Team:SPSingapore/Notebook-Week-8

• Home
• Team
  • Overview
  • Official Profile
  • Team Bios
  • Mentors
  • Attributions
• Project
  • Overview
  • Invasin + Listerolysin
  • esa Quorum Sensing
  • Anaerobic Promoter
  • Parts
• Notebook
  • Protocols
  • Entries
• Human Practices
  • Overview
  • Workshop
  • Workshop Materials
  • Consultations
• Safety
• Medals

• NOTEBOOK
  •  
• PROTOCOL
  •  
• ENTRIES
  • Week 1 (24/5 - 30/5)
  • Week 2 (31/5 - 6/6)
  • Week 3 (7/6 - 13/6)
  • Week 4 (14/6 - 20/6)
  • Week 5 (21/6 - 27/6)
  • Week 6 (28/6 - 4/7)
  • Week 7 (5/7 - 11/7)
  • Week 8 (12/7 - 18/7)
  • Week 9 (19/7 - 25/7)
  • Week 10 (26/7 - 1/8)
  • Week 11 (2/8 - 8/8)
  • Week 12 (9/8 - 15/8)
  • Week 13 (16/8 - 22/8)
  • Week 14 (23/8 - 29/8)
  • Week 15 (30/8 - 5/9)
  • Week 16 (6/9 - 12/9)
  • Week 17 (13/9 - 18/9)

