Difference between revisions of "Team:UNITN-Trento/Test"

m
 
(37 intermediate revisions by 2 users not shown)
Line 4: Line 4:
 
 
 
</html>{{UNITN-Trento/globalIncluder}}<html>
 
</html>{{UNITN-Trento/globalIncluder}}<html>
−
<script src="https://2015.igem.org/Template:UNITN-Trento/JSModernizer?action=raw&ctype=text/javascript"></script>
+
−
<script src="https://2015.igem.org/Template:UNITN-Trento/JSscrollTo?action=raw&ctype=text/javascript"></script>
+
 
<script src="https://2015.igem.org/Template:UNITN-Trento/JSnotebookFunctions?action=raw&ctype=text/javascript"></script>
 
<script src="https://2015.igem.org/Template:UNITN-Trento/JSnotebookFunctions?action=raw&ctype=text/javascript"></script>
 
 
Line 28: Line 27:
  
 
<header>
 
<header>
−
<h2><strong>Interlab Study</strong></h2>
+
<h2><strong>InterLab Measurement Study</strong></h2>
−
<p>I have no idea what I'm doing!</p>
+
<p>What happens when GFP meets different promoters? Are they all the same? Here is what we found out!</p>
 
</header>
 
</header>
−
<footer>
+
−
<ul class="buttons">
+
−
<li><p id="interlab_intro_btn" class="button small bstyle1" style="line-height:2em;" onclick="javascript:scrollToID('interlab_intro')"><span class="primary">Introduction</span> <span class="primary">&amp; Achievements</span></p></li> 
+
−
<li><p id="interlab_design_btn" class="button small bstyle3"  onclick="javascript:scrollToID('interlab_design')"><span class="primary">Experimental</span> <span class="primary">Design</span></p></li>
+
−
<li><p id="interlab_protocols_btn" class="button small bstyle5" onclick="javascript:scrollToID('interlab_protocols')"><span class="primary">Experiments</span><span class="primary">&amp; Protocols</span></p></li>
+
−
<li><p id="interlab_final_btn" class="button small bstyle7" style="line-height:2em;" onclick="javascript:scrollToID('interlab_final')"><span class="primary">Final Discussion</span> <span class="primary">&amp; Results</span></p></li>
+
−
</ul>
+
−
+
−
</footer>
+
  
 
</section>
 
</section>
Line 45: Line 36:
 
<article id="main">     
 
<article id="main">     
 
 
−
<section  id="interlab_intro"  class="wrapper style4 container" style="margin-top:1em;">
+
<a class="anchor-off" name="interlab_intro" id="interlab_intro"></a>
 +
<section class="wrapper style4 container" style="margin-top:1em;">
 
 
 
<div class="content">
 
<div class="content">
Line 53: Line 45:
 
</header>
 
</header>
 
   
 
   
−
<p class="wow fadeInDown">The characterization of standard parts has always been one of the main concerns in Synthetic Biology. For this very same reason, iGEM teams from all around the World were suggested to take part in the biggest Measurement Interlab Study ever conducted and the 2015 UNITN iGEM Team answered the call. The goal of this Second International Measurement Interlab Study is to assemble <b>three different devices</b>, each one containing a promoter with a screening plasmid intermediate and collect as many fluorescence data as possible. The three different promoters will differently affect the GFP production and thating plasmid intermediate and collect as iGEM teams are free to use any technique to measure their devices as long the obtained data are solid and reproducible.</p> 
+
 
 
 
<div class="row">
 
<div class="row">
 
<div class="4u 12u(narrower)">
 
<div class="4u 12u(narrower)">
 
<div href="#" class="wow zoomIn rotate-box square-icon">
 
<div href="#" class="wow zoomIn rotate-box square-icon">
−
<span class="rotate-box-icon"><i class="faa flaticon-newspaper11"></i></span>
+
<span class="rotate-box-icon tals"><i class="faa flaticon-up151"></i></span>
−
<div class="rotate-box-info">
+
−
<h4>Clear Data and Protocols</h4>
+
−
<p>We have listed in the &rdquo;InterLab Study&rdquo; page:
+
−
<ul>
+
−
<li>All devices measured for this study</li>
+
−
<li>All protocols developed and adopted</li>
+
−
<li>Sequencing data for all measurements devices</li>
+
−
</ul>
+
−
</p>
+
−
</div>
+
 
