Revision as of 16:27, 13 September 2015

EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits

E. Coli Laboratory Notebook

Construction of pdCas9-w
Construction of pdCas9-w-sgRNAs
- Part 1: Assemble pdCas9-w + sgRNA
- Part 2: Assemble pdCas9-w-sgRNA + sgRNA
  - Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR
  - Assemble pdCas9-w-sgRNA-sgRNA constructs
Construction of pWJ89alt
Construction of pAraC-sgRNA
- PCR pAraC and sgRNA
- Assemble pAraC-sgRNA constructs
Construction of pWJ89alt_Z4-to-X4
Primer table

Construction of pdCas9-w
07.05.2015 - 01.06.2015

pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP.

Materials and method

Open pdCas9-bacteria by Phusion PCR (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products
pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).
Extract w subunit from pWJ66 by Phusion PCR (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products
pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
Gibson assembly (cf. Protocols) of pdCas9-w using purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)
Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products + restriction digest (Cf. Protocols) of pdCas9-w (isolated by Miniprep (cf.Protocols)) with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products + sequencing (Microsynth)
Site-directed mutagenesis (cf. Protocols) of dCas9-w with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w (necesary for pdCas9-w to be BioBrick compatible)
Control with restriction digest (cf. Protocols) of mutated pdCas9-w (isolated by Miniprep (cf. Protocols)) with EcoRI + sequencing (Microsynth)

Results

Open pdCas9 by PCR
07.05.2015, 10.05.2015

Linearized pdCas9-w is expected to be 6705 bp.
We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. Many, but not all, of our samples were successfully amplified (cf. Fig.1).
For next steps, sample from lane 1 (cf. Fig.1) was used.

**Fig.1** - Gel of pdCas9 linearized by PCR, successful for all 5 samples. Ladder: 1kb Generuler.

Extract w subunit from pWJ66 by PCR
07.05.2015

Successful PCR reactions are expected to yield 340 bp fragments.
PCR was succesful for sample visible on gel. (cf. Fig.2)

**Fig.2** - Gel of w subunit extracted from pWJ66 by PCR, successful for sample in lane 1. Ladder: 1kb Generuler.

Gibson assembly of pdCas9-w
Gibson assembly, transformation: 19.05.2015. Colony PCR: 29.05.2015. Restriction analysis: 01.06.2015.

Colony PCR yields 666 bp amplicons if Gibson assembly worked and 396 bp amplicons if the plasmid self-ligated.
Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.
Gibson assembly seems to have worked for some samples. (cf. Fig.3)
To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.

pdCas9-w was analysed by restriction digest with BamHI and KpnI, both single cutters in pdCas9 and double cutters in pdCas9-w (cf. Fig.4).
Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see. By looking at the relative heights, we can say that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel.

Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).

Figure 3a — **Fig.3** - Gels of colony PCR of dCas9-w Gibson assembly products, successful for samples 5, 6, 16, 22, 25-28, 30, 31, 37, 41, 43. Ladder: 1kb Generuler.

Figure 3b — **Fig.3** - Gels of colony PCR of dCas9-w Gibson assembly products, successful for samples 5, 6, 16, 22, 25-28, 30, 31, 37, 41, 43. Ladder: 1kb Generuler.

Figure 4a — **Fig.4** - Gels of restriction digest of pdCas9-w Gibson assembly products. Each colony is present on gels in triplicates: undigested (7kb but migrates faster than linear DNA), digested by BamHI (6147 bp + 834 bp) and digested by KpnI (4534 bp + 2447 bp). All digestions worked and show that plasmids contain the w subunit. Undigested plasmid for sample 16 is not visible due to a technical error. Ladder: 1kb Generuler.

Figure 4b — **Fig.4** - Gels of restriction digest of pdCas9-w Gibson assembly products. Each colony is present on gels in triplicates: undigested (7kb but migrates faster than linear DNA), digested by BamHI (6147 bp + 834 bp) and digested by KpnI (4534 bp + 2447 bp). All digestions worked and show that plasmids contain the w subunit. Undigested plasmid for sample 16 is not visible due to a technical error. Ladder: 1kb Generuler.

Site-directed mutagenesis of dCas9-w - (date?)

Construction of pdCas9-w-sgRNAs - 08.07.2015 - 02.09.2015

These experiments consist of inserting one or two sgRNA producing cassettes (cf. Fig.8) into pdCas9-w. In part 1, one sgRNA (X0, X4, X35, Z0, Z4 or Z35) was inserted into pdCas9-w by Gibson assembly. For technical reasons, we were unable to make most constructs with two inserted cassettes using this method. In part 2, we extracted sgRNA cassettes from existing constructs and inserted them in other constructs that already contained one other sgRNA cassette.

Figure ¨8 — **Fig.8** - Schematics of structure of sgRNA cassettes

Materials and method

Part 1: Assemble pdCas9-w + sgRNA

Open pdCas9-w by restriction digest (cf. Protocols) with BsrBI (blunt ends) + agarose gel electrophoresis of 2 µL of digested and undigested product (with 1kb Generuler)
Amplify sgRNA cassettes by Phusion or Q5 PCR (cf. Protocols) with primers f_Gbs_sgRNA-A and r_Gbs_sgRNA-B + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols).
Gibson assembly pdCas9-w-sgRNA (cf. Protocols) with linearized pdCas9-w and purified sgRNA PCR products + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)
Control with colony PCR (cf. Protocols) with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) (one colony PCR (cf. Fig11a) was done with primers f_Gbs_pdCas9 and r_Scq_pdCas9_w_sgRNA) + sequencing (Microsynth)

