Difference between revisions of "Team:SZU China/Basic parts"
| Line 27: | Line 27: | ||
<br> | <br> | ||
<br> | <br> | ||
| − | <p id="heading"><small> | + | <p id="heading"><small>Basic parts</small></p> |
</div></br> | </div></br> | ||
<br> | <br> | ||
| Line 41: | Line 41: | ||
<div class="blog-post"> | <div class="blog-post"> | ||
| − | <h2 class="blog-post-title"> | + | <h2 class="blog-post-title">Basic parts</h2> |
<div class="content-text"> | <div class="content-text"> | ||
<div class="improved part"> | <div class="improved part"> | ||
| Line 50: | Line 50: | ||
<div class="col-sm-4"> | <div class="col-sm-4"> | ||
<div class="part_name"> | <div class="part_name"> | ||
| − | <h3> | + | <h3>hUPll</h3> |
</div> | </div> | ||
<div class="part_info"> | <div class="part_info"> | ||
| − | <p><a href="http://parts.igem.org/Part: | + | <p><a href="http://parts.igem.org/Part:BBa_K1722000">BBa_K1722000</a><br> |
SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced. | SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced. | ||
</p> | </p> | ||
| Line 63: | Line 63: | ||
<div class="col-sm-4"> | <div class="col-sm-4"> | ||
<div class="part_name"> | <div class="part_name"> | ||
| − | <h3> | + | <h3>TERT</h3> |
</div> | </div> | ||
<div class="part_info"> | <div class="part_info"> | ||
| − | <p><a href="http://parts.igem.org/Part: | + | <p><a href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a><br> |
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012) | hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012) | ||
</p> | </p> | ||
| Line 74: | Line 74: | ||
<div class="col-sm-4"> | <div class="col-sm-4"> | ||
<div class="part_name"> | <div class="part_name"> | ||
| − | <h3> | + | <h3>aatRNA</h3> |
</div> | </div> | ||
<div class="part_info"> | <div class="part_info"> | ||
| − | <p><a href="http://parts.igem.org/Part: | + | <p><a href="http://parts.igem.org/Part:BBa_K1722004">BBa_K1722004</a><br> |
hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out. | hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out. | ||
</p> | </p> | ||
Revision as of 06:37, 18 September 2015
Basic parts
Basic parts
hUPll
BBa_K1722000
SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced.
TERT
BBa_K1722002
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)
aatRNA
BBa_K1722004
hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out.
Other parts
part 4:
ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT
part 5:
ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT