Protocols

A compilation of the protocols used at UCSC: from Gibson to MGM.
To view our Notebook click here

Agarose Gel Protocol.

Preparing DNA and Running in Gel Electrophoresis

Reagents:

10X TBE Buffer
Deionized Water
Agarose Powder
Gel Loading Dye Purple 6X spiked with SYBRGold
DNA solutions
DNA Ladder

Equipment:

Gel Doc-it UV imaging machine (Purple and grey with green tape)
Computer with Launch VisionWorksLS program open
Gel electrophoresis Box (with non-morphed electrodes) and Lid
Power Supply box
Microwave
Rotation Mixer
Weight

Methods:

Protocol 1: Preparing the Gel

Create 500 mL of 1X TBE buffer by mixing 50 mL of 10X TBE buffer and 450 mL of deionized H20
For a 1% (w/v) gel (for very large DNA), take 50 mL of 1X TBE buffer and mix with the appropriate percent mass of Agarose powder (Weigh out 0.5 g for a 1% gel)
Mix thoroughly using the rotation mixer (optional)
Loosely plug flask with paper towel and heat in microwave for approximately 1 minute, or until the agarose is fully dissolved. The liquid should be completely clear.
Once completed, wait till the beaker cools and prepare to add solution to the gel tray. Put comb into the tray and make sure that the tray is oriented in the gel box so that its ends are blocked against the sides of the box.
SLOWLY pour solution into gel tray to avoid creating bubbles.
Allow gel to solidify and cool for 20 - 30 minutes or until fully solidified. This can be tested by how easy it is to move the pick.
Once solidified, gently turn the gel tray with the gel so that the ends are exposed.
Fill the gel box with 1X TBE buffer until gel is fully covered (0.5 - 1 cm above gel)
Slowly and carefully remove the comb so as not to tear the wells.

Protocol 2: Staining the DNA Samples and Running Gel

Caution: Gel box has high voltage! Be sure to turn off power pack and unplug leads before removing lid of gel box.

You will be staining the DNA using Professor Bernick’s Droplet Technique. Depending on how many samples you have (including controls and DNA ladder), place 1 uL droplets of 6X Loading Dye on a piece of parafilm.
Take 5 uL of each DNA sample and add to an individual droplet. You will have a final volume of 6uL. Be sure to mix thoroughly up and down, then take the sample and inject into a well.

Make sure to change pipet tips for each DNA sample so as to prevent contamination! Keep track of the positions of each sample

Once all samples have been loaded, close the gel box and attach all electrodes to the gel box and to the power pack. (Use color coding to be sure all electrodes are attached correctly. Black = negative electrode and Red = positive. The electrode closest to the samples will be negative while the further is positive.
Turn on the power pack and set to 120 V. You should immediately see bubbles rising from the wires in the gel box.
Run continuously for 75 minutes. Once complete, turn of the power pack.

Protocol 3: Visualizing the Gel

Remove the lid from the gel box (Be sure that the power pack is turned off!)
Pour out the 1x TBE buffer into the used TBE buffer beaker
Open the Gel Doc it door and pull out the UV transilluminator. (Make sure it is off!)
Transfer the gel to the UV transilluminator tray, push it back into the machine and flip the on switch on the lower right corner.
Close the door and make sure the knob is turned to Syber Gold. Go to the computer and open the Launch VisionWorks program.
Flick the UV light switch and press preview on the computer. When the gel is clearly visible and you can see the bands, press capture and save it to the folder IGEM2015.

References:

Ruben, Giulia, “Lab 2 Protocol #1, Gel Electrophoresis”, Biochemistry Laboratory, Winter 2015

Colony PCR Protocols for Transformed E.coli

Colony PCR Protocol for Transformed E. coli

Equipment

Thermocycler
Micro-pipettes (P10, P20 & P1000)
Thin-walled PCR Tubes
Eppendorf tubes
Microcentrifuge with PCR and Eppendorf tube adapters
Ice bucket and ice (Ice is found in the Autoclave room 202)

Reagents

Fresh Miliq water (Found in the Autoclave room 202)
SOC Media
Titaq 2x Master Mix

Methods

After plating your electroporated E. coli cells, choose about 6 large cultures with the least amount of micro satellites.