Part 2: Assemble pdCas9-w-sgRNA + sgRNA

Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers f_Gbs_sgRNAinPd and r_Gbs_sgRNAinPd + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols)
Open pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers f_opn_d9w and r_opn_d9w + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols)
Gibson assembly of pdCas9-w-sgRNA, as describes in table below, + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)
Control with colony PCR (cf. Protocols) with primers f_Sq_CoP_pdCas92ndIns and r_Sq_CoP_pAraC2ndInsert + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler or 2-log DNA ladder) + sequencing (Microsynth)

sgRNA insert	sgRNA in pdCas9-w-sgRNA (backbone)
Z4	pdCas9-w-Z0
Z35	pdCas9-w-Z0
Z35	pdCas9-w-Z4
X4	pdCas9-w-X0
X35	pdCas9-w-X0
X35	pdCas9-w-X4

Results

Part 1: Assemble pdCas9-w + sgRNA
08.07.2015 - 07.08.2015

Open pdCas9-w by restriction digest
16.07.2015, 19.07.2015, 26.07.2015, 02.08.2015 (repeats)

The digested and undigested plasmids have the same size. Circular fragments migrates faster than linear fragments of the same size. This means that the undigested plasmid will migrate faster than the digested plasmid.
Even though the ladder is not clear, by looking at the relative heights we can see that the digested sample migrated more slowly than the undigested sample (cf. Fig.9). The restriction digest was successful.
Diegestion was repeated at least 3 times, we needed it for many PCRs.

**Fig.9** - Gel of pdCas9-w digested by BamHI (lane 1) and undigested (lane 2). Digested plasmid is lower on gel, which means digestion worked. Ladder: 1kb Generuler.

Amplify sgRNA cassettes by PCR
08.07.2015, 09.07.2015, 10.07.2015, 13.07.2015, 14.07.2015, 15.07.2015, 16.07.2015, 02.08.2015, 03.08.2015, 04.08.2015, 06.08.2015

Amplified sgRNA cassettes are expected to be about 370 bp.
sgRNA cassette Z0 was amplified with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).
sgRNA cassette Z4 was amplified with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).
sgRNA cassette Z35 was successfuly amplified with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)
sgRNA cassette X0 was successfuly amplified with Phusion PCR. (cf. Fig.10d)
sgRNA cassette X4 was successfuly amplified with Phusion PCR. (cf. Fig.10e)
sgRNA cassette X35 was successfuly amplified with Phusion PCR. (cf. Fig.10f)

Many PCRs were necessary to obtain all sgRNAs because of technical problems, such as PCR reactions not working and contamination of most of our tubes. Figures show only the samples that were used in the next steps.

Figure 10a — **Fig.10: Gels of sgRNA cassettes amplified by PCR**
**Fig.10a** - Gel of sgRNA cassette Z0 amplicon (lanes 1-2), successful for both samples
**Fig.10b** - Gel of sgRNA cassette Z4 amplicon, successful for samples in lanes 3 and 4
**Fig.10c** - Gel of sgRNA cassette Z35 amplicon, successful for sample in lane 1
**Fig.10d** - Gel of sgRNA cassette X0 amplicon, successful for sample
**Fig.10e** - Gel of sgRNA cassette X4 amplicon
**Fig.10f** - Gel of sgRNA cassette X35 amplicon, successful for sample
Ladder: 1kb Genruler.

Figure 10b — **Fig.10: Gels of sgRNA cassettes amplified by PCR**
**Fig.10a** - Gel of sgRNA cassette Z0 amplicon (lanes 1-2), successful for both samples
**Fig.10b** - Gel of sgRNA cassette Z4 amplicon, successful for samples in lanes 3 and 4
**Fig.10c** - Gel of sgRNA cassette Z35 amplicon, successful for sample in lane 1
**Fig.10d** - Gel of sgRNA cassette X0 amplicon, successful for sample
**Fig.10e** - Gel of sgRNA cassette X4 amplicon
**Fig.10f** - Gel of sgRNA cassette X35 amplicon, successful for sample
Ladder: 1kb Genruler.

Assemble pdCas9-w-sgRNA constructs
Gibson assembly, transformation: 16.07.2015, 17.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 04.08.2015, 05.08.2015
Colony PCR: 17.07.2015, 26.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 30.07.2015, 05.08.2015, 06.08.2015, 07.08.2015

In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.

pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.11a) was confirmed by sequencing to be pdCas9-w-Z0 and to not contain any mutations that may have an effect on its activity. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.11a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. (This sample will be used again in Part 2.)
Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.11b). Sequencing comfirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.11c) and sequencing confirmed that is the case. Sequencing also showed some mutations or deletions in the promoter and/or terminator for these 2 samples. We decided to keep working with these and test whether these mutations are significative with an activity assay.
Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.11d). However, it contains a mutation in the promoter. A 2nd pdCas9-w-X0 without mutations will be constructed in part 2, after which we will be able to compare the activity of this promoter with/without a mutation.
Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.11e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4 and that it does not contain any mutations.
Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.11d) and no mutations were found in the sequence.

Figure 11a — **Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products**
**Fig.11a** - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.
**Fig.11b** - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies
**Fig.11c** - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others
**Fig.11d** - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.
**Fig.11e** - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.
Ladder: 1kb Generuler.

Figure 11b — **Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products**
**Fig.11a** - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.
**Fig.11b** - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies
**Fig.11c** - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others
**Fig.11d** - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.
**Fig.11e** - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.
Ladder: 1kb Generuler.

