Difference between revisions of "Team:SZU China/Basic parts"

Line 97: Line 97:
 
             hTERT+tRNA Composite:  <a  href="http://parts.igem.org/Part:BBa_K1722010">BBa_K1722010</a><br>
 
             hTERT+tRNA Composite:  <a  href="http://parts.igem.org/Part:BBa_K1722010">BBa_K1722010</a><br>
 
             SV40+Rluc Composite:      <a  href="http://parts.igem.org/Part:BBa_K1722012">BBa_K1722012</a><br>
 
             SV40+Rluc Composite:      <a  href="http://parts.igem.org/Part:BBa_K1722012">BBa_K1722012</a><br>
                 <p>ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT</p>
+
                  
 
             </div>
 
             </div>
 
            
 
            

Revision as of 06:54, 18 September 2015



Parts




Basic parts

hUPll

BBa_K1722000
SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced.

TERT

BBa_K1722002
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)

tRNA

BBa_K1722004
hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out.

Favorite parts


hUPⅡ+AckRS Composite: BBa_K1722007
hTERT+tRNA Composite: BBa_K1722010
SV40+Rluc Composite: BBa_K1722012

All our parts


hUPⅡ+AckRS Composite: BBa_K1722007
hTERT+tRNA Composite: BBa_K1722010
SV40+Rluc Composite: BBa_K1722012