Take a micropipet tip and gently touch it to the colony (No need to scrape as this will be too many cells)

Place the micropipet into an eppendorf tube with 10 uL of water to create a 1:10 dilution of DNA, and slowly pipet up and down to lyse the cells.

Take 1uL of this dilution and use it as DNA template for your PCR reaction

Plasmid Specific Primer Options

Breakdown Primers:

bGlu_Seq_Fw1: 5’ CCCTCGATTTTCCGCCTGCCGATTA 3’
bGlu_Seq_Rv4: 5’ GCGCTCTAGAACTAGTGGATCCCCC 3’

Dominic Primers:

Aldy5Seq1F: 5’-TACTTCACATTCGCGGACCTATTG - 3’
Aldy5Seq5R: 5’-AGAACTAGTGGATCCCCCG - 3’

Professor Bernick Primers:

PCR Ingredients

Components	25 uL Reaction
Titaq 2x Master Mix	12.5 uL
Forward Primer	0.5 uL
Reverse Primer	0.5 uL
Template DNA	1 uL
PCR Enhancer	5 uL
Miliq Water	5.5 uL

References

Professor David Bernick, Lab Advisor

Polymerase Chain Reaction (PCR) for Amplification of pTA963 Expression Plasmids

Polymerase Chain Reaction (PCR) for Amplification of pTA963 Expression Plasmids

Equipment:

Heat block or thermo-cycler
Micro-pipettes (P10 & P20)
Thin-walled PCR Tubes
Microcentrifuge with PCR adapters
Small beaker and ice (Ice is found in the Autoclave room 202)

Methods

We will be amplifying two versions of the pTA963 expression plasmid: One which allows the insertions of a 6 x Histidine Tag on the N-Terminus region, and other which allows insertion in the C- Terminus region.

You will be using different primers depending on which plasmid you are amplifying, so be sure to grab the right ones!

If you have the N-Terminal, the primers you will be using are:

pTA963Nterm Forward

pTA963Nterm Reverse

If you have the C-Terminal, the primers you will be using are:

pTA963Cterm Forward:

CGATAAGCTTGATATCGAATTCCTG

pTA963Cterm Reverse:

ATGCGCAATAGGTCCGCG

Before you begin, always prepare the thermocycler using the conditions below. The thermocycler takes time to warm up, so run the appropriate protocol as you are mixing so that you can place the PCR reaction in the machine as soon as possible.

In this experiment, you will be preparing the thermocycler for a Touchdown PCR. The annealing temperature for the first round of cycles will decrease by 0.2°C each cycle for a total temperature drop of 1°C/5 cycles. Use the appropriate parameters below depending on which reaction you are running.

C-terminal cycles (15 cycles, 10 cycles)
\|<-------	---------	x 15 \|	\|<-------	---------	-- x 10\|
98°C	98°C	66°C*	72°C	98°C	63°C	72°C	72°C	4°C
5:00	0:10	0:10	3:00	0:10	0:10	3:00	5:00	Hold

*Touchdown is a -0.2 degree per cycle for a total of 3 degree decrease.

N-terminal cycles (10 cycles, 15 cycles)
\|<-------	---------	-- x 10\|	\|<-------	---------	x 5 \|
98°C	98°C	64°C*	72°C	98°C	62°C	72°C	72°C	4°C
5:00	0:10	0:10	3:00	0:10	0:10	3:00	5:00	Hold

*Touchdown is -0.2 degrees per cycle for a total of 2 degree decrease

Use the following protocol if 2X Q5 Mastermix is not available :

COMPONENTS	25 µL RXN	50 µL RXN	FINAL CONC.
5X Q5 Reaction Buffer	5µL	10 µL	1X
10 mM dNTPS	0.5 µL	1 µL	200 µM
10 uM Forward Primer	1.25 µL	2.5 µL	0.5 µM
10 uM Reverse Primer	1.25 µL	2.5 µL	0.5 µM
Template DNA	0.5 uL	1 uL	<1,000 ng
Q5 High-Fidelity DNA Polymerase	0.25 µL	0.5 µL	0.02 U/µl
PCR Enhancer (optional)	(5 µL)	(10 µL)	(1X)
Nuclease-Free Water	11.25 ul	22.50

If Mastermix is available, use the following protocol:

COMPONENTS	25 µL RXN	50 uL RXN
MiliQ H20	4.5 uL	9 uL
5X PCR Enhancer	5 uL	10 uL
10 uM Forward Primer	1.25 uL	2.5 uL
10 uM Reverse Primer	1.25 uL	2.5 uL
Diluted pTA963 Plasmid	0.5 uL	1 uL
2X Q5 MasterMix	12.5 uL	25 uL

Obtain thin-walled PCR tubes – be sure to wear gloves when removing them from the container. Then, distribute the appropriate volume of primers, plasmid and water into the tube. Do not add DNA Polymerase or Mastermix, this will go last and only when you are ready to run the reaction in the thermocycler. Place all reagent and reaction tubes on ice while you wait.