Part 2: Assemble pdCas9-w-sgRNA + sgRNA
24.08.2015 - 02.09.2015

Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR
24.08.2015, 25.08.2015, 28.08.2015, 31.08.2015

Amplified sgRNA cassettes (Z4, Z35, X4 and X35) are expected to be 400 bp. All were successfully amplified (cf. Fig.12a and Fig.12b).
Amplified pdCas9-w-sgRNA (Z0, Z4, X0 and X4) are expected to be about 7000 bp. All were successfully amplified (cf. Fig.12a and Fig.12b).

Figure 12a — **Fig.12** - Gels of PCR products of pdCas9-w-sgRNA and sgRNA cassettes
**Fig.12a** - Gel of PCR products for the construction of pdCas9-w-sgRNA: pdCas9-w-Z0 (lane 1), pdCas9-w-Z4 (lane 2), sgRNA Z4 (lane 3), pdCas9-w-X0 (lane 4), pdCas9-w-X4 (lane 5) and sgRNA X4 (lane 6), all were successfully amplified.
**Fig.12b** - Gel of PCR products for the construction of pAraC-sgRNA (see below): pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 (lanes 3+5, different primers), sgRNA Z4 (lanes 4+6, different primers), successfully amplified. Gel of PCR products for the construction of pdCas9-w-sgRNA: sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), all successfully amplified.
Ladder: 1kb Generuler.

Figure 12b — **Fig.12** - Gels of PCR products of pdCas9-w-sgRNA and sgRNA cassettes
**Fig.12a** - Gel of PCR products for the construction of pdCas9-w-sgRNA: pdCas9-w-Z0 (lane 1), pdCas9-w-Z4 (lane 2), sgRNA Z4 (lane 3), pdCas9-w-X0 (lane 4), pdCas9-w-X4 (lane 5) and sgRNA X4 (lane 6), all were successfully amplified.
**Fig.12b** - Gel of PCR products for the construction of pAraC-sgRNA (see below): pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 (lanes 3+5, different primers), sgRNA Z4 (lanes 4+6, different primers), successfully amplified. Gel of PCR products for the construction of pdCas9-w-sgRNA: sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), all successfully amplified.
Ladder: 1kb Generuler.

Assemble pdCas9-w-sgRNA-sgRNA constructs
Gibson assembly, transformation: 26.08.2015, 31.08.2015. Colony PCR: 31.08.2015, 02.09.2015

Colony PCR primers are placed such as amplicons are 724 bp if Gibson assembly worked and are 390 bp if it did not (self-ligation). All necessary constructs were successfuly obtained. Following colonies were kept for our constructs: colony #1 for pdCas9-w-Z0-Z4 (cf. Fig.13a), colony #4 (2nd attempt) for pdCas9-w-Z0-Z35 (cf. Fig.13c), colony #6 for pdCas9-w-Z4-Z35 (cf. Fig.13b), colony #4 for pdCas9-w-X0-X4 (cf. Fig.13c), colony #2 for pdCas9-w-X0-X35 (cf. Fig.13d) and colony #1 for pdCas9-w-X4-X35 (cf. Fig.13e).

Figure 13a — **Fig.13** - Gels of colony PCR of pdCas9-w-sgRNAs
**Fig.13a** - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-2), successful for colony #1, and colony PCR of pdCas9-w-Z0-Z35, self-ligation for all colonies. Ladder: 1kb Generuler.
**Fig.13b** - Gel of colony PCR of pdCas9-w-Z4-Z35, successful for all colonies. Ladder: 2-log DNA ladder.
**Fig.13c** - Gel of colony PCR of pdCas9-w-Z0-Z35 (2nd attempt), successful for colonies #1 and #4, and colony PCR of pdCas9-w-X0-X4 (part 1), successful for colonies #2 and #4. Ladder: 2-log DNA ladder. (09/02/2015)
**Fig.13d** - Gel of colony PCR of pdCas9-w-X0-X4 (part 2), maybe successful for colonies #8, #9 and #10 (gel unclear), and colony PCR of pdCas9-w-X0-X35, successful for colony #2. Ladder: 2-log DNA ladder.
**Fig.13e** - Gel of colony PCR of pdCas9-w-X4-X35, succesful for colony #1 (maybe others, gel unclear). Ladder: 2-log DNA ladder.
Ladder: 1kb Generuler.

Figure 13b — **Fig.13** - Gels of colony PCR of pdCas9-w-sgRNAs
**Fig.13a** - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-2), successful for colony #1, and colony PCR of pdCas9-w-Z0-Z35, self-ligation for all colonies. Ladder: 1kb Generuler.
**Fig.13b** - Gel of colony PCR of pdCas9-w-Z4-Z35, successful for all colonies. Ladder: 2-log DNA ladder.
**Fig.13c** - Gel of colony PCR of pdCas9-w-Z0-Z35 (2nd attempt), successful for colonies #1 and #4, and colony PCR of pdCas9-w-X0-X4 (part 1), successful for colonies #2 and #4. Ladder: 2-log DNA ladder. (09/02/2015)
**Fig.13d** - Gel of colony PCR of pdCas9-w-X0-X4 (part 2), maybe successful for colonies #8, #9 and #10 (gel unclear), and colony PCR of pdCas9-w-X0-X35, successful for colony #2. Ladder: 2-log DNA ladder.
**Fig.13e** - Gel of colony PCR of pdCas9-w-X4-X35, succesful for colony #1 (maybe others, gel unclear). Ladder: 2-log DNA ladder.
Ladder: 1kb Generuler.