Research Notebook

Week 8 (12/7 - 18/7) ▪ July 12 Invasin + Listerolysin    ☀ Adrian ☀ Prepared restreak of inv/hly plasmid from original stab culture ▪ July 13 Anaerobic Promoter    ☀ Yi Han & Yun Ting ☀ Ligation for FNRgfp (4X) 200ng of gfp plasmid (4.36ul) 297.5 ng insert (7:1) 10.3 1ul 10Buffer (53.34) 4ul T4 ligase Trial run of anaerobe chamber open sachet to decrease O2 at 3.30pm takes 2.5h to activate streak plate of P. putida a strict aerobe and E. coli, facultative aerobe in chamber at 30deg C to grow O/N P. putida is an obligate aerobe and if chamber works ,it will not grow E. coli should grow in both conditions controls grown outside chamber ▪ July 14 Anaerobic Promoter    Invasin + Listerolysin ☀ Yi Han ☀ No colonies for FNRgfp plasmid Inv Plasmid Verification buffer 1 EcoRI 0.5 in plasmid 0.5 dH2O 8 Total 10ul Gel extraction RE digest of EsaR-GFP plasmid Ligation Control Vector (45ng) 1 1 insert 1 1 Buffer 1 1 dH2O 6 7 ligase 1 1 Transformation of FNRgfp Anaerobe jar E. coli grew in both conditions P putida-> some growth in anaerobe chamber Proper streak plate in aerobic conditions Packet runs out after 16 hours Invasin + Listerolysin    ☀ Yan Ting & Yun Ting ☀ Colony PCR of invasin ▶ Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol. ▶ Also constituted dNTP w 2.5mM of each atcg triphosphate. Anaerobic Promoter    ☀ Yi Han & Chi Yan ☀ Transformation of ligated FNRgfp plasmid into dH5alpha Cleaned waterbath, de-iced the fridge. Today, we also did a spring cleaning for the lab esa Quorum Sensing    ☀ Clarice ☀ Transformation of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction) plate O/N ▪ July 15 Anaerobic Promoter    ☀ Yi Han ☀ FNRgfp-> no colonies after transformation religation (4X reaction) 200ng of gfp plasmid (4.4ul) 2125ng of insert (8ul) 4ul T4 ligase 55.6 H2O Anaerobic Promoter    ☀ Yi Han & Chi Yan ☀ Transformation of FNR gfp into 20ul of BL21 Invasin + Listerolysin    ☀ Yun Ting ☀ 10am : Placed BBa_K299812 plate in incubator for overnight growth. 3pm : 100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front. Invasin + Listerolysin    ☀ Yan Ting ☀ RE digest of the miniprepped inv/hly plasmid with EcoRI/PstI from (20/7) ▶ Tube C-> 226ng/ul ▶Tube D-> 298ng/ul Buffer 3ul Plasmid 4ul each EcoRI 1ul PstI 1ul H2O 21ul each Total 30ul ▶ incubated at 37degC for 2h ▶ Add 6X loading dye to stop reaction in both tubes ▶ Ran gel (1kb, 100bp, cut vector C, D) ▪ July 16 Anaerobic Promoter    ☀ Yi Han ☀ No colonies grew Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder ▶ Seems to be band shift. Invasin + Listerolysin    ☀ Yan Ting & Yun Ting ☀ Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator. Primer conc=0.5 uM, template DNA dissolved in 10ul h20. Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol. 100V for 34min. Tubes 1-2: FP-prefix, RP-suffix. 3-4: FP-VF2, RP-VR. 5-6: FP-prefix, RP_Inv_M2. 7-8: RP-suffix, FP_Inv_M1. No template control with FP-prefix, RP-suffix. [Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG]. Gel image saved as “7.17_inv colony.sgd” Results: ▶ Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies. ▶ Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time). Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb. ▶ No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb. ▪ July 17 Anaerobic Promoter    ☀ Chi Yan ☀ RE digest of FNR-GFP fusion PCR with EcoRI and PstI EcoRI 1 PstI 1 Buffer 5 FNR-GFP from 12/7 in RIP box 1ug -> 2.5ul H2O 40.5 Total 50 ▶ RE for 2 hours at 37 degrees ▶ Direct purification using Promega kit Overnight ligation (4X reaction) 200ng of gfp plasmid (4.4ul) 400ng of insert (5:1) (4ul) 4ul T4 ligase 8ul T4 ligase buffer 44.1 H2O ESA Quorum Sensing    ☀ Adrian ☀ Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI) 10x T4 DNA ligase Buffer 1ul Vector 1ul Insert 5ul H2O 10ul T4 DNA ligase 1ul ▶ Reactions were incubated for 30min at room temperature Transformation   pSB1A2 esaRBSGFP   pSB1A2 RNG GFP   Control cut pSB1A2 Anaerobic Promoter    ☀ Yi Han ☀ For plates on LB alone there was a lawn For pUC19, the transformation worked, and separated colonies were produced No colonies were produced for the FNR-gfp plasmid ▪ July 18 Anaerobic Promoter    ☀ Xin Yi ☀ Transformation of FNRGFP ligated product into BL21 (from Chi Yan 17/7)    1. 3ul pUC19 control +10ul BL21    2. 20ul Ligation product + 20ul BL21    3. 5ul Ligation product + 20ul BL21 Plated on LB+amp plates    40ul of transformed bacteria in SOC media on LB+amp    20ul of transformed bacteria in SOC media on LB alone esa Quorum Sensing    ☀ Adrian ☀ Confirmation of gfp plasmid RE digest of gfp plasmid with EcoRI/PStI EcoRI 2ul PstI 2ul Buffer 4ul DNA 10ul H2O 22ul Total 40ul Ran gel, band size was correct gel extraction -> 101ng/ul Master plates RNG - 4 colonies esaRGFP- 6 colonies esa Quorum Sensing    ☀ Adrian ☀ Vector dimer check 8 colonies were selected from the control plate (26/7) PCR mastermix H2O 222ul Buffer 80ul MgCl2 32ul dNTP 32ul 1ug FP_Biobricks_Prefix 16ul RP_Biobricks_Prefix 16ul GoTaq 2ul Total 400ul The control plate had plasmids with a 800bp insert Gel extract was performed on a 2kb band Ligation Troubleshooting Ligation Mastermix H2O 222ul Buffer 80ul MgCl2 32ul dNTP 32ul FP_Biobricks_Suffix 16ul RP_Biobricks_Suffix 16ul GoTaq 2ul Total 400ul Colony PCR 8 colonies were selected from esaR and RNG each, total 16 colonies PCR Mastermix H2O 444ul Buffer 160ul MgCl2 64ul dNTP 64ul FP_Biobricks_Suffix 32ul RP_Biobricks_Suffix 32ul GoTaq 4ul Total 800ul Ran gel Lanes:    1. Vector Backbone (EcoRI/PstI)    2. Control Ligation mix    3. esaR ligation mix    4. RNG ligation mix    5. T4 Ligation buffer    6. Blank