It’s best to start with the appropriate volume of H20, then add all the other reagents.

Mix contents of each tube thoroughly, either by by pipetting up and down slowly, OR placing the tube on a vortex mixer and microcentrifuge for about a second.

Make sure your tube is well labelled with group members, the specific plasmid you are amplifying, and the date.

Clean- Up

Dump ice into the sink and place ice box in designated area on side bench

Place all remaining plasmid and primer samples back in the fridge.

References:

Ruben, Giulia, “Lab 4 Protocol #2, Polymerase Chain Reaction”, Biochemistry Laboratory, Winter 2015

Dominic Schenone, lab advisor

Protocol for Fragment Assembly and Gene Isolation from H. hispanica

Protocol for Fragment Assembly and Gene Isolation from H. Hispanica

Equipment:

Heat block
Thermocycler
Micro-pipettes (P10, P20 & P1000)
Thin-walled PCR Tubes
Eppendorf tubes
Microcentrifuge with PCR and Eppendorf tube adapters
Ice bucket and ice (Ice is found in the Autoclave room 202)
2 Liter Beaker

Reagents

Fresh Miliq water (Also found in the Autoclave room 202)
23% Modified Growth Medium

Methods

Fragment Assembly Protocol

Obtain the appropriate amounts of fragment 1, 2 and 3 that provide an equal molar concentration of each fragment. In this case, the concentrations are:

Fragment 1: 0.88 uL
Fragment 2: 1.25 uL
Fragment 3: 1 uL

Use the following primers:

bGlu_Fw_flag:

5'CCTGCCGATTACTTCACATTCGCGGACC

TATTGCGCATATGGCACATGACACGACTGACG 3'

bGlu_Rv_flag:

5' TTCGATATCAAGCTTATCGTCAGTGGTG

GTGGTGGTGGTGCGAGCGACCGCGGACCTC 3'

Set the thermocycler to the following conditions:

Fragment Assembly cycles (25 cycles)
\|<-------------	----------------	x 25 \|
98°C	98°C	65°C*	72°C	72°C	4°C
5:00	0:10	0:10	1:00	5:00	Hold

Gene Isolation Protocol

Growth of Haloarcula Hispanica

Your cells need to be grown in 23% Modified Growth media till they have reached an A 600reading between 0.4 - 0.8.

To make a liter of 23% Modified Growth media, use the following ingredients:

Salt Water (30% Stock)	767
Pure Water	200
Peptone( Oxoid)	5
Yeast Extract	1

*Don’t use Difco Bacto-Peptone, as it was reported in 1988 that it contained bile salts that lyse halobacteria.

Rapid Chromosomal DNA Isolation

Spin down 1 mL of a freshly grown Hbt. salinarum culture at exponential or early stationary

phase (1 minute at max. rpm in a microcentrifuge)

Suck off the supernatant.

Add 400 μL pure water and lyse the cells by gently pipetting. The cells disrupt immediately by

osmotic lysis.

Inactivate the proteins by heating the DNA solution up to 70°C for 10 min.

Comments:

a) DNA from freshly grown cultures (exponential or early stationary phase) give better results for

further reactions than old ones.

b) use 1 – 3 μl as a template for amplifying a DNA fragment by PCR.
c) digest 30 μl (in 100 μl final volume) for southern blot analysis.
d) if there is a problem using the DNA as template for PCR it could be due to much DNA. Try

several concentrations or volumes e.g. 1, 5, 10 μl from stock solution.