</div>
 
</div>
 
</div>  
 
</div>  
 
 
−
<div class="4u 12u(narrower)">
 
−
<div href="#" class="wow zoomIn rotate-box square-icon" style="-moz-animation-delay: 0.2s; -webkit-animation-delay: 0.2s; animation-delay: 0.2s;">
 
−
<span class="rotate-box-icon"><i class="faa flaticon-tools6"></i></span>
 
−
<div class="rotate-box-info">
 
−
<h4><span>3</span> BioBrick devices</h4>
 
−
<p>We used the three BioBrick devices listed in the &rdquo;Required Devices&rdquo; section.</p>
 
−
</div>
 
−
</div>
 
−
</div>
 
−
<div class="4u 12u(narrower)">
 
−
<div href="#" class="wow zoomIn rotate-box square-icon" style="-moz-animation-delay: 0.5s; -webkit-animation-delay: 0.5s; animation-delay: 0.5s;">
 
−
<span class="rotate-box-icon"><i class="faa flaticon-microscope23"></i></span>
 
−
<div class="rotate-box-info">
 
−
<h4><span> 5</span> techniques </h4>
 
−
<p>We used <span class="i_enph italic">in-vivo</span> and <span class="i_enph italic">in-vitro</span> techniques for measuring RNA and proteins levels:
 
−
<ul>
 
−
<li>Plate Reader</li>
 
−
<li>Spectrofluorimeter</li>
 
−
<li>FACS</li>
 
−
<li>RT-qPCR</li>
 
−
<li>Cell-Free Extract</li>
 
−
</ul>
 
−
</p>
 
−
</div>
 
−
</div>
 
−
</div>
 
−
</div>
 
−
 
−
<div class="row">
 
−
<div class="4u 12u(narrower)">
 
−
<div href="#" class="wow zoomIn rotate-box square-icon">
 
−
<span class="rotate-box-icon"><i class="faa flaticon-increasing5"></i></span>
 
−
<div class="rotate-box-info">
 
−
<h4> Statistical Reliability </h4>
 
−
<p>We have three biological replicates for each measurement, with positive and negative controls</p>
 
−
</div>
 
−
</div>
 
−
</div>
 
−
 
−
<div class="4u 12u(narrower)">
 
−
<div href="#" class="wow zoomIn rotate-box square-icon" style="-moz-animation-delay: 0.2s; -webkit-animation-delay: 0.2s; animation-delay: 0.2s;">
 
−
<span class="rotate-box-icon"><i class="faa flaticon-lists10"></i></span>
 
−
<div class="rotate-box-info">
 
−
<h4>Worksheet and Protocol</h4>
 
−
<p>We have completed the InterLab Worksheet and the InterLab Protocol</p>
 
−
</div>
 
−
</div>
 
−
</div>
 
−
<div class="4u 12u(narrower)">
 
−
  <div href="#" class="wow zoomIn rotate-box square-icon" style="-moz-animation-delay: 0.5s; -webkit-animation-delay: 0.5s; animation-delay: 0.5s;">
 
−
<span class="rotate-box-icon"><i class="faa flaticon-lab2"></i></span>
 
−
<div class="rotate-box-info">
 
−
<h4>Technical replicates </h4>
 
−
<p>We have technical replicates for each sample</p>
 
−
</div>
 
−
</div>
 
−
</div>
 
−
</div>
 
 
 
 
 
Line 135: Line 59:
 
</div>  
 
</div>  
 
</section>
 
</section>
−
+
−
<section  id="interlab_design"  class="wrapper style4 container" style="margin-top:1em;">
+
−
+
−
<div class="content">
+
−
<section>
+
−
<header>
+
−
<h3 class="wow fadeInDown">Experimental Design</h3>
+
−
</header>
+
−
+
−
<p class="wow fadeInDown">We used the three mandatory devices for the measurement study:
+
−
<ul class="arrowed">
+
−
<li>Device 1: <a class="i_linker" target="_blank" href="http://parts.igem.org/Part:BBa_J23101">BBa_J23101</a> + <a class="i_linker" href="http://parts.igem.org/Part:BBa_I13504">BBa_I13504</a> in pSB1C3</li>
+
−
<li>Device 2: <a class="i_linker" target="_blank" href="http://parts.igem.org/Part:BBa_J23106">BBa_J23106</a> + <a class="i_linker" href="http://parts.igem.org/Part:BBa_I13504">BBa_I13504</a> in pSB1C3</li>
+
−
<li>Device 3: <a class="i_linker" target="_blank" href="http://parts.igem.org/Part:BBa_J23117">BBa_J23117</a> + <a class="i_linker" href="http://parts.igem.org/Part:BBa_I13504">BBa_I13504</a> in pSB1C3</li>
+
−
<li>Negative control: <a class="i_linker" target="_blank" href="http://parts.igem.org/Part:BBa_R0040">BBa_R0040</a> in psB1C3</li>
+
−
<li>Positive control: <a class="i_linker" target="_blank" href="http://parts.igem.org/Part:BBa_I20270">BBa_I20270</a> in pSB1C3.</li>
+
−
</ul> </p>
+
−
 