Construction of pWJ89alt
05.08.2015 - 13.08.2015

pWJ89alt contains GFP controlled by the promoter J23117alt, which can be activated by dCas9-w bound to sgRNA X4 and inhibited by dCas9-w bound to sgRNA X0 or X35.

Materials and method

Phusion and Q5 PCR (cf. Protocols) pWJ89 wihtout its J23117 promoter with primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89 + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols). pWJ89 was a gift from David Bikard.
Phusion and Q5 PCR J23117alt promoter with primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols). J23117alt was synthesized by IDT.
Gibson assembly of pWJ89alt with purified PCR products pWJ89 (without J23117) and J23117alt promoter + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)
Control with colony PCR (cf. Protocols) with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) + sequencing (Microsynth)

Results

PCR pWJ89
05.08.2015

Successful PCR reactions are expected to yield 4400 bp amplicons.
Both negative control lanes (cf. Fig.14) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.13). We will work with this sample for next steps.

**Fig.14** - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control. Ladder: 1kb Generuler.

PCR J23117alt promoter
05.08.2015

Successful PCR reactions are expected to yield 340 bp amplicons.
Both negative control lanes (cf. Fig.14) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.

**Fig.15** - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control. Ladder: 1kb Generuler.

Gibson assembly of pWJ89alt
Gibson assembly, transformation: 10.08.2015, Colony PCR: 11.08.2015

Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.
Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).

Construction of pAraC-sgRNA
25.08.2015 - 03.09.2015

We made 3 pAraC-sgRNA constructs: pAraC-Z0 and pAraC-Z4 contain sgRNA Z0 or Z4 producing cassettes controlled by promoter pBAD-AraC (positively regulated by arabinose) and pAraC-Z0-Z4 contains sgRNA Z0 producing cassette controlled by promoter pBAD-AraC and sgRNA Z4 producing cassette controlled by promoter pBAD (constitutively active).

Materials and method

Linearize pAraC by Q5 PCR (cf. Protocols) with primers f_opn_pAraC and r_opn_pAraC + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols). pAraC, called pFIF on Addgene, was a gift from Jay Keasling (Addgene plasmid #17565).
Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers as indicated in table below + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)
Gibson assembly of pAraC-sgRNA constructs with purified PCR products pAraC and sgRNA + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)
Control with colony PCR (cf. Protocols) with primers f_Sqc2_CoP_pAraCsgRNAs_sg1 and r_CoP_pAraCsgRNAs primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) + sequencing (Microsynth)

Construct	sgRNA cassette(s)	Forward primer(s) / Reverse primer(s)
pAraC-Z0	Z0	f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAinpAraC
pAraC-Z4	Z4	f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAinpAraC
pAraC-Z0-Z4	Z0 Z4	f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAwoAra f_Gbs_sgRNAwoAra_VS / r_Gbs_sgRNAinpAraC

Results

PCR pAraC and sgRNA
25.08.2015, 26.08.2015

Successfully amplified PCR products should be 5612 bp for pAraC and ??bp for the sgRNAs.
pAraC was successfully amplified and we will use sample #1 for the next steps (cf. Fig.16b). sgRNAs Z0 and Z4 were succefully amplified with different sets of primers, as indicated in table above (cf. Fig.16a).

Figure 16a — **Fig.16** - Gels of pArac and sgRNA PCR products
**Fig.16a** (same as Fig.12b) - Gel of PCR products for the construction of pAraC-sgRNA: pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 and Z4 (1) for pAraC-Z0 and pAraC-Z4 (lanes 3-4), sgRNA Z0 and Z4 (2) for pAraC-Z0-Z4 (lanes 5-6), successfully amplified. Gel of PCR products for the construction of pdCas9-w-sgRNA (see above): sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), all successfully amplified. Ladder: 1kb Generuler.
**Fig.16b** - Gel of pAraC PCR product, both successfully amplified but sample #1 is clearer. Ladder: 1kb Generuler.

Figure 16b — **Fig.16** - Gels of pArac and sgRNA PCR products
**Fig.16a** (same as Fig.12b) - Gel of PCR products for the construction of pAraC-sgRNA: pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 and Z4 (1) for pAraC-Z0 and pAraC-Z4 (lanes 3-4), sgRNA Z0 and Z4 (2) for pAraC-Z0-Z4 (lanes 5-6), successfully amplified. Gel of PCR products for the construction of pdCas9-w-sgRNA (see above): sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), all successfully amplified. Ladder: 1kb Generuler.
**Fig.16b** - Gel of pAraC PCR product, both successfully amplified but sample #1 is clearer. Ladder: 1kb Generuler.

Assemble pAraC-sgRNA constructs
Gibson assembly and transformation: 28.08.2015, 01.09.2015, Colony PCR: 31.08.2015, 02.09.2015

Colony PCR (pictures of gels were lost for technical reasons) and seqeuncing confirmed Gibson assembly was successful for one colony for each construct.

Construction of pWJ89alt_Z4-to-X4
18.08.2015 - 02.09.2015

pWJ89alt_Z4-to-X4 contains a cassette producing sgRNA X4 (activator for J23117alt) controlled by the promoter J23117 and GFP under the J23117alt promoter (corresponds to pWJ89alt).