Nested PCR Part 1: Wild Type Beta Glucosidase Isolation

Use the following primers for the first step of nested PCR:

bGlu_iso_Fw: 5' CACTGTTTGGGTGCGCCTGTCATG 3'
bGlu_iso_Rv: 5' GTAGTGGGTATTCGGGGTCCGGTG 3'

Set the thermocycler to the following conditions:

Gene Isolation cycles (25 cycles)
\|<-------------	----------------	x 25 \|
98°C	98°C	71°C*	72°C	72°C	4°C
5:00	0:10	0:10	0:42 sec	5:00	Hold

PCR Reaction Ingredients

Use the following protocol if 2X Q5 Mastermix is not available :

COMPONENTS	25 µL RXN	50 µL RXN	FINAL CONC.
5X Q5 Reaction Buffer	5µL	10 µL	1X
10 mM dNTP	0.5 µL	1 µL	200 µM
10 uM Forward Primer	1.25 µL	2.5 µL	0.5 µM
10 uM Reverse Primer	1.25 µL	2.5 µL	0.5 µM
Template DNA	0.5 uL	1 uL	<1,000 ng
Q5 High-Fidelity DNA Polymerase	0.25 µL	0.5 µL	0.02 U/µl
PCR Enhancer (optional)	(5 µL)	(10 µL)	(1X)
Nuclease-Free Water	11.25 ul	22.50

If Mastermix is available, use the following protocol:

COMPONENTS	25 µL RXN	50 uL RXN
MiliQ H20	4.5 uL	9 uL
5X PCR Enhancer	5 uL	10 uL
10 uM Forward Primer	1.25 uL	2.5 uL
10 uM Reverse Primer	1.25 uL	2.5 uL
Diluted pTA963 Plasmid	0.5 uL	1 uL
2X Q5 MasterMix	12.5 uL	25 uL

Obtain thin-walled PCR tubes – be sure to wear gloves when removing them from the container. Then, distribute the appropriate volume of primers, plasmid and water into the tube. Do not add DNA Polymerase or Mastermix, this will go last and only when you are ready to run the reaction in the thermocycler. Place all reagent and reaction tubes on ice while you wait.

It’s best to start with the appropriate volume of H20, then add all the other reagents.

Mix contents of each tube thoroughly, either by by pipetting up and down slowly, OR placing the tube on a vortex mixer and microcentrifuge for about a second.

Make sure your tube is well labelled with group members, the specific plasmid you are amplifying, and the date.

Clean- Up

Dump ice into the sink and place ice box in designated area on side bench

Place all remaining plasmid and primer samples back in the fridge.

References:

Ruben, Giulia, 2015 “Lab 4 Protocol #2, Polymerase Chain Reaction”, Biochemistry Laboratory

Dyall-Smith, Mike., Rodriguez-Valera., 2008 “Modified Growth Medium (MGM) for Haloarchea”, The Halohandbook: Protocols for Haloarcheal Genetics (7th ed.). 14-15

Dyall-Smith, Mike., Pfieffer, Matthias., 2008 “Alternative Rapid Chromosomal DNA Isolation”, The Halohandbook: Protocols for Haloarcheal Genetics (7th ed.). 70

Protocol Taken from the Halohandbook Page 14 by Dr Mike Dyall-Smith

SOC Media

Ingredients

SOB
20 mM glucose

Protocol

Follow directions to make 1 liter of SOB media
After cooling medium to less than 50°C, add 20 ml filter sterilized 20% glucose solution

Summary

SOB Medium. Used in growing bacteria for preparing chemically competent cells

Ingredients

0.5% (w/v) yeast extract
2% (w/v) tryptone
10 mM NaCl
2.5 mM KCl
20 mM MgSO4

Per liter:

5 g yeast extract
20 g tryptone
0.584 g NaCl
0.186 g KCl
2.4 g MgSO4

Note: Some formulations of SOB use 10 mM MgCl2 and 10 mM MgSO4 instead of 20 mM MgSO4.

SOB medium is also available dry premixed from Difco, 0443-17.

Adjust to pH 7.5 prior to use. This requires approximately 25 ml of 1M NaOH per liter.