+
−
<div class="row">
+
−
<div class="5u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/f/f5/Unitn_pics_interlab_GFP.png"><img src="https://static.igem.org/mediawiki/2015/b/bd/Unitn_pics_interlab_GFP_thumb.jpg" alt="" style="width:100%;"/></a>
+
−
</div>
+
−
+
−
<div class="7u 12u(narrower)">
+
−
<p>The measurement devices were prepared by amplifying the reporter (BBa_I20270) by PCR. The amplified insert was then cut with <span class="i_enph">XbaI</span> and <span class="i_enph">PstI</span> and ligated into the plasmid containing the promoter previously cut with <span class="i_enph">SpEI</span> and <span class="i_enph">PstI</span>. All the devices were confirmed by restriction digestion as well as DNA sequencing.</p>
+
−
</div>
+
−
</div>
+
−
+
−
<div class="row">
+
−
<div class="6u 12u(narrower) rotate-box-superhover"> 
+
−
<h4 class="header4"><div href="#" class="rotate-box square-icon" style="text-align:center;">
+
−
<span class="rotate-box-icon"><i class="faa flaticon-bacteria"></i></span>
+
−
</div><br />In-vivo Measurements </h4> 
+
−
<p>The confirmed devices were then transformed in different bacterial strains of E. Coli, NEB10&beta;, NEB Express, and JM109. Each measurement was taken at the same optical density to allow a more precise comparison of the data. For each device we have 3 biological and 3 technical measurements for each used technique. We measured in vivo fluorescence emission in different ways using Tecan Infinite 200 PRO plate reader, Varian Cary Eclipse spectrofluorimeter, and BD FACSCanto FACS.</p>
+
−
</div>
+
−
+
−
<div class="6u 12u(narrower) rotate-box-superhover"> 
+
−
<h4 class="header4"><div href="#" class="rotate-box square-icon" style="text-align:center;">
+
−
<span class="rotate-box-icon"><i class="faa flaticon-bacteria"></i></span>
+
−
</div><br />In-vitro Measurements </h4>
+
−
+
−
<p>We also focused of transcription since the characterization is about promoters. To do so we we performed RT-qPCR using a BioRad CFX96 Touch&trade; Real-Time PCR Detection System. Additionally, we performed an in vitro characterization study, by measuring the fluorescence intensities of each device with a Cell Free <span class="i_enph italic">E. coli</span> <span class="i_enph">S30</span> Extract System with a Circular DNA Real Time PCR.</p>
+
−
</div> 
+
−
</div> 
+
−
</section>
+
−
</div>
+
−
</section>
+
−
+
−
<section  id="interlab_protocols"  class="wrapper style4 container" style="margin-top:1em;">
+
−
+
−
<div class="content">
+
−
<section>
+
−
<header>
+
−
<h3 class="wow fadeInDown">Experiments &amp; Protocols</h3>
+
−
</header>
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Extraction from the Registry</h4>
+
−
<div style="display:none;">
+
−
<p>All the parts needed for the InterLab Study were extracted from the 2015 iGEM Registry Distribution Kit.</p>
+
−
<table class="standard_table">
+
−
<thead>
+
−
<tr>
+
−
<td>Part ID</td>
+
−
<td>Description</td>
+
−
<td>Plasmid Backbone</td>
+
−
<td>2015 Registry Location</td>
+
−
</tr>
+
−
</thead>
+
−
<tbody>
+
−
<tr>
+
−
<td>BBa_K823005</td>
+
−
<td>Anderson promoter J23101</td>
+
−
<td>pSB1C3</td>
+
−
<td>Plate 1; 20K</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BBa_K823008</td>
+
−
<td>Anderson promoter J23106</td>
+
−
<td>pSB1C3</td>
+
−
<td>Plate 1; 22A</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BBa_K823013</td>
+
−
<td>Anderson promoter J23117</td>
+
−
<td>pSB1C3</td>
+
−
<td>Plate 1; 22K</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BBa_I12504</td>
+
−
<td>RBS + GFP + 2 terminators</td>
+
−
<td>pSB1A2</td>
+
−
<td>Plate 4; 21J</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BBa_R0040</td>
+
−
<td>TetR sequence</td>
+
−
<td>pSB1C3</td>
+
−
<td>Plate 2; 6F</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BBa_I20270</td>
+
−
<td>Promoter MeasKit</td>
+
−
<td>pSB1C3</td>
+
−
<td>Plate 3; 8P</td>
+
−
</tr>
+
−
</tbody>
+
−
</table>
+
−
</div>
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Polymerase Chain Reaction (PCR)</h4>
+
−
+
−
<div class="row" style="display:none;">
+
−
<div class="3u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/a/ae/Unitn_pics_interlab_gel_GFP1.jpg"><img src="https://static.igem.org/mediawiki/2015/a/ae/Unitn_pics_interlab_gel_GFP1.jpg" alt="" style="width:100%; max-width:163px;"/></a>
+
−
</div>
+
−
+
−
<div class="9u 12u(narrower)">
+
−
<p>The reporter gene (i.e. <span class="i_enph">GFPmut3b</span> from part <a class="i_linker" href="http://parts.igem.org/Part:BBa_I13504">BBa_I13504</a>) was amplified using the Phusion polymerase from New England Biolabs and primers matching the prefix and suffix.</p>
+
−
+
−
<p>We used <span class="i_enph quantity">50 ng</span> of template with an annealing temperature of <span class="i_enph quantity">59 &deg;C</span> and an extension time of <span class="i_enph quantity">90 seconds</span>. The PCR was confirmed by electrophoresis and subsequently purified with NucleoSpin Gel and PCR Clean-Up Kit from Macherey-Nigel. <span class="i_enph quantity">125 ng</span> of purified PCR were digested with <span class="i_enph quantity">1 μl</span> of <span class="i_enph">XbaI</span> and <span class="i_enph quantity">1 μl</span> of <span class="i_enph">PstI</span> overnight at <span class="i_enph quantity">37&deg;C</span>. The following morning the sample was treated with 1 ul of <span class="i_enph">DpnI</span> for 2 hour at <span class="i_enph quantity">37&deg;C</span> and the enzymes were deactivated for <span class="i_enph quantity">20 min</span>  at <span class="i_enph quantity">80 &deg;C</span>.</p>
+
−
</div>
+
−
</div>
+
−
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Restriction Digestion of plasmids containing the promoter</h4>
+
−
+
−
<div style="display:none;">
+
−
<p>Each promoter containing plasmid was digested with <span class="i_enph quantity">1 μl</span> of <span class="i_enph">SpeI</span> and <span class="i_enph quantity">1 μl</span> of <span class="i_enph">PstI</span> at <span class="i_enph quantity">37&deg;C</span> overnight. The day after add <span class="i_enph quantity">1 μl</span> of phosphatase (CIP from New England Biolabs) for <span class="i_enph quantity">2 hours</span> at <span class="i_enph quantity">37&deg;C</span>. The enzymes were then heat deactivated.</p>
+
−
+
−
<p>The digestion reactions were assembled in this way:</p>
+
−
<table style="width:40%;" class="standard_table">
+
−
<thead>
+
−
<tr>
+
−
<td class="empty"></td>
+
−
<td>PCR Products</td>
+
−
<td>Plasmids</td>
+
−
</tr>
+
−
</thead>
+
−
<tbody>
+
−
<tr>
+
−
<td>Template</td>
+
−
<td>3000 ng</td>
+
−
<td>2000 ng</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Enzyme 1</td>
+
−
<td>2 µl</td>
+
−
<td>1.5 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Enzyme 2</td>
+
−
<td>2 µl</td>
+
−
<td>1.5 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Buffer (Stock 10X)</td>
+
−
<td>5 µl</td>
+
−
<td>5 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BSA (Stock 10X)</td>
+
−
<td>5 µl</td>
+
−
<td>5 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Water</td>
+
−
<td>Up to 50 µl</td>
+
−
<td>Up to 50 µl</td>
+
−
</tr>
+
−
</tbody>
+
−
</table>
+
−
</div>
+
−
+
−
<h4 class="header4 displayControl" style="position:relative" >Ligation</h4>
+
−
<div style="display:none;">
+
−
<p>The ligation reactions were assembled and incubated at room temperature for <span class="i_enph quantity">1 hour</span> according to the table below:</p>
+
−
+
−
<table class="standard_table">
+
−
<thead>
+
−
<tr>
+
−
<td></td>
+
−
<td>Plasmid: Insert = 1 : 3</td>
+
−
<td>Control</td>
+
−
</tr>
+
−
</thead>
+
−
<tbody>
+
−
<tr>
+
−
<td>Vector</td>
+
−
<td>100 ng</td>
+
−
<td>100 ng</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Insert</td>
+
−
<td>125 ng</td>
+
−
<td>-</td>
+
−
