBoard.

The multi-channel pipette system has a minor difference, beside the number of syringe and tip of course. Because it was not possible to assemble the syringes close enough so they would fit the width of a standard 96-well plate, we had to add tubing between the syringe and the pipette tip adaptor. That way, the tip adaptor is close enough to fit a standard 96 tips box, and there is enough space to attach the larger syringes side-by-side. Take a look at the assembly section of the pipette to have a better idea of the system.

Specifications

Mechanical

Specification Value
Dimensions (Height Width x Depth) Single channel: 283 mm X 80 mm X 52 mm
Multi channel: 224.2 mm X 175 mm X 99 mm
Vacuuming range 0 to 1000 μl
Vacuuming precision 0.2 μl

Electrical

Specification Value
Stepper motor's input voltage 12V

Software

Specification Value
Language C++

Parts list

  • Idex P-420 Super Flangeless Female Nut PEKK Natural for 1/16" OD (link)
  • Idex P-259 Super Flangeless Ferrule w/SST Ring, Tefzel (ETFE), 1/4-28 Flat-Bottom, for 1/16" OD (link)
  • Idex XP-286 Flangeless Fitting Headless, PEEK, Natural, 1/4-28 Flat-Bottom, for 1/16" OD (link)


Assembly and Bill of Material



Back to top  

Gripper


Gripper

Description

The finger-like gripper is design to allow the handling of lab-ware around the work area. It can moves tubes, micro-plate and different type of containers or boxes such as pipette tip box around as needed. The gripper is fixed to one of the three z-axis of the tool holder. It can therefore be used independently of the other tools on the holder. The gripper first consists of a Dual Gripper Kit obtained from Crust Crawler Robotics. This kit uses two Robotis' Dynamixel AX-12A servomotors for the finger-like motion. We then added a third AX-12A servo to give the gripper wrist-like capabilities, adding flexion and extension movement. Lastly, a MX-12W servo was also added so the gripper can rotate around a vertical axis on 360°.

This gripper kit was chosen because it uses Robotis' Dynamixel servomotors. Those servos are easy to control and their precision in movement allows the gripper to access almost any components. They offer various options to monitor and use different operating values of the servo even during live operation, allowing us to use them at our will to control the gripping function of our platform. The most useful Dynamxiel's control function is the torque limit that we can set to a custom value corresponding to the object we desire to grip. Also, the MX-12W was chosen for the gripper rotation because the angle of the servo can be monitored over 360°, unlike AX-12A Dynamixel which can only be monitored from -150° to 150°. The servos assembly gives the gripper the ability to take narrow objects as well as wider ones, and it can grip them from top or from the side. It can also rotate on 360°. The gripper is controlled by a dedicated BananaBoard.


Specifications

Mechanical

Specification Value
Dimensions 258 mm x 75 mm x 97 cm
Motors Robotis' Dynamixel AX and MX servomotors
Fingertip precision 0.7 mm
Fingertip speed from 0 to 680 mm/s
Fingertip torque from 0 to 1.5 N*m
Rotation precision 0.088°
Rotation speed from 0 to 470 rpm

Electrical

Specification Value
Servos' input voltage 12V

Software

Specification Value
Language C++

Parts list

  • 3x Dynamixel AX-12A by Robotis (link)
  • 1x Dynamixel MX-12W by Robotis (link)
  • 1x CrustCrawler AX Dual Robotic Gripper Hardware Kit (link)
  • 2x Bioloid F2 Frame (from Dynamixel servo's kit)
  • 3x Bioloid F3 Frame (from Dynamixel servo's kit)
  • 3x 3-Pins Dynamixel Communication Cable (from Dynamixel servo's kit)
  • Bolts and nuts (from Dynamixel servo's kit)


Assembly

...



Back to top
 

Centrifuge


Centrifuge

Description

Centrifugation operations are often required for protocols in molecular biology labs and that is why we wanted to build a custom automated centrifuge that can be operated with the platform and the gripper.

The centrifuge is able to fit up to eight 1.5 ml tubes and up to four 5 ml tubes. The rotating plate, which hold the tubes, is made of polyoxymethylene, a lightweight and strong thermoplastic. It is coupled on a Quanum MT series 2208 brush-less DC motor. Such motors offer high rotation speed and compact size, two characteristics important for the whole design. Swinging bucket tube holders allow tube to be in a vertical position when resting, to ease manipulation with the gripper, and force tube to tilt to a 45° angle during centrifugation so the pellet forms at the bottom of the tube and not on the side. To detect high vibrations, a warning of potential problems during run-time, an accelerometer is added to the module and stops the centrifuge if needed to prevent any accident. The centrifuge is equipped with an automated lid which is secured by a lock mechanism during running time. Because the lid only opens over one tube slot, we need to rotate the plate from slot to slot when the centrifuge is being loaded by the gripper. To do so, a magnetic sensor is positioned on the axis of rotation so the absolute angular position is known. That way, it is possible to rotate the plate to place a tube slot under the opening in the lid so the gripper can load and unload tubes. The magnetic sensor is also use to measure the rotation speed of the centrifuge. And of course, the whole centrifuge case is built with a sturdy construction, using material such as aluminum and polycarbonate to prevent any external damage should there be any internal problems. The centrifuge is controlled by a dedicated BananaBoard.