15/10 medium

Growth of competent TOP10 cells in Example 2 of the Bloom05 patent is performed in 15/10 broth, which is similar to SOB:

Extended instructions

1 M MgCl2 stock: dissolve 20.33 g MgCl2 6H2O in 100 ml ddH2O (XXX), autoclave on liquid cycle @ XXX°C for 20 min (can be done at the same time as SOC pre-mix below)
250 mM KCl stock: dissolve 1.86 KCl in 100 ml ddH2O (XXX)

combine:

Reagent	for 1 L	500 mL	100 mL
tryptone	20 g	10 g	2g
yeast	5g	2.5 g	0.5 g
NaCl	0.5 g	0.25 g	0.05 g
250 nM KCl	10 mL	5mL	1 mL
ddH2O	980 ml	490 ml	98 ml

adjust pH to 7.0 w/ NaOH
bring to volume:

Reagent

for 1 L

500 mL

100 mL

autoclave on liquid cycle @ XXX°C for 20 min

add autoclaved 1 M MgCl2

Reagent	for 1 L	500 mL	100 mL
1 M MgCl2	10 ml	5 ml	1 ml

Source

Adapted From:

Ausubel et al., Short Protocols in Molecular Biology (John Wiley & Sons, ed. 4, 1999) pg. A1-36

Typical Cycling Conditions for Q5 or Phusion

Typical PCR protocol for a 1,000 bp amplicon

1 cycle	98°C	30 seconds
25 cycles	98°C	10 seconds
	55°C	15 seconds
	72°C	15 seconds
1 cycle	72°C	5 minutes (to finish replication on all templates)
1 cycle	4-10°C	indefinite period (storing the sample prior to further analysis)

Polymerase Chain Reaction (PCR) for Fragment Assembly of gblocks

Equipment:

Heat block or thermo-cycler
Micro-pipettes (P10 & P20)
Thin-walled PCR Tubes
Microcentrifuge with PCR adapters
Small beaker and ice (Ice is found in the Autoclave room 202)

Methods

We will be amplifying two versions of the gene blocks with a N terminus and C terminus His tag.

You will be using different primers depending on which protein you are creating, so be sure to grab the right ones!

If you have the N-Terminal, the primers you will be using are:

Nterm Forward

atgcaccaccaccaccaccacATGACGGTCACGAACGAG 3'Tm=62.4 3'Ta(annealing temp)=62.1

Nterm Reverse

tatcaagcttatcgacatTCACTTGTCCGAATAGGC 3'Tm=59.1 3'Ta(annealing temp)=62.1

If you have the C-Terminal, the primers you will be using are:

Cterm Forward:

cggacctattgcgcatATGACGGTCACGAACGAG 3'Tm=62.4 3'Ta(annealing temp)=65.4

Cterm Reverse:

tcagtggtggtggtggtggtgCTTGTCCGAATAGGCCGTG 3'Tm=63.7 3'Ta(annealing temp)=65.4

Before you begin, always prepare the thermocycler using the conditions below. The thermocycler takes time to warm up, so run the appropriate protocol as you are mixing so that you can place the PCR reaction in the machine as soon as possible.

In this experiment, you will be preparing the thermocycler for a Touchdown PCR. The annealing temperature for the first round of cycles will decrease by 0.2°C each cycle for a total temperature drop of 1°C/5 cycles. Use the appropriate parameters below depending on which reaction you are running.

C-terminal cycles (15 cycles, 10 cycles)
\|<-------	---------	x 15 \|	\|<-------	---------	-- x 10\|
98°C	98°C	65°C*	72°C	98°C	65°C	72°C	72°C	4°C
5:00	0:10	0:10	1:00	0:10	0:10	1:00	5:00	Hold

N-terminal cycles (10 cycles, 15 cycles)
\|<-------	---------	-- x 10\|	\|<-------	---------	x 5* \|
98°C	98°C	62°C*	72°C	98°C	62°C	72°C	72°C	4°C
5:00	0:10	0:10	1:00	0:10	0:10	1:00	2:00**	Hold

Use the following protocol if 2X Q5 Mastermix is not available :

COMPONENTS	25 µL RXN	50 µL RXN	FINAL CONC.
5X Q5 Reaction Buffer	5µL	10 µL	1X
10 mM dNTPS	0.5 µL	1 µL	200 µM
10 uM Forward Primer	1.25 µL	2.5 µL	0.5 µM
10 uM Reverse Primer	1.25 µL	2.5 µL	0.5 µM
Template DNA	0.5 uL	1 uL	<1,000 ng
Q5 High-Fidelity DNA Polymerase	0.25 µL	0.5 µL	0.02 U/µl
5X Q5 High GC Enhancer (optional)	(5 µL)	(10 µL)	(1X)
Nuclease-Free Water	11.75 ul	23.50

If Mastermix is available, use the following protocol:

COMPONENTS	25 µL RXN
MiliQ H20	4.5 uL
5X PCR Enhancer	5 uL
10 uM Forward Primer	1.25 uL
10 uM Reverse Primer	1.25 uL
Diluted pTA963 Plasmid	0.5 uL
2X Q5 MasterMix	12.5 uL

For a 50 uL reaction, simply double the above amounts.