Materials and method

Open pWJ89alt by restriction digest with AfeI + Agarose gel electrophoresis of 2 µL of digested product (with 1kb Generuler)
Amplify Z4-to-X4 by Q5 PCR (cf. Protocols) with primers f_Gb_pWJ89alt and r_Gb_pWJ89alt + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)
Gibson assembly of pWJ89alt_Z4-to-X4 with linearized pWJ89alt and purified PCR product of Z4-to-X4 + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)
Control with colony PCR (cf. Protocols) with primers f_Cl_pWJ89 and r_Sqc_T2reporter + agarose gel electrophoresis of 2 µL PCR prodcuts + sequencing (Microsynth)

Results

Open pWJ89alt by restriction digest
18.08.2015

Undigested pWJ89alt is expected to migrate faster than digested pWJ89alt. We observe both bands at the same height (cf. Fig.17). As there is a smear for the digested sample, it may have been paritally digested.

**Fig.17** - Gel of pWJ89alt digested by AfeI (lane 1) and undigested (lane 2).Ladder: 1kb Generuler.

PCR Z4-to-X4
19.08.2015

Amplicons should be 425 bp.
We did 4 samples with slightly different thermocylcing settings. All were successfully amplified (cf. Fig.18) and we kept sample in lane 1 for next steps.

**Fig.18** - Gel of Z4-to-X4 PCR products. Different samples had different thermocycling settings. PCR was successful for all samples. Ladder: 1kb Generuler.

Gibson assembly pWJ89alt_Z4-to-X4
Gibson assembly and transformation: 28.08.2015, Colony PCR: 31.08.2015

Primer table

Name	Sequence	Associated part
f_Gbs_pdCas9	CTCGAGTAAGGATCTCCAG	pdCas9
f_Gbs_sgRNA-CtoA	GTCGGCGATGGTGGTAGCTAATTATGTTCCctcgctcactgactcgctac	sgRNA cassettes
f_Gbs_sgRNA-DtoA	CTAGACCTAACTGAGATACTGTCATAGACGctcgctcactgactcgctac	sgRNA cassettes
f_Gbs_sgRNA-A	ctcgctcactgactcgctac	sgRNA cassettes
f_Gbs_w	ACACGCATTGATTTGAGTCA	pWJ66
f_Mt_A2080C_pdCas9-w	TGACTTTTCGcATTCCTTATTATGTTG	pdCas9-w
r_Gbs_pdCas9	GTCACCTCCTAGCTGACTC	pdCas9
r_Gbs_sgRNA-B	tggcatcttccaggaaatc	sgRNA cassettes/td>
r_Gbs_sgRNA-BtoC	GGAACATAATTAGCTACCACCATCGCCGACtggcatcttccaggaaatc	sgRNA cassettes
r_Gbs_sgRNA-BtoD	CGTCTATGACAGTATCTCAGTTAGGTCTAGtggcatcttccaggaaatc	sgRNA cassettes/td>
r_Gbs_w	atttgatgcctggagatccttactcgagTTAACGACGACCTTCAGCA	pWJ66
r_Mt_A2080C_pdCas9-w	AGATTTTTTCAATCTTCTCACG	pdCas9-w
r_Scq_pdCas9_w_sgRNA	ctgatttgagcgtcagat	pdCas9-w-sgRNA

EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits

@@ Line 114: / Line 114: @@
        <h2>Materials and method</h2>
        <ul>
-         <li><b>Open pdCas9-bacteria by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler ladder)</br>pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).</li>
+         <li><b>Open pdCas9-bacteria by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products</br>pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).</li>
-         <li><b>Extract w subunit from pWJ66 by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)</br>pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
+         <li><b>Extract w subunit from pWJ66 by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products</br>pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
-         <li><b>Gibson assembly (cf. Protocols) of pdCas9-w</b> using purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)</br>Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) <b>+</b> restriction digest (Cf. Protocols) of pdCas9-w (isolated by Miniprep (cf.Protocols)) with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products (with 1kb Generuler) <b>+</b> sequencing (Microsynth)</li>
+         <li><b>Gibson assembly (cf. Protocols) of pdCas9-w</b> using purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)</br>Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products <b>+</b> restriction digest (Cf. Protocols) of pdCas9-w (isolated by Miniprep (cf.Protocols)) with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products <b>+</b> sequencing (Microsynth)</li>
          <li><b>Site-directed mutagenesis (cf. Protocols) of dCas9-w</b> with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w (necesary for pdCas9-w to be BioBrick compatible)</br>Control with restriction digest (cf. Protocols) of mutated pdCas9-w (isolated by Miniprep (cf. Protocols)) with EcoRI <b>+</b> sequencing (Microsynth)</li>
        </ul>
@@ Line 131: / Line 131: @@
              <figure>
                <a href="https://static.igem.org/mediawiki/2015/archive/d/d4/20150913161250%21Lab_nb_ecoli_fig1.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/d/d4/20150913161250%21Lab_nb_ecoli_fig1.jpg" alt="Figure 1" style="height:100px"></a>
-               <figcaption><b>Fig.1</b> - Gel of linearized pdCas9</figcaption>
+               <figcaption><b>Fig.1</b> - Gel of pdCas9 linearized by PCR<small>, successful for all 5 samples. Ladder: 1kb Generuler.</small></figcaption>
              </figure>
            </div>
@@ Line 146: / Line 146: @@
              <figure>
                <a href="https://static.igem.org/mediawiki/2015/archive/e/ef/20150913161422%21Lab_nb_ecoli_fig2.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/e/ef/20150913161422%21Lab_nb_ecoli_fig2.jpg" alt="Figure 2" style="height:100px"></a>
-               <figcaption><b>Fig.2</b> - Gel of w subunit extracted from pWJ66</figcaption>
+               <figcaption><b>Fig.2</b> - Gel of w subunit extracted from pWJ66 by PCR<small>, successful for sample in lane 1. Ladder: 1kb Generuler.</small></figcaption>
              </figure>
            </div>
@@ Line 166: / Line 166: @@
                <a href="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fib3c.jpg"><img src="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fib3c.jpg" alt="Figure 3c" style="height:100px"></a>
                <a href="https://static.igem.org/mediawiki/2015/4/4f/Lab_nb_ecoli_fig3d.jpg"><img src="https://static.igem.org/mediawiki/2015/4/4f/Lab_nb_ecoli_fig3d.jpg" alt="Figure 3d" style="height:100px"></a>
-               <figcaption><b>Fig.3</b> - Gels of colony PCR of dCas9-w Gibson assembly products</figcaption>
+               <figcaption><b>Fig.3</b> - Gels of colony PCR of dCas9-w Gibson assembly products<small>, successful for samples 5, 6, 16, 22, 25-28, 30, 31, 37, 41, 43. Ladder: 1kb Generuler.</small></figcaption>
              </figure>
              <figure>
@@ Line 172: / Line 172: @@
                <a href="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg"><img src="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg" alt="Figure 4b" style="height:120px"></a>
                <a href="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg" alt="Figure 4c" style="height:120px"></a>
-               <figcaption><b>Fig.4</b> - Gels of restriction digest of pdCas9-w Gibson assembly products. Each colony is present on gels in triplicates: undigested (7kb but migrates faster than linear DNA), digested by BamHI (6147 bp + 834 bp) and digested by KpnI (4534 bp + 2447 bp).</figcaption>
+               <figcaption><b>Fig.4</b> - Gels of restriction digest of pdCas9-w Gibson assembly products.<small> Each colony is present on gels in triplicates: undigested (7kb but migrates faster than linear DNA), digested by BamHI (6147 bp + 834 bp) and digested by KpnI (4534 bp + 2447 bp). All digestions worked and show that plasmids contain the w subunit. Undigested plasmid for sample 16 is not visible due to a technical error. Ladder: 1kb Generuler.</small></figcaption>
              </figure>
            </div>
@@ Line 256: / Line 256: @@
                  <figure>
                    <a href="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg"><img src="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg" alt="Figure 9" style="height:120px"></a>
-                   <figcaption><b>Fig.9</b> - Gel of digested pdCas9-w (lane 1) and undigested pdCas9-w (lane 2)</figcaption>
+                   <figcaption><b>Fig.9</b> - Gel of pdCas9-w digested by BamHI (lane 1) and undigested (lane 2)<small>. Digested plasmid is lower on gel, which means digestion worked. Ladder: 1kb Generuler.</small></figcaption>
                  </figure>
                </div>
@@ Line 276: / Line 276: @@
                    <a href="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg" alt="Figure 10e" style="height:100px"></a>
                    <a href="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg"><img src="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg" alt="Figure 10f" style="height:100px"></a>
-                   <figcaption><b>Fig.10: Gels of sgRNA cassettes amplified by PCR with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplicon (lanes 1-2), successful for both samples</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplicon, successful for samples in lanes 3 and 4</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplicon, successful for sample in lane 1</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplicon, successful for sample</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplicon</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplicon, successful for sample</small></figcaption>
+                   <figcaption><b>Fig.10: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplicon (lanes 1-2), successful for both samples</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplicon, successful for samples in lanes 3 and 4</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplicon, successful for sample in lane 1</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplicon, successful for sample</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplicon</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplicon, successful for sample</br>Ladder: 1kb Genruler.</small></figcaption>
                  </figure>
                </div>
@@ Line 295: / Line 295: @@