</tr>
+
−
<tr>
+
−
<td>10X Buffer</td>
+
−
<td>2 µl</td>
+
−
<td>2 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Buffer (Stock 10X)</td>
+
−
<td>5 µl</td>
+
−
<td>5 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>T4 - DNA Ligase</td>
+
−
<td>2 µl</td>
+
−
<td>2 µl</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Water</td>
+
−
<td>Up to 20 µl</td>
+
−
<td>Up to 20 µl</td>
+
−
</tr>
+
−
</tbody>
+
−
</table>
+
−
+
−
<div class="row">
+
−
<div class="7u 12u(narrower)">
+
−
<p>Subsequently <span class="i_enph quantity">10 μl</span> of the ligation mixture were transformed and plated into LB-agar plates with the proper antibiotic resistance.</p>
+
−
+
−
<p style="margin-top:1em;" >Correct clones were screened by restriction digestion and confirmed by sequencing:</p>
+
−
<ul class="arrowed" style="margin-bottom:1em;">
+
−
<li>BBa_J23101 + BBa_I13504 <a class="i_linker" target="_blank" style="font-size:0.8em;" href="https://static.igem.org/mediawiki/2015/b/b2/Unitn_fasta_interlab_GFPK05.fasta.txt">[Sequencing Data]</a></li>
+
−
<li>BBa_J23106 + BBa_I13504 <a class="i_linker" target="_blank" style="font-size:0.8em;" href="https://static.igem.org/mediawiki/2015/6/62/Unitn_fasta_interlab_GFPK08.fasta.txt">[Sequencing Data]</a></li>
+
−
<li>BBa_J23117 + BBa_I13504 <a class="i_linker" target="_blank" style="font-size:0.8em;" href="https://static.igem.org/mediawiki/2015/8/83/Unitn_fasta_interlab_GFPK13.fasta.txt">[Sequencing Data]</a></li>
+
−
</ul>
+
−
<p>The confirmed devices were transfected in NEB10&beta;, JM109, NEB Express.</p>
+
−
</div>
+
−
<div class="5u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/f/f0/Unitn_pics_interlab_GFP2.png"><img src="https://static.igem.org/mediawiki/2015/8/8a/Unitn_pics_interlab_GFP2_thumb.jpg" title="Correct clones were screened by restriction digestion" alt="" style="width:100%; max-width:400px;"/></a>
+
−
</div>
+
−
</div>
+
−
</div>
+
−
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Glycerol stocks preparation and Sample Growth  </h4>
+
−
<div style="display:none;">
+
−
<p>A single colony was inoculated with a sterile pipette tip in a test tube with <span class="i_enph quantity">10 ml</span> of LB and antibiotic (1000:1 LB to antibiotic ratio) and placed in the thermoshaker (<span class="i_enph quantity">190 rpm</span>, <span class="i_enph quantity">37°C</span>. When the culture got cloudy</span>, <span class="i_enph quantity">40 ml</span> of LB+antibiotic were added to reach a final volume of <span class="i_enph quantity">50 ml</span>. The cells were grown until an OD600 of <span class="i_enph quantity">0.5</span> and then centrifuged at <span class="i_enph quantity">4100 rpm</span> for <span class="i_enph quantity">10 minutes</span> at <span class="i_enph quantity">4 °C</span>. The supernatant was discarded and the cells were resuspend in <span class="i_enph quantity">5 ml</span> of LB + antibiotic + glycerol (<span class="i_enph quantity">20% v/v</span>). The cells were kept on ice and were promptly aliquoted into <span class="i_enph quantity">200 μl</span> tubes and frozen at <span class="i_enph quantity">-80°C</span> immediately. From this protocol we obtained a <span class="i_enph quantity">10X</span> concentrated glycerol stock for each sample.</p>
+
−
+
−
<p>The glycerol stock was thaw and added into <span class="i_enph quantity">10 ml</span> of LB with antibiotic, giving a  starting culture with an OD600 of <span class="i_enph quantity">0.1</span>. The sample were grown in a <span class="i_enph quantity">50 mL</span> conical  plastic tube in the termoshaker at <span class="i_enph quantity">37°C</span> and were grown until an OD600 <span class="i_enph quantity">0.7</span>. At this  point <span class="i_enph quantity">3 ml</span> of the culture were transferred in a new tube, centrifuged it, and stored at <span class="i_enph quantity">-20°C</span>.</p>
+
−
</div>
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Fluorescence readings:<br/>Tecan INFINITE &reg; 200 PRO Plate Reader  </h4>
+
−
<div style="display:none;" class="row">
+
−
+
−
<div class="5u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/c/c8/Unitn_pics_interlab_graphs_plate_reader.png"><img src="https://static.igem.org/mediawiki/2015/6/65/Unitn_pics_interlab_graphs_plate_reader_thumb.jpg" title="P" alt="" style="width:100%; max-width:500px;"/></a>
+
−
</div>
+
−
<div class="7u 12u(narrower)">
+
−
<p>The cells were thawed and resuspended in <span class="i_enph quantity">3 ml</span> of PBS. An aliquot of <span class="i_enph quantity">150 μl</span> of each sample was placed into a white, flat-bottomed, 96-well Costar Plate (code: 3917) and fluorescence intensities were taken with a Tecan Infinite® 200 Pro Plate Reader (made in Switzerland). Excitation wavelength and emission wavelength were <span class="i_enph quantity">395 nm</span> and <span class="i_enph quantity">509 nm</span>, respectively. The gain was optimized at <span class="i_enph quantity">70 V</span> and kept constant for each sample. PBS was used as blank. To obtain technical replicates, fluorescence intensities were acquired for three aliquots of the same biological sample, keeping the same instrumental conditions. The raw data were adjusted for the blank value and the MEANS across the replicates with their relative standard deviation were plotted.</p>
+
−
</div>
+
−
</div>
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Fluorescence readings:<br/>Cary Eclipse Fluorescence Spectrophotometer  </h4>
+
−
<div style="display:none;" class="row">
+
−
+
−
<div class="7u 12u(narrower)">
+
−
<p>The cells were thaw and resuspended in <span class="i_enph quantity">3 ml</span> of PBS. Each measurement was taken in a clear acrylic cuvette (REF 67.755) with a Cary Eclipse Fluorescence Spectrophotometer (made in USA). The blank was done with PBS. The excitation wavelenght used was <span class="i_enph quantity">395 nm</span> and the spectra were acquired between <span class="i_enph quantity">420 nm</span> to <span class="i_enph quantity">650 nm</span>. The gain was optimized at <span class="i_enph quantity">775 V</span> and kept the same throughout the measurement.</p>
+
−
<p>The fluorescence intensity of the maximum emission wavelenght (<span class="i_enph quantity">514 nm</span>) was adjusted for the blank and the calculated means with relative standard deviations were plotted.</p>
+
−
</div>
+
−
+
−
<div class="5u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/7/7a/Unitn_pics_interlab_graphs_spectrofluorimeter.png"><img src="https://static.igem.org/mediawiki/2015/6/60/Unitn_pics_interlab_graphs_spectrofluorimeter_thumb.jpg" title="P" alt="" style="width:100%; max-width:500px;"/></a>
+
−
</div>
+
−
+
−
</div>
+
−
+
−
<h4 class="header4 displayControl">Fluorescence readings:<br/>BioRad CFX96 TouchTM Real-Time PCR Detection System</h4>
+
−
<div style="display:none;">
+
−
+
−
+
−
<p>The cells were grown from glycerol stock until an OD600 of <span class="i_enph quantity">0.7</span> was reached. Total  RNA was purified by using the Thermo Scientific GeneJET RNA Purification Kit, following the manufacturer`s instructions and subsequently genomic DNA was  removed from the total RNA by using the Thermo Scientific RapidOut DNA Removal Kit, following the manufacturer`s instructions. RNA levels were quantified using NanoDrop 1000 and reverse transcription of cDNA from the RNA template was  performed with Thermo Scientific RevertAid First Strand cDNA Synthesis Kit,  following the manufacturer`s instructions. qPCR reactions were performed with  BioRad CFX96 TouchTM Real-Time PCR Detection System (made in USA) and  assembled as follows:</p>
+
−
+
−
<div class="row">
+
−
<div class="6u 12u(narrower)">
+
−
<table class="standard_table">
+
−
<thead>
+
−
<tr>
+
−