Obtain thin-walled PCR tubes – be sure to wear gloves when removing them from the container. Then, distribute the appropriate volume of primers, plasmid and water into the tube. Do not add DNA Polymerase or Mastermix, this will go last and only when you are ready to run the reaction in the thermocycler. Place all reagent and reaction tubes on ice while you wait.

It’s best to start with the appropriate volume of H20, then add all the other reagents.

Mix contents of each tube thoroughly, either by by pipetting up and down slowly, OR placing the tube on a vortex mixer and microcentrifuge for about a second.

Make sure your tube is well labelled with group members, the specific plasmid you are amplifying, and the date.

Clean- Up

Dump ice into the sink and place ice box in designated area on side bench

Place all remaining plasmid and primer samples back in the fridge.

References:

Ruben, Giulia, “Lab 4 Protocol #2, Polymerase Chain Reaction”, Biochemistry Laboratory, Winter 2015

Sample for PCR (ALDY3&5, ADH2)Sample for PCR (ALDY3&5, ADH2)

Sample for PCR (ALDY3&5, ADH2)

For a 50µl reaction:

For the template:

example, if 140 ng/µl

take 20µl of 140 ng/µl
add 20µl of miliQH2O

then add 1µl of 70ng/µl template to 50µl reaction

Gibson Assembly Protocol

Gibson Protocol (from board)

10 μL of master mix
50 ng of plasmid and fragments (> 3 μL of each)
Fill to 20 μL with milliQ
50℃ for 3 hours
4℃ hold

PCR Clean-Up Kit Protocol

Protocol for making the kit:

Membrane Binding Buffer:

26.5g of GITC
8.33ml of 3M potassium acetate
adjust volume to 50ml with H20

Membrane Wash Solution:

100X stock

3.32ml of 3M potassium acetate
33.4µl of 0.5M EDTA
adjust volume to 100ml with H20

10X working solution

7.99ml of 100% ethanol
1ml of 100X stock
1.0ml of H20

Protocol for using the kit:

add volume of sample to column
add 7X the amount of binding buffer to the sample in column
centrifuge at 16,000G for 1min

discard flow through

add 700µl of working solution wash
centrifuge at 16,000G for 1min

discard flow through

add 500µl of working solution wash
centrifuge at 16,000G for 5min

discard flow through

without adding any wash, centrifuge at 16,000G for 1min

discard flow through

transfer column to eppendorf tube
add 20µl of HOT miliq H20 to the column
centrifuge at 16,000G for 1min
nanodrop to check 260/230 is above 1

Field Sample Collection Protocol

Materials

gloves
disposable bags
50mL sterile capped sampling tubes
1 bottle of distilled water (from the milliQ) - about 500 ml
tape (labeling)
sharpie
pH probe
salinity meter
thermometer
styrofoam ice chest with ice
towel
camera
long-reach sampling pole and attaching tape (duct tape)
field notebook
spare clothes

Prep Procedure:

Obtain all materials.
Go through procedure with team
Fill ice chest with ice before leaving.

Field Procedure:

Distinguish varying sampling environments.
Look for sources of contamination to avoid (trash, oil, etc.).
Label falcon tube with identifier and initials of person sampling
Collect samples; fill 50 mL tube to the top and cap off immediately
For each sample, record time and date, explicit location with detail, and take photos.
Transport in styrofoam ice chest.

