Difference between revisions of "Team:Dundee/Sequences"
| Line 37: | Line 37: | ||
<td width="312" valign="top"> | <td width="312" valign="top"> | ||
<p align="center"> | <p align="center"> | ||
| − | < | + | <b>Registry - ID</b> <!-- e.g. BBa_K1590000--> |
</p> | </p> | ||
</td> | </td> | ||
| Line 534: | Line 534: | ||
| − | </tbody | + | </tbody> |
| − | </div></div></body> | + | </table> |
| + | |||
| + | |||
| + | </div> | ||
| + | </div> | ||
| + | |||
| + | |||
| + | </body> | ||
<!--sequence modals--> | <!--sequence modals--> | ||
| Line 544: | Line 551: | ||
<!--Haemoglobin A--> | <!--Haemoglobin A--> | ||
| + | |||
| + | |||
<div class="modal fade" id="sequence_haemoglobina_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | <div class="modal fade" id="sequence_haemoglobina_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
<div class="modal-dialog" role="document"> | <div class="modal-dialog" role="document"> | ||
| Line 549: | Line 558: | ||
<div class="modal-header"> | <div class="modal-header"> | ||
<button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
| − | <div class="modal-title | + | <div class="modal-title" id="myModalLabel"></div> |
| − | + | ||
| − | + | ||
</div> | </div> | ||
| + | <div class="modal-body"> | ||
| + | <p class="sequences">>BBa_K1590000 (Haemoglobin A) <!--change style to unmodified--> | ||
| + | ATGGTTCTGTCTCCGGCGGACAAAACCAACGTTAAAGCGGCGTGGGGTAAAGTTGGTGCGCACGCGGGTGAATACGGTGCGGAAGCGCTGGAACGTATGTTCCTGTCTTTCCCGACCACCAAAACCTACTTCCCGCACTTCGACCTGTCTCACGGTTCTGCGCAGGTTAAAGGTCACGGTAAAAAAGTTGCGGACGCGCTGACCAACGCGGTTGCGCACGTTGACGACATGCCGAACGCGCTGTCTGCGCTGTCTGACCTGCACGCGCACAAACTGCGTGTTGACCCGGTTAACTTCAAACTGCTGTCTCACTGCCTGCTGGTTACCCTGGCGGCGCACCTGCCGGCGGAGTTCACCCCGGCGGTTCACGCGTCTCTGGACAAATTCCTGGCGTCTGTTTCTACCGTTCTGACCTCTAAATACCGTTAA</p> | ||
| + | </div> | ||
<div class="modal-footer"> | <div class="modal-footer"> | ||
<button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
| Line 1,261: | Line 1,272: | ||
</script> | </script> | ||
| − | |||
</html> | </html> | ||
{{:Team:Dundee/navbar}} | {{:Team:Dundee/navbar}} | ||
{{:Team:Dundee/footer}} | {{:Team:Dundee/footer}} | ||
Revision as of 08:32, 9 September 2015
<!DOCTYPE html>
Sequences and Parts
|
Registry - ID |
Name |
Short Description |
Part of which tool |
Sequences |
|
Haemoglobin A (Homo sapiens) |
Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12. |
BioSpray - Blood Detection |
||
|
Haemoglobin B (Homo sapiens) |
Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12. |
BioSpray - Blood Detection |
||
|
Haptoglobin (Homo sapiens) |
Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12. |
BioSpray - Blood Detection |
||
|
pChr-ChrB-GFP |
Partial sequence of chromate resistance operon of Ochrobactrum tritici 5bvl1, containing a chromate-inducible promoter, pChr, a repressor, ChrB, and a fluorescen reporter, GFP. |
Chromate Detection |
||
|
pChr |
Promoter sequence of chromate resistance operon of Ochrobactrum tritici 5bvl1. |
Chromate Detection |
||
|
- |
ChrB |
Coding sequence for unmodified chromate sensitive repressor of pChr. |
Chromate Detection |
|
|
ChrBopt |
Coding sequence for partially optimised chromate sensitive repressor of pChr. |
Chromate Detection |
||
|
pChrGFP |
Sequence of fluorescent reporter-fusion, chromate sensitive promoter + GFP. |
Chromate Detection |
||
|
Lanosterol Synthase (Homo Sapiens) |
Coding sequence for Human lanosterol synthase in silico optimised for increased expression level in E. coli K12. |
Fingerprint Ageing |
||
|
Odorant Binding Protein 2A (Homo sapiens) |
Coding sequence for human odorant binding 2A protein in silico optimised for increased expression level in E. coli K12. |
BioSpray - Nasal Mucus Detection |
||
|
- |
Odorant Binding Protein (Homo sapiens) - Helix |
Coding sequence for C-terminal helix of human odorant binding protein. |
BioSpray - Nasal Mucus Detection |
|
|
- |
Odorant Binding Protein (Homo sapiens) - Barrel |
Coding sequence for N-terminal barrel of human odorant binding protein. |
BioSpray - Nasal Mucus Detection |
|
|
Lactoferrin Binding Protein (Neisseria Meningitidis) |
Coding sequence lactoferrin binding protein. |
BioSpray - Saliva Detection |
||
|
PotD (Escherichia Coli) |
Unmodified coding sequence for E.coli Spermidine Binding Protein PotD. |
BioSpray - Semen Detection |
||
|
Spermine Binding Protein (Mus Musculus) |
Coding sequence for murine Spermine Binding Protein in silico optimised for increased expression level in E. coli K12. |
BioSpray - Semen Detection |