<td>cDNA</td>
+
−
<td>5 ng</td>
+
−
</tr>
+
−
</thead>
+
−
<tbody>
+
−
<tr>
+
−
<td>Primer Fw</td>
+
−
<td>180 ng</td>
+
−
</tr>
+
−
<tr>
+
−
<td>Primer Rv</td>
+
−
<td>180 ng</td>
+
−
</tr>
+
−
<tr>
+
−
<td>BioRad iQ™ SYBR® Green Supermix #1708880</td>
+
−
<td>Up to 10 µl</td>
+
−
</tr>
+
−
</tbody>
+
−
</table>
+
−
</div>
+
−
<div class="6u 12u(narrower)">
+
−
+
−
<table class="standard_table">
+
−
<tbody>
+
−
<tr>
+
−
<td>GFP Primer Fw</td>
+
−
<td>ATGCTTTGCGAGATACCCAG</td>
+
−
</tr>
+
−
<tr>
+
−
<td>GFP Primer Rv</td>
+
−
<td>TGTCTTGTAGTTCCCGTCATC</td>
+
−
</tr>
+
−
<tr>
+
−
<td>idnT Primer Fw</td>
+
−
<td>CTGCCGTTGCGCTGTTTATT</td>
+
−
</tr>
+
−
<tr>
+
−
<td>idnT Primer Rv</td>
+
−
<td>GATTTGCTCGATGGTGCGTC</td>
+
−
</tr>
+
−
</tbody>
+
−
</table>
+
−
<p>Primers were designed for the reporter gene <span class="i_enph italic">GFP_mut3b</span> and for the housekeeping gene <span class="i_enph italic">idnT</span> <span class="lesser">(D-gluconate transporter)</span> as indicated above</p>
+
−
</div>
+
−
</div>
+
−
</div>
+
−
+
−
<h4 class="header4 displayControl">Fluorescence readings:<br/>BD FACSCanto</h4>
+
−
<div style="display:none;">
+
−
+
−
<p>The cells were grown from glycerol stocks as described above. Differently from before when they reached the OD of <span class="i_enph quantity">0.7</span> were not frozen, but were used immediately to measure fluorescence intensity. An aliquot of <span class="i_enph quantity">5 μl</span> of cells was diluted in <span class="i_enph quantity">900 μl</span> of PBS. The instrument used was a BD FACSCanto (made in USA) set with the following parameters:</p>
+
−
<ul  class="arrowed" style="margin-bottom:1em;">
+
−
<li>FSC gain: 525 V</li>
+
−
<li>SSC gain: 403 V</li>
+
−
<li>FITC gain: 510 V</li>
+
−
<li>Flow rate: LOW</li>
+
−
<li>Total number of events in P2: 10000</li>
+
−
</ul>
+
−
<p>Those parameters allowed the instrument to process 900/1500 events per second. We analyzed the raw data and plot the means of three replicates with relative standard deviations.</p>
+
−
+
−
<div class="row">
+
−
<div class="6u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/2/22/Unitn_pics_interlab_graphs_FACS.png"><img src="https://static.igem.org/mediawiki/2015/6/68/Unitn_pics_interlab_graphs_FACS.jpg" title="P" alt="" style="width:100%; max-width:500px;"/></a>
+
−
</div>
+
−
+
−
<div class="6u 12u(narrower)">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/2/21/Unitn_pics_interlab_graphs_FACSJ23117_R0040.png"><img src="https://static.igem.org/mediawiki/2015/e/e5/Unitn_pics_interlab_graphs_FACSJ23117_R0040_thumb.jpg" title="P" alt="" style="width:100%; max-width:500px;"/></a>
+
−
</div>
+
−
</div>
+
−
</div>
+
−
+
−
+
−
<h4 class="header4 displayControl" style="position:relative">Fluorescence readings:<br/>E. coli S30 Extract System for DNA Circular  </h4>
+
−
<div style="display:none;">
+
−
<p>Miniprep DNA was purified and extracted through phenol/chloroform extraction followed by ethanol precipitation. Reactions were set following Promega E. coli S30Extract System Technical Bulletin and were performed using Qiagen Rotor-Gene Q (made in USA). Parameters for this specific experiment were set as follows:</p>
+
−
<ul class="arowed">
+
−
<li>Green channel gain: <span class="i_enph quantity">0.67</span></li>
+
−
<li>Green channel Excitation: <span class="i_enph quantity">365&plusmn;20 nm</span></li>
+
−
<li>Green channel Emission: <span class="i_enph quantity">510&plusmn;5 nm</span></li>
+
−
</ul>
+
−
<p>We analyzed the raw data and plot the means of three replicates over time, with relative standard deviations</p>
+
−
<p style="text-align:center;">
+
−
<a class="fancybox" rel="group" href="https://static.igem.org/mediawiki/2015/6/64/Unitn_pics_interlab_graphs_S30extract.png"><img src="https://static.igem.org/mediawiki/2015/2/2c/Unitn_pics_interlab_graphs_S30extract_thumb.jpg" title="P" alt="" style="width:100%; max-width:800px;"/></a>
