View source for Template:Team:Groningen/CONTENT/EXPERIMENTS/Colony PCR thrC locus 2 (th18)

{{Team:Groningen/TEMPLATES/LOG
	|title=00:00, 4 September 2015 - 00:00, 4 September 2015
	|executor=Marieke Mulder
	|content=<div class="text">Colonies from the transformation were checked with a colony PCR. For this, the following primers were used.</div>

<div class="object data" id="tbl1">
	<div class="wrapper">
	<div class="header">
		<div class="field fw3">Primer</div>
		<div class="field fw7">Sequence</div>
			</div>

	<div class="record">
		<div class="field fw3">IGEM thrC forward</div>
		<div class="field fw7">AATTCATGTAAAAGATGAGGTTGGTTCATT</div>
			</div>

	<div class="record">
		<div class="field fw3">iGEM erm-thrC rev 2</div>
		<div class="field fw7">AGGAAGTTAAAGGAGCTCGAATTAATTCC</div>
			</div>
	</div>
	<div class="caption">Used primers.</div>
</div>
 
<div class="text">The bands were expected to have a length of around 2500 bp. Colony 5 showed the correct band on the agarose gel after the colony PCR. This colony was grown on LB with Ampicillin overnight at 37 °C.</div>

}}