Salinity and pH Procedure:

Create 1:10 dilution of liquid sample with 5 mL of sample and 45 mL of DI water
Perform proper meter calibration
Measure pH and salinity using meter

Insoluble MCC Liquid Media Protocol

Materials:

For 1 bottle of 1L Sol-MCC liquid media

Make up 30% SW
Into 1L Erlenmeyer flask

Distilled H20	330 ml
30% SW	600 ml

Add to mix

1 M Tris.HCl (pH 7.5)

30 ml

Add slowly to mix

Insoluble MCC	25.5 ml
Hv-Min Salts	12 ml
0.5 M KPO buffer (pH 7.5)	1950 µl
Thiamine & Biotin	900 µl

Stir thoroughly for 15 minutes
Adjust pH with HCl/NaOH to 7.5 carefully
Pour mix into individuals flasks and top with foil
Autoclave for 30 minutes

Medium Solutions and Components

Insoluble MCC Carbon Source

Weigh out 3 g of MCC on scale in erlenmeyer flask
Pour 25.5 ml DI H2O into flask

Trace Elements

To 100 ml water add a few drops of concentrated HCl (be careful)

Dissolve the following one-by-one

MnCl2*4H20	36 mg
ZnSO4*7H20	44 mg
FeSO4*7H20	230 mg
CuSO4*5H20	0.4 ml

Hv-Min Salts

For 36 ml Hv-Min salts combine

1 M NH4Cl	30 ml
Trace elements	6 ml

Store in fridge

Thiamine & Biotin

For 10.8 ml combine

Thiamine (1 mg/ml)	9.6 ml
Biotin (1 mg/ml)	1.2 ml

0.5 M KPO4 Buffer pH 7.5

For 200 ml 0.5 M KPO4 buffer (pH 7.5)

1 M K2HPO4	83.4 ml
1 M KH2PO4	16.6 ml

Adjust pH to 7.5 by slowly adding HCl/NaOH. Record concentration of acid/base.
Add equal volume (100 ml) of DI H20
Store at room temperature

Edited with Online HTML Converter.

Soluble MCC Liquid Media Protocol

For 1 bottle of 1.05555 L Sol-MCC liquid media

Make up 30% SW
Into Erlenmeyer flask

Distilled H20	330 ml
30% SW	600 ml

Add to mix

1 M Tris.HCl (pH 7.5)

30 ml

Add slowly to mix

Thawed Solubilized MCC	80.7 ml
Hv-Min Salts	12 ml
0.5 M KPO4 buffer (pH 7.5)	1950 µl
Thiamine & Biotin	900 µl

Stir thoroughly for 15 minutes
Adjust pH to ~7.5 carefully. If stored, pH may rise back to around 8.0
Autoclave for 30 min
Pour mix into individuals labeled flasks and top with foil

Medium Solutions and Components

Solubilized MCC Carbon Source

Create 14.9 wt% NaOH Solution

If solid NaOH is used

Place erlenmeyer flask on scale and set to zero
Weigh out 14.9 g of NaOH in flask
Add DI H20 until solution reaches 100 g

If 4M NaOH solution is used

To create 100 mL of 14 wt% combine

4.0M NaOH	93.1 ml
DI H20	6.9 ml

In 3 individual erlenmeyer flasks add 2.0 g of MCC
Add 26.9 ml of 14 wt% NaOH to each flask
Stir until solution swells
Freeze solution overnight
Thaw at room temperature until solution becomes gel-like

Trace Elements

To 100 ml water add a few drops of concentrated HCl (be careful)

Dissolve the following one-by-one

MnCl2*4H20	36 mg
ZnSO4*7H20	44 mg
FeSO4*7H20	230 mg
CuSO4*5H20	0.4 ml

Hv-Min Salts

For 72 ml Hv-Min salts combine

1 M NH4Cl	30 ml
Trace elements	6 ml
0.5 M CaCl2	36 ml

Store in fridge

Thiamine & Biotin

For 10.8 ml combine

Thiamine (1 mg/ml)	9.6 ml
Biotin (1 mg/ml)	1.2 ml

0.5 M KPO4 Buffer pH 7.5

For 200 ml 0.5 M KPO4 buffer (pH 7.5)

1 M K2HPO4	83.4 ml
1 M KH2PO4	16.6 ml

Adjust pH to 7.5 by slowly adding HCl/NaOH. Record concentration of acid/base.
Add equal volume (100 ml) of DI H20

Soluble MCC Agar Plate Protocol

For 1 bottle of 1.05555 L Sol-MCC liquid media

Make up 30% SW
Into Erlenmeyer flask

Distilled H20	330 ml
30% SW	600 ml

Add to mix

1 M Tris.HCl (pH 7.5)

30 ml

Add slowly to mix

Thawed Solubilized MCC	80.7 ml
Hv-Min Salts	12 ml
0.5 M KPO4 buffer (pH 7.5)	1950 µl
Thiamine & Biotin	900 µl

