Difference between revisions of "Team:SPSingapore/Notebook-Week-8"

Line 135: Line 135:
  
 
<!--------------------new day------------------------------>
 
<!--------------------new day------------------------------>
 +
 +
<tr class = "tablenotebook"><td><div class = "paper">
 +
&#9642; July 12
 +
<br><br>
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Adrian &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Prepared restreak of inv/hly plasmid from original stab culture
 +
</span>
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
</div>
 +
<div style = "border-top: 2px solid turquoise;"></div>
 +
</td>
 +
</tr>
 +
 +
 +
<!--------------------new day------------------------------>
 +
  
 
<tr class = "tablenotebook"><td><div class = "paper">
 
<tr class = "tablenotebook"><td><div class = "paper">
Line 225: Line 252:
  
 
<br><br>
 
<br><br>
 +
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yan Ting & Yun Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Colony PCR of invasin
 +
<br> &#9654; Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.
 +
<br> &#9654; Also constituted dNTP w 2.5mM of each atcg triphosphate.
 +
</span>
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
 +
  
  
Line 272: Line 320:
  
 
<br><br>
 
<br><br>
 +
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yun Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
10am : Placed BBa_K299812 plate in incubator for overnight growth.
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
3pm : 100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.
 +
</span>
 +
 +
</div>
 +
 +
<br><br>
 +
  
  
Line 298: Line 364:
  
 
<br><br>
 
<br><br>
 +
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yan Ting & Yun Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.
 +
<br> Primer conc=0.5 uM, template DNA dissolved in 10ul h20.
 +
<br> Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
100V for 34min. Tubes 1-2: FP-prefix, RP-suffix. 3-4: FP-VF2, RP-VR. 5-6: FP-prefix, RP_Inv_M2. 7-8: RP-suffix, FP_Inv_M1. No template control with FP-prefix, RP-suffix.
 +
<br><i>[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG]</i>.
 +
<br> Gel image saved as “7.17_inv colony.sgd”
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
Results:
 +
<br> &#9654; Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.
 +
<br> &#9654; Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time). Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.
 +
<br> &#9654; No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.
 +
 +
</div>
 +
 +
<br><br>
 +
  
  

Revision as of 19:40, 17 September 2015


Research Notebook

Week 8 (12/7 - 18/7)

▪ July 12

Invasin + Listerolysin    ☀ Adrian ☀

Prepared restreak of inv/hly plasmid from original stab culture


▪ July 13

Anaerobic Promoter    ☀ Yi Han & Yun Ting ☀

Ligation for FNRgfp (4X)
200ng of gfp plasmid (4.36ul)
297.5 ng insert (7:1) 10.3
1ul 10Buffer (53.34)
4ul T4 ligase

Trial run of anaerobe chamber
open sachet to decrease O2 at 3.30pm
takes 2.5h to activate
streak plate of P. putida a strict aerobe and E. coli, facultative aerobe in chamber at 30deg C to grow O/N
P. putida is an obligate aerobe and if chamber works ,it will not grow
E. coli should grow in both conditions
controls grown outside chamber


▪ July 14

Anaerobic Promoter    Invasin + Listerolysin
☀ Yi Han ☀

No colonies for FNRgfp plasmid
Inv Plasmid Verification
buffer 1
EcoRI 0.5
in plasmid 0.5
dH2O 8
Total 10ul


Gel extraction RE digest of EsaR-GFP plasmid
LigationControl
Vector (45ng) 1 1
insert 1 1
Buffer 1 1
dH2O 6 7
ligase 1 1


Transformation of FNRgfp
Anaerobe jar
E. coli grew in both conditions
P putida-> some growth in anaerobe chamber
Proper streak plate in aerobic conditions
Packet runs out after 16 hours


Invasin + Listerolysin    ☀ Yan Ting & Yun Ting ☀

Colony PCR of invasin
▶ Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.
▶ Also constituted dNTP w 2.5mM of each atcg triphosphate.


▪ July 15

Anaerobic Promoter    ☀ Yi Han ☀

FNRgfp-> no colonies after transformation
religation (4X reaction)
200ng of gfp plasmid (4.4ul)
2125ng of insert (8ul)
4ul T4 ligase
55.6 H2O


Anaerobic Promoter    ☀ Yi Han & Chi Yan ☀

Transformation of FNR gfp into 20ul of BL21


Invasin + Listerolysin    ☀ Yun Ting ☀

10am : Placed BBa_K299812 plate in incubator for overnight growth.

3pm : 100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.


▪ July 16

Anaerobic Promoter    ☀ Yi Han ☀

No colonies grew
Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder
▶ Seems to be band shift.


Invasin + Listerolysin    ☀ Yan Ting & Yun Ting ☀

Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.
Primer conc=0.5 uM, template DNA dissolved in 10ul h20.
Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.

100V for 34min. Tubes 1-2: FP-prefix, RP-suffix. 3-4: FP-VF2, RP-VR. 5-6: FP-prefix, RP_Inv_M2. 7-8: RP-suffix, FP_Inv_M1. No template control with FP-prefix, RP-suffix.
[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].
Gel image saved as “7.17_inv colony.sgd”

Results:
▶ Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.
▶ Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time). Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.
▶ No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.


▪ July 17

Anaerobic Promoter    ☀ Chi Yan ☀

RE digest of FNR-GFP fusion PCR with EcoRI and PstI
EcoRI 1
PstI 1
Buffer 5
FNR-GFP from 12/7 in RIP box 1ug -> 2.5ul
H2O 40.5
Total 50
▶ RE for 2 hours at 37 degrees
▶ Direct purification using Promega kit

Overnight ligation (4X reaction)
200ng of gfp plasmid (4.4ul)
400ng of insert (5:1) (4ul)
4ul T4 ligase
8ul T4 ligase buffer
44.1 H2O


ESA Quorum Sensing    ☀ Adrian ☀

Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)
10x T4 DNA ligase Buffer 1ul
Vector 1ul
Insert 5ul
H2O 10ul
T4 DNA ligase 1ul
▶ Reactions were incubated for 30min at room temperature

Transformation
  pSB1A2 esaRBSGFP
  pSB1A2 RNG GFP
  Control cut pSB1A2


Anaerobic Promoter    ☀ Yi Han ☀

For plates on LB alone there was a lawn
For pUC19, the transformation worked, and separated colonies were produced
No colonies were produced for the FNR-gfp plasmid


▪ July 18

Anaerobic Promoter    ☀ Xin Yi ☀

Transformation of FNRGFP ligated product into BL21 (from Chi Yan 17/7)
   1. 3ul pUC19 control +10ul BL21
   2. 20ul Ligation product + 20ul BL21
   3. 5ul Ligation product + 20ul BL21

Plated on LB+amp plates
   40ul of transformed bacteria in SOC media on LB+amp
   20ul of transformed bacteria in SOC media on LB alone


ESA Quorum Sensing    ☀ Adrian ☀

Confirmation of gfp plasmid
RE digest of gfp plasmid with EcoRI/PStI
EcoRI 2ul
PstI 2ul
Buffer 4ul
DNA 10ul
H2O 22ul
Total 40ul


Ran gel, band size was correct
gel extraction -> 101ng/ul

Master plates
RNG - 4 colonies
esaRGFP- 6 colonies