+
−
</p>
+
−
</div>
+
−
+
−
</section>
+
−
</div>
+
−
</section> 
+
−
+
−
+
−
<section  id="interlab_final"  class="wrapper style4 container" style="margin-top:1em;">
+
−
+
−
<div class="content">
+
−
<section>
+
−
<header>
+
−
<h3 class="wow fadeInDown">Final Discussion</h3>
+
−
</header>
+
−
+
−
+
−
<h4 class="header4-resume">Our characterization confirmed the relative strength of the promoters</h4>
+
−
<p>J23101/J23106 fluorescence ratios ranged from 2.0 to 4.5, depending on the strain
+
−
and the technique. Differently from the other two promoters, J23117 showed a very
+
−
low GFP production, as it was not detectable by eye or using the trans-illuminator
+
−
and showed little fluorescence with the three techniques used.</p>
+
−
+
−
+
−
<h4 class="header4-resume">Ratios across promoters are kept the same</h4>
+
−
<p>J23101/J23106 fluorescence ratios ranged from 2.0 to 4.5, depending on the strain
+
−
and the technique. Differently from the other two promoters, J23117 showed a very
+
−
low GFP production, as it was not detectable by eye or using the trans-illuminator
+
−
and showed little fluorescence with the three techniques used.</p>
+
−
<h4 class="header4-resume">Different techniques lead to the same results, with different sensitivities</h4>
+
−
<p>The best way to perform a characterization is to use various techniques, hoping to
+
−
end up with the same result. Throughout our experiment we saw that each
+
−
instrument has a specific sensitivity, which alters the output data. The FACS
+
−
happened to be the most accurate among all, due to its extremely high intrinsic
+
−
sentivity. The plate reader also showed a good accuracy while the fluorimeter was
+
−
not able to detect the the wakest promoter from the background noise, due to its low
+
−
intrinsic sensitivity.</p>
+
−
<h4 class="header4-resume">Bacterial strain does matter</h4>
+
−
<p>The three promoters behaved differently in the different bacterial strains used. The
+
−
bacterial strain which gave the highest fluorescence was NEB10Beta cells in all
+
−
cases showed a significant increased expression of the protein, compared to JM109
+
−
and NEB Express. We hypothesized this discordance among strains is due to their
+
−
different genotypes. A different bacterial proteome (i.e. presence/lack of specific
+
−
proteases and/or chaperonins, polymerases efficiency) may alter protein production,
+
−
processing and folding, thus fluorescence emission.</p>
+
−
<h4 class="header4-resume">In vitro conditions mimic the in vivo reality</h4>
+
−
<p>Characterization in vitro using techniques like the cell-free extract and the qPCR
+
−
allows to quantify the promoter strength by measuring transcript level, rather than
+
−
just looking at the protein production. This approach gives a better understanding on
+
−
the promoter`s nature, since it`s well known that the central dogma in biology is not
+
−
always respected.</p>
+
−
+
−
+
−
+
−
</section>
+
−
</div>
+
−
</section> 
+
−
+
 
</article>
 
</article>
 
 
Line 572: Line 75:
 
{
 
{
 
jQuery(ob).addClass('spinnable');  
 
jQuery(ob).addClass('spinnable');  
−
jQuery(ob).next().fadeIn(200);  
+
jQuery(ob).next().fadeIn(100);
 
 
 
}else
 
}else
 
{
 
{
−
jQuery(ob).next().fadeOut(200,function(){jQuery(ob).removeClass('spinnable'); });
+
jQuery(ob).next().fadeOut(100,function(){jQuery(ob).removeClass('spinnable'); });
 
 
 
}
 
}
Line 582: Line 85:
 
 
 
$(function(){
 
$(function(){
−
new WOW().init(); $(".fancybox").fancybox();
+
new WOW().init();
 +
 
jQuery('.displayControl').click(function() {
 
jQuery('.displayControl').click(function() {
 
var me = $(this);
 
var me = $(this);

Latest revision as of 14:24, 17 September 2015

InterLab Measurement Study

What happens when GFP meets different promoters? Are they all the same? Here is what we found out!

The Interlab Measurement Study