Stir thoroughly for 15 minutes
Adjust pH to ~7.5 carefully. If stored, pH may rise back to around 8.0
Add 15g of Agar and mix
Autoclave for 30 min
Pour mix into individuals labeled plates and cool before storing

Medium Solutions and Components

Solubilized MCC Carbon Source

Create 14.9 wt% NaOH Solution

If solid NaOH is used

Place erlenmeyer flask on scale and set to zero
Weigh out 14.9 g of NaOH in flask
Add DI H20 until solution reaches 100 g

If 4M NaOH solution is used

To create 100 mL of 14 wt% combine

4.0M NaOH	93.1 ml
DI H20	6.9 ml

In 3 individual erlenmeyer flasks add 2.0 g of MCC
Add 26.9 ml of 14 wt% NaOH to each flask
Stir until solution swells
Freeze solution overnight
Thaw at room temperature until solution becomes gel-like

Trace Elements

To 100 ml water add a few drops of concentrated HCl (be careful)

Dissolve the following one-by-one

MnCl2*4H20	36 mg
ZnSO4*7H20	44 mg
FeSO4*7H20	230 mg
CuSO4*5H20	0.4 ml

Hv-Min Salts

For 72 ml Hv-Min salts combine

1 M NH4Cl	30ml
Trace elements	6 ml
0.5 M CaCl2	36 ml

Store in fridge

Thiamine & Biotin

For 10.8 ml combine

Thiamine (1 mg/ml)	9.6 ml
Biotin (1 mg/ml)	1.2 ml

0.5 M KPO4 Buffer pH 7.5

For 200 ml 0.5 M KPO4 buffer (pH 7.5)

1 M K2HPO4	83.4 ml
1 M KH2PO4	16.6 ml

Adjust pH to 7.5 by slowly adding HCl/NaOH. Record concentration of acid/base.
Add equal volume (100 ml) of DI H20

MGM Plate Protocol

per Litre:

Add the following ingredients (in a large beaker):

12 % MGM	18% MGM	23% MGM	25% MGM
Salt Water	400	600	767	833
Pure Water	567	367	200	134
Peptone (oxoid)*	5	5	5	5
Yeast Extract	1	1	1	1

*Don’t use Difco Bacto-Peptone, as it was reported in 1988 that it contained bile salts that lyse halobacteria (Kamekura et al., 1988). This was still the case in 2001, when tested by Thorsten Allers!

Stir to dissolve (you may have to warm slightly). Adjust the pH up to 7.5 with 1M Tris.Cl, pH 7.5, using 5 ml per Litre. If this is not sufficient, then use 1M Tris base, drop-wise, to reach the final pH. In Melbourne, Australia, I had no problems adjusting and maintaining the pH, but in Germany the pH would drop to 5.5 after autoclaving, unless I used at least 10 mM Tris. Note that Tris.Cl is inhibitory if > 45mM.
Adjust volume to 1000 ml with pure water (about another 30 ml water) For solid medium: Plates, add 15g Difco Bacto-agar; Top Layer Agar (for virus plaquing or transformations), add 7 g. It is better if the agar is largely dissolved before autoclaving, i.e. by heating to 100°C for 10-20 min. However with large volumes this can be difficult. The longer autoclaving time (30 min) should overcome this problem. The brand of agar is important, see note below at the end of section 2.4. Protocols for halobacterial genetics © Ver 7.2, March 2009 page 15
Sterilize (e.g. in a large, wide-mouthed 2 – 3 L flask) for 30 min, 101 kPa (15 lb). Cool to 55 – 60°C and pour into Petri dishes (see note below on pouring plates).
After autoclaving, make sure the agar is mixed before pouring as it tends to settle at the bottom. Pour relatively hot (about 60°C) as the high salt concentration makes the agar set easily. Bubbles are more difficult to get rid of (i.e. by flaming with a bunsen burner) than in normal media so be careful.

6. Dry plates before use (30 – 60 min, 37°C, upside-down, with lids removed; or more conveniently, overnight at RT on the bench). Store plates at 4°C, wrapped in plastic film.

Team:UCSC/Protocols

Protocols

Ingredients

Protocol

Summary

Extended instructions

Source

Typical Cycling Conditions for Q5 or Phusion