Difference between revisions of "Team:HUST-China/Collaborations"

(Prototype team page)
 
 
(24 intermediate revisions by 7 users not shown)
Line 1: Line 1:
−
{{HUST-China}}
+
<HTML>
−
<html>
+
<head lang="en">
 +
<meta http-equiv="content-type" content="text/html; charset=UTF-8">
 +
<meta charset="UTF-8">
 +
<meta name="viewport" content="width=device-width,initial-scale=1">
  
−
<h2> Collaborations</h2>
+
<title>Team:HUST-China:Collaborations</title>
 +
<link rel="stylesheet" type="text/css" href="https://2015.igem.org/Team:HUST-China/CSS?action=raw&ctype=text/css" />
  
−
<p>
+
<script type="text/javascript" src="https://2015.igem.org/Team:HUST-China/jquery?action=raw&ctype=text/javascript"></script>
−
Sharing and collaboration are core values of iGEM. We encourage you to reach out and work with other teams on difficult problems that you can more easily solve together.
+
−
</p>
+
  
−
<div class="highlightBox">
+
<script type="text/javascript" src="https://2015.igem.org/Team:HUST-China/JS?action=raw&ctype=text/javascript"></script>
 +
<style>
 +
  /*改默认设定*/
 +
#footer-box,#sponsor-box,.shadow3,#content,table,#catlinks {
 +
    background-color: transparent;
 +
}
 +
.mediawiki.ltr.ns-0.ns-subject.page-Team_HUST-China
 +
#globalWrapper #top-section #p-logo a img {
 +
    visibility:hidden;
 +
}
 +
 +
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading, .visualClear{display: none;}
 +
#globalWrapper, #content,#bodyContent { /*-- changes default wiki settings --*/
 +
    width: 100%;
 +
    height: 100%;
 +
    border: 0px;
 +
    background-color: transparent;
 +
    margin: 0px;
 +
    padding: 0px;
 +
  top: 0px;
 +
}
 +
#top_menu_under{height: 0px;}
  
−
<h4> Which other teams can we work with? </h4>
+
html, .wrapper { /*-- changes default wiki settings --*/
−
<p>
+
    width: 100%;
−
You can work with any other team in the competition, including software, hardware, high school and other tracks. You can also work with non-iGEM research groups, but they do not count towards the <a hreef="https://2015.igem.org/Judging/Awards#Medals">iGEM team collaboration gold medal criterion</a>.
+
    height: 100%;
−
</p>
+
    background-color: transparent; 
 +
top: 0px;
 +
}
 +
.viewport, .container {
 +
max-width: 1349px;
 +
          top: 0px;}
  
−
<p>
+
.box{width: 800px;
−
In order to meet the gold medal criteria on helping another team, you must complete this page and detail the nature of your collaboration with another iGEM team.
+
height: auto;
−
</p>
+
padding-top:5px;
−
</div>
+
padding-left: 10px;
 +
padding-right: 10px;
 +
margin-top: 30px;
 +
margin-left: 30px;
 +
margin-bottom: 10px;
 +
border: 2px ridge grey;
 +
  padding-bottom: 10px;
 +
  background-color: #F0FFF0;}
  
−
<p>
+
.picture{ width: 780px;
−
Here are some suggestions for projects you could work on with other teams:
+
    height: auto;
−
</p>
+
        border: 2px ridge grey;
 +
        margin-bottom:5px; }
  
−
<ul>
+
.pizhu{font-size: 14px;
−
<li> Improve the function of another team's BioBrick Part or Device</li>
+
width: 780px;
−
<li> Characterize another team's part </li>
+
text-align: center;}
−
<li> Debug a construct </li>
+
−
<li> Model or simulating another team's system </li>
+
−
<li> Test another team's software</li>
+
−
<li> Help build and test another team's hardware project</li>
+
−
<li> Mentor a high-school team</li>
+
−
</ul>
+
  
 +
#mid{width: 1349px;
 +
margin: 0 auto;}
  
  
−
</div>
+
 
−
</html>
+
      body{ background-color: white;
 +
position: absolute;
 +
margin: 0;
 +
    font-family:Arial,Verdana,Sans-serif;
 +
color: black;
 +
z-index: 0}
 +
 