Specifications

Mechanical

Specification Value
Dimensions (Length x Width x Height) 209 mm x 209 mm x 182 mm
Rotation Speed 16 500 rpm
G Force applied 18000 G
Tube capacity 8x 1.5mL tubes and 4x 5mL tubes

Electrical

Specification Value
Motor's input voltage 12V

Software

Specification Value
Language C++

Parts list

...


Assembly

...



Back to top
 

Magneto Caloric 1.5 (MC1.5)

Description


MC1.5 3D Plan


Download SolidWorks File

The other module that can control temperature and magnetic field is called Magneto Caloric 1.5 (MC1.5) and has the same functionalities as the MC96, but for tubes containing an amount of liquid as high as 1.5mL, which is more than the capacity of a MC96 well. The MC1.5 consists of two independent sub-modules. So, each sub-module could have its own sequence.


Specifications

Thermal

Specification Value
Range Achieved 4 to 80°C
Precision Achieved ±1.5°C
Heating speed Achieved 1.81°C/s
Cooling speed Achieved 0.5°C/s

Mechanical

Specification Value
Material 1.5ml test tube mold : Aluminium
Frames and Module base : Plastic
Dimensions 8.5cm x 12.8cm x 22 cm
Linear actuator speed 12mm/s
Linear actuator stroke 2cm

Electrical

Specification Value
Input voltage 24V
Maximal power consumption ≈400 Watts

Software

Specification Value
Language C++

Parts list

Download Bill of Material File



Back to top
 

Turbido Agitator Caloric (TAC)

Description


TAC 3D Plan


Download SolidWorks File

The main function of this module is to grow cell culture in a 25mm test tube. To do so, the module must regulate the tube temperature, be able to agitate the liquid and to measure the amount of cells in the culture. The TAC module enables the automation of repetitive steps that are performed on a daily basis in laboratories around the world. It can be reprogrammed to meet specifications of different protocols for molecular biology or microbiology experiments.

One possible application of the TAC module would be the insertion of DNA into a micro-organism. This manipulation requires the growth of the micro-organism at the optimal temperature until a specific optical density is reached. This is required for the observed colony to enter its stationary phase as we can observe in the following figure.


Cell density of a culture vs time

Once the optical density has been reached, the cells have to be washed a couple times to eliminate the residual growing media. Afterwards, the DNA is added to the mix and the cells are perforated to allow its transfer. This stressful operation kills most of them. Therefore, we have to replicate them quickly in a proper medium and at the right temperature.

To regulate the temperature between 0 and 37°C, a Peltier element is used because it can heat or cool the tube depending on the current’s direction. An heat sink is stick to the other side of the Peltier element to eliminate the heat produced by the Peltier element. The fan is used to create a forced convection, thus increasing the efficiency of the heat sink.

To agitate the liquid, the same principle as a magnetic stirrer is used. First, a magnetic stirrer bar must be inserted into the test tube. Then, a magnet stuck on a DC motor attracted the magnetic stirrer bar. So, when the DC motor rotates the magnetic stirrer bar inside the test tube rotates at the same speed and thus, agitating the liquid.

To measure the amount of cells in the culture, a system has previously been developed by the lab of professor Rodrigue. This system used the transmittance of the liquid to measure the amount of cells in a 25mm test tube. To measure it, a LED (light-emitting diode) is placed on one side of the test tube and a photodiode is placed on the other side. The LED blinks and this blink is received on the photodiode, generating a square signal as shown in the folowing Figure.


Photodiode signal voltage vs time

The amplitude difference between the signal high and the signal low increase as the transmittance increased and decreased as the transmittance decreased. A calibration graph has been calculated and is shown in the folowing Figure.


Optical density vs Amplitude difference


Specifications

Thermal

Specification Value
Range 0 to 37°C
Precision ±1.5°C
Heating speed Achieved 1.2°C/s
Cooling speed Achieved 0.3°C/s if tube temperature above room temperature
Achieved 0.21°C/s if tube temperature below room temperature

Mechanical

Specification Value
Material 25mm test tube mold : Aluminium
Frames and Module base : Plastic
Dimensions 8.5cm x 12.8cm x 21.8cm
DC motor speed 60 to 600 rpm

Electrical

Specification Value
Input voltage 24V
Maximal power consumption ≈400 Watts
Turbidity measurement precision ±5% from a reference turbidimeter

Software

Specification Value
Language C++

Parts list

Download Bill of Material File



Back to top
 

Magneto Caloric 96 (MC96)

Description


MC96 3D Plan


Download SolidWorks File

This module is called Magneto Caloric 96 (MC96) because it has to manage magnetism and temperature cycling (caloric) of a 96-well plate. The main use of the MC96 is to apply a specific temperature on different liquids (e.g. cell cultures) in the context of biological research.