                    <a href="https://static.igem.org/mediawiki/2015/archive/6/64/20150902094918%21Lab_nb_ecoli_fig11d.jpg.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/6/64/20150902094918%21Lab_nb_ecoli_fig11d.jpg" alt="Figure 11d" style="height:100px"></a>
                    <a href="https://static.igem.org/mediawiki/2015/a/ae/Lab_nb_ecoli_fig11e.jpg"><img src="https://static.igem.org/mediawiki/2015/a/ae/Lab_nb_ecoli_fig11e.jpg" alt="Figure 11e" style="height:100px"></a>
-                   <figcaption><b>Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products</b></br><small><b>Fig.11a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.</br><b>Fig.11b</b> - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies</br><b>Fig.11c</b> - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others</br><b>Fig.11d</b> - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.</br><b>Fig.11e</b> - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.</small></figcaption>
+                   <figcaption><b>Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products</b></br><small><b>Fig.11a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.</br><b>Fig.11b</b> - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies</br><b>Fig.11c</b> - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others</br><b>Fig.11d</b> - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.</br><b>Fig.11e</b> - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.</br>Ladder: 1kb Generuler.</small></figcaption>
                  </figure>
                </div>
@@ Line 314: / Line 314: @@
                  <a href="https://static.igem.org/mediawiki/2015/e/eb/Lab_nb_ecoli_fig12a.jpg"><img src="https://static.igem.org/mediawiki/2015/e/eb/Lab_nb_ecoli_fig12a.jpg" alt="Figure 12a" style="height:130px"></a>
                  <a href="https://static.igem.org/mediawiki/2015/e/e5/Lab_nb_ecoli_fig12b.jpg"><img src="https://static.igem.org/mediawiki/2015/e/e5/Lab_nb_ecoli_fig12b.jpg" alt="Figure 12b" style="height:130px"></a>
-                 <figcaption><b>Fig.12</b> - Gels of PCR products of pdCas9-w-sgRNA and sgRNA cassettes</br><small><b>Fig.12a</b> - Gel of PCR products for the construction of pdCas9-w-sgRNA: pdCas9-w-Z0 (lane 1), pdCas9-w-Z4 (lane 2), sgRNA Z4 (lane 3), pdCas9-w-X0 (lane 4), pdCas9-w-X4 (lane 5) and sgRNA X4 (lane 6), all were successfully amplified.</br><b>Fig.12b</b> - Gel of PCR products for the construction of pAraC-sgRNA (see below): pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 (lanes 3+5, different primers), sgRNA Z4 (lanes 4+6, different primers), successfully amplified. Gel of PCR products for the construction of pdCas9-w-sgRNA: sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), all successfully amplified.</figcaption>
+                 <figcaption><b>Fig.12</b> - Gels of PCR products of pdCas9-w-sgRNA and sgRNA cassettes</br><small><b>Fig.12a</b> - Gel of PCR products for the construction of pdCas9-w-sgRNA: pdCas9-w-Z0 (lane 1), pdCas9-w-Z4 (lane 2), sgRNA Z4 (lane 3), pdCas9-w-X0 (lane 4), pdCas9-w-X4 (lane 5) and sgRNA X4 (lane 6), all were successfully amplified.</br><b>Fig.12b</b> - Gel of PCR products for the construction of pAraC-sgRNA (see below): pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 (lanes 3+5, different primers), sgRNA Z4 (lanes 4+6, different primers), successfully amplified. Gel of PCR products for the construction of pdCas9-w-sgRNA: sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), all successfully amplified.</br>Ladder: 1kb Generuler.</figcaption>
                </figure>
              </div>
@@ Line 331: / Line 331: @@
                    <a href="https://static.igem.org/mediawiki/2015/c/cc/Lab_nb_ecoli_fig13d.jpg"><img src="https://static.igem.org/mediawiki/2015/c/cc/Lab_nb_ecoli_fig13d.jpg" alt="Figure 13d" style="height:100px"></a>
                    <a href="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fig13e.jpg"><img src="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fig13e.jpg" alt="Figure 13e" style="height:100px"></a>
-                   <figcaption><b>Fig.13</b> - Gels of colony PCR of pdCas9-w-sgRNAs</br><small><b>Fig.13a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-2), successful for colony #1, and colony PCR of pdCas9-w-Z0-Z35, self-ligation for all colonies. Ladder: 1kb Generuler. (08/31/2015)</br><b>Fig.13b</b> - Gel of colony PCR of pdCas9-w-Z4-Z35, successful for all colonies. Ladder: 2-log DNA ladder. (08/31/2015)</br><b>Fig.13c</b> - Gel of colony PCR of pdCas9-w-Z0-Z35 (2nd attempt), successful for colonies #1 and #4, and colony PCR of pdCas9-w-X0-X4 (part 1), successful for colonies #2 and #4. Ladder: 2-log DNA ladder. (09/02/2015)</br><b>Fig.13d</b> - Gel of colony PCR of pdCas9-w-X0-X4 (part 2), maybe successful for colonies #8, #9 and #10 (gel unclear), and colony PCR of pdCas9-w-X0-X35, successful for colony #2. Ladder: 2-log DNA ladder. (09/02/2015)</br><b>Fig.13e</b> - Gel of colony PCR of pdCas9-w-X4-X35, succesful for colony #1 (maybe others, gel unclear). Ladder: 2-log DNA ladder. (09/02/2015)</small></figcaption>
+                   <figcaption><b>Fig.13</b> - Gels of colony PCR of pdCas9-w-sgRNAs</br><small><b>Fig.13a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-2), successful for colony #1, and colony PCR of pdCas9-w-Z0-Z35, self-ligation for all colonies. Ladder: 1kb Generuler.</br><b>Fig.13b</b> - Gel of colony PCR of pdCas9-w-Z4-Z35, successful for all colonies. Ladder: 2-log DNA ladder.</br><b>Fig.13c</b> - Gel of colony PCR of pdCas9-w-Z0-Z35 (2nd attempt), successful for colonies #1 and #4, and colony PCR of pdCas9-w-X0-X4 (part 1), successful for colonies #2 and #4. Ladder: 2-log DNA ladder. (09/02/2015)</br><b>Fig.13d</b> - Gel of colony PCR of pdCas9-w-X0-X4 (part 2), maybe successful for colonies #8, #9 and #10 (gel unclear), and colony PCR of pdCas9-w-X0-X35, successful for colony #2. Ladder: 2-log DNA ladder.</br><b>Fig.13e</b> - Gel of colony PCR of pdCas9-w-X4-X35, succesful for colony #1 (maybe others, gel unclear). Ladder: 2-log DNA ladder.</br>Ladder: 1kb Generuler.</small></figcaption>
                  </figure>
                </div>
@@ Line 362: / Line 362: @@
                <figure>
                  <a href="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg"><img src="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg" alt="Figure 14" style="height:120px"></a>
-                 <figcaption><b>Fig.14</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control (08/05/2015)</figcaption>
+                 <figcaption><b>Fig.14</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. <small>Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control. Ladder: 1kb Generuler.</small></figcaption>
                </figure>
              </div>
@@ Line 377: / Line 377: @@
                <figure>
                  <a href="https://static.igem.org/mediawiki/2015/6/6a/Lab_nb_ecoli_fig15.jpg"><img src="https://static.igem.org/mediawiki/2015/6/6a/Lab_nb_ecoli_fig15.jpg" alt="Figure 15" style="height:120px"></a>
-                 <figcaption><b>Fig.15</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control (08/05/2015)</figcaption>
+                 <figcaption><b>Fig.15</b> - Gel of pWJ89 amplified without J23117 promoter by PCR.<small> Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control. Ladder: 1kb Generuler.</small></figcaption>
                </figure>
              </div>

Difference between revisions of "Team:EPF Lausanne/Notebook/Ecoli"

Revision as of 16:27, 13 September 2015

E. Coli Laboratory Notebook

Construction of pdCas9-w07.05.2015 - 01.06.2015

Materials and method

Results

Open pdCas9 by PCR07.05.2015, 10.05.2015

Extract w subunit from pWJ66 by PCR07.05.2015

Gibson assembly of pdCas9-wGibson assembly, transformation: 19.05.2015. Colony PCR: 29.05.2015. Restriction analysis: 01.06.2015.

Site-directed mutagenesis of dCas9-w - (date?)

Construction of pdCas9-w-sgRNAs - 08.07.2015 - 02.09.2015

Materials and method

Part 1: Assemble pdCas9-w + sgRNA

Part 2: Assemble pdCas9-w-sgRNA + sgRNA

Results

Part 1: Assemble pdCas9-w + sgRNA08.07.2015 - 07.08.2015

Open pdCas9-w by restriction digest16.07.2015, 19.07.2015, 26.07.2015, 02.08.2015 (repeats)

Amplify sgRNA cassettes by PCR08.07.2015, 09.07.2015, 10.07.2015, 13.07.2015, 14.07.2015, 15.07.2015, 16.07.2015, 02.08.2015, 03.08.2015, 04.08.2015, 06.08.2015

Assemble pdCas9-w-sgRNA constructsGibson assembly, transformation: 16.07.2015, 17.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 04.08.2015, 05.08.2015 Colony PCR: 17.07.2015, 26.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 30.07.2015, 05.08.2015, 06.08.2015, 07.08.2015

Part 2: Assemble pdCas9-w-sgRNA + sgRNA24.08.2015 - 02.09.2015

Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR24.08.2015, 25.08.2015, 28.08.2015, 31.08.2015

Assemble pdCas9-w-sgRNA-sgRNA constructsGibson assembly, transformation: 26.08.2015, 31.08.2015. Colony PCR: 31.08.2015, 02.09.2015

Construction of pWJ89alt05.08.2015 - 13.08.2015

Materials and method

Results

PCR pWJ8905.08.2015

PCR J23117alt promoter05.08.2015

Gibson assembly of pWJ89altGibson assembly, transformation: 10.08.2015, Colony PCR: 11.08.2015

Construction of pAraC-sgRNA25.08.2015 - 03.09.2015

Materials and method

Results

PCR pAraC and sgRNA25.08.2015, 26.08.2015

Assemble pAraC-sgRNA constructsGibson assembly and transformation: 28.08.2015, 01.09.2015, Colony PCR: 31.08.2015, 02.09.2015

Construction of pWJ89alt_Z4-to-X418.08.2015 - 02.09.2015

Materials and method

Results

Open pWJ89alt by restriction digest18.08.2015

PCR Z4-to-X419.08.2015

Gibson assembly pWJ89alt_Z4-to-X4Gibson assembly and transformation: 28.08.2015, Colony PCR: 31.08.2015

Primer table

Construction of pdCas9-w
07.05.2015 - 01.06.2015

Open pdCas9 by PCR
07.05.2015, 10.05.2015

Extract w subunit from pWJ66 by PCR
07.05.2015

Gibson assembly of pdCas9-w
Gibson assembly, transformation: 19.05.2015. Colony PCR: 29.05.2015. Restriction analysis: 01.06.2015.

Part 1: Assemble pdCas9-w + sgRNA
08.07.2015 - 07.08.2015

Open pdCas9-w by restriction digest
16.07.2015, 19.07.2015, 26.07.2015, 02.08.2015 (repeats)

Amplify sgRNA cassettes by PCR
08.07.2015, 09.07.2015, 10.07.2015, 13.07.2015, 14.07.2015, 15.07.2015, 16.07.2015, 02.08.2015, 03.08.2015, 04.08.2015, 06.08.2015

Assemble pdCas9-w-sgRNA constructs
Gibson assembly, transformation: 16.07.2015, 17.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 04.08.2015, 05.08.2015
Colony PCR: 17.07.2015, 26.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 30.07.2015, 05.08.2015, 06.08.2015, 07.08.2015

Part 2: Assemble pdCas9-w-sgRNA + sgRNA
24.08.2015 - 02.09.2015

Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR
24.08.2015, 25.08.2015, 28.08.2015, 31.08.2015

Assemble pdCas9-w-sgRNA-sgRNA constructs
Gibson assembly, transformation: 26.08.2015, 31.08.2015. Colony PCR: 31.08.2015, 02.09.2015

Construction of pWJ89alt
05.08.2015 - 13.08.2015

PCR pWJ89
05.08.2015

PCR J23117alt promoter
05.08.2015

Gibson assembly of pWJ89alt
Gibson assembly, transformation: 10.08.2015, Colony PCR: 11.08.2015

Construction of pAraC-sgRNA
25.08.2015 - 03.09.2015

PCR pAraC and sgRNA
25.08.2015, 26.08.2015

Assemble pAraC-sgRNA constructs
Gibson assembly and transformation: 28.08.2015, 01.09.2015, Colony PCR: 31.08.2015, 02.09.2015

Construction of pWJ89alt_Z4-to-X4
18.08.2015 - 02.09.2015

Open pWJ89alt by restriction digest
18.08.2015

PCR Z4-to-X4
19.08.2015

Gibson assembly pWJ89alt_Z4-to-X4
Gibson assembly and transformation: 28.08.2015, Colony PCR: 31.08.2015