The module has the possibility to concentrate particles in a solutions by applying an electromagnetic field that will bring particles on the wall of the well. This is explained by the magnetic attraction of microscopic magnetic beads to which particles are agglomerated. The beads are to be introduced into the well during the procedure and this can also be automated.

To apply the electromagnetic field, neodymium magnets are moved to the side of the wells. To do so, the magnets are assembled in a frame that is moved by a linear actuator. So, when the actuator raises the frame, the magnets are moved near the wells and the beads are brought on the well’s wall.

To implement thermal cycling, a Peltier element is used because it can heat or cool the 96-well plate depending on the current’s direction. A heat sink is stick to the other side of the Peltier element to eliminate the heat produced by it. The fan is used to create a forced convection, thus increasing the efficiency of the heat sink.


Specifications

These characteristics are the desired specifications or part’s characteristics because no prototype has been built yet.

Thermal

Specification Value
Range 4 to 80°C
Precision ±1.5°C
Heating speed 0.5-1°C/s
Cooling speed 0.5-1°C/s

Mechanical

Specification Value
Material 96-well mold : Aluminium
Frames and Module base : Plastic
Dimensions 12.8cm x 13.34cm x 18.43cm
Linear actuator speed 12mm/s
Linear actuator stroke 2cm

Electrical

Specification Value
Input voltage 24V
Maximal power consumption ≈800 Watts

Software

Specification Value
Language C++


Back to top
 

BananaBoard


BananaBoard Top and Bottom view

Description

With so many different independent modules, it would have been a real struggle to design a Printed Circuit Board (PCB) for each of them. Yet, when you compare modules to each other, you can notice that there are similarities between them. We therefore decided to design a single PCB (that we named BananaBoard) that has all the electrical and software capabilities to supply every modules individually. The components soldered on te BananaBoard depend on the module interfaced with the PCB. For example, the BananaBoard has a 24V output connectors. The gripper doesn't need this electrical supply but the MC1.5 and the TAC need it. So the component for this output will not be soldered on the PCB for the gripper, but they will be for the MC1.5 and the TAC's PCB. This allowed us to save design time and reduce complexity during the PCB assembly and debugging. The BananaBoard is also versatile enough so it could be used if new modules are design or if existing equipment from third party must be integrated on the platform.


Specifications

Mechanical

Specification Value
Dimensions (with all component soldered) 107.9 mm x 80.4 mm x 35.8 mm

Electrical

Specification Value
Input voltage 12-24 V
Output voltages 12-24 V / 60 A: Half H-Bridges and Stepper Motors
5 V / 1 A: Logic Circuit, LED, Sensors
3.3 V / 100 mA: Accelerometer
Microcontroler Cypress' PSoC5 CYC5868AXI-LP034
Other components
  • 8x Half H-Bridges
  • CAN, SPI and UART communications capabilities
  • 2x Stepper motors control modules
  • Many various digital and analogue inputs and outputs

Software

Specification Value
Language C++

Parts list

...


Assembly

...



Back to top
 

Controller Interface

Description

The controller interface is used to control the platform as well as the modules installed on it. The controller interface is hosted on a PC connected to the platform via a USB to CAN converter. The following figure shows the interface:



Controller Interface

# Close-up Desciption
1

This is the menus of the interface. The File menu allows the user to import and save protocols, module definition, deck layout and more. The Options menu allows the user to is to modify and configure USB communication, platform and modules variable and more.

2

This is a list of selected protocols. This allows the user to start and stop the selected protocol. To add a protocol simply drag the protocol from Steps to Protocols.
3

This is a list of protocols that have been created or have been imported. A protocol is a collection of commands (steps) that can be sent to the platform. A protocol could also contain another protocol. For example, there is protocol named “Grow” and another protocol named “Pipetting”. The user can then create a new protocol named “Grow and Pipetting” containing “Grow” and ”Pipetting”. It is possible to add a protocol by clicking on Add.

4

This is a list of available tools on the platform. This allows the user to edit the parameters of the modules present on the platform by clicking on Edit. The user can also access this feature in the Options menus.
5

This is the deck layout. This allows the user to represent the actual position of different modules on the platform. To add a module on the deck, it has been planned to drag it from the tools list.

6

This is the connection indicator. This allows the user to know whether or not the host PC is connected to the platform.
7

The is the labware list. This list allows the user to register all labware item, like 96-wells plate, 25mm test tube or pipette tips.
8

This is the console. The console allows the user to see every important events occurring on the platform. This also allows the user to directly send a message to the platform by typing it into the field under the log then click on the Send button. It is planned to implement this feature after the competition.

Specifications


Software

Specification Value
Language C#



Back to top

Also in "Project"