 +
.header{position: fixed;
 +
    width: 1348px;
 +
                            text-align:center;
 +
  height:200px;
 +
  margin-top: 0px;
 +
  padding-top: 5px;
 +
  background-image: url(https://static.igem.org/mediawiki/2015/d/d7/HUST_daohang.png);
 +
  background-size:100% 100%;
 +
    filter:alpha(opacity:30);opacity:0.95;  -moz-opacity:0.4; -khtml-opacity: 0.4;
 +
  z-index:1;}
 +
 
 +
.first-menu{float: left;
 +
font-size:19px;
 +
    max-width: 20%;
 +
                padding-top:5px;}
 +
 
 +
.other-menu{float: left;
 +
margin-left:1%;
 +
font-size:19px;
 +
    max-width: 20%;
 +
                    padding-top:5px;}
 +
 
 +
 
 +
.navbar .nav > li .dropdown-menu {margin: 0;}
 +
.navbar .nav > li:hover .dropdown-menu {display: block;}
 +
 
 +
a:link,a:visited {
 +
color:#002855;
 +
text-decoration:none;
 +
            }
 +
a:hover,a:active {
 +
color:#007fff;
 +
text-decoration:underline;
 +
}
 +
 
 +
ul.ul{list-style-type:none;
 +
list-style-image: none;
 +
margin-bottom: 0px;
 +
padding-left: 0px;}
 +
li.li{margin-top: 0px;
 +
list-style-image: none;}
 +
 
 +
#maodian ul{list-style-type:none;
 +
margin-bottom: 0px;
 +
padding-left: 0px;
 +
                                margin-left:0px;}
 +
 
 +
 +
#pic{  background-image: url(https://static.igem.org/mediawiki/2015/1/14/HUST_OTHERS_1.JPG
 +
 
 +
);
 +
                width:1349px;
 +
                height:650px;
 +
              float: left;
 +
              z-index: 0;
 +
          background-size: 100%,100%;
 +
          margin-top: 0px;}
 +
 
 +
.title{width: 900px; 
 +
                height:300px;
 +
              margin-left: 18%;
 +
                margin-top:80px;}
 +
    .pic_a img{width: 135px;
 +
    height: 120px;
 +
    }
 +
    .pic_a{float: left;
 +
            margin-top:50px;
 +
            width: 1349px;
 +
            text-align:center;
 +
              }
 +
 
 +
#maodian{float: left;
 +
                    top: 50px;
 +
  position: fixed;
 +
  margin-top: 70px;  
 +
  z-index: -1;
 +
margin-left: 0px; }
 +
#maodian img{ padding-left: 2% ;
 +
width:150px;
 +
height: auto;
 +
}
 +
.btn
 +
{ background-color:#5d96a3;
 +
margin-left: 0px;
 +
width: 200px;
 +
font-size: 16px;
 +
padding-left: 1px;
 +
    }
 +
 
 +
.btn:hover,.btn:active {
 +
color:white;
 +
background-color:#004c6f;}
 +
 
 +
   
 +
    .description {margin-left: 20%;
 +
              margin-right: 20%;
 +
              margin-top: 50px;
 +
              text-align: left;
 +
              float: left;
 +
              font-size:16px;}
 +
    .description p{font-size: 16px;
 +
                        width:809px;}
 +
     
 +
    .dongxi{height:50px;}  
 +
 +
      .scroll{
 +
width:100px;
 +
height:120px;
 +
background-image: url(https://static.igem.org/mediawiki/2015/8/87/Top.png);
 +
background-size: 100% 100%;
 +
position:fixed;
 +
right:10px;
 +
bottom:20px;
 +
cursor:pointer;
 +
opacity:0.6;
 +
}
 +
 +
 
 +
</style>
 +
<!--点击TOP回滚到顶部js如下：-->
 +
<script type="text/javascript">
 +
$(function(){
 +
showScroll();
 +
function showScroll(){
 +
$(window).scroll( function() {
 +
var scrollValue=$(window).scrollTop();
 +
scrollValue > 100 ? $('div[class=scroll]').fadeIn():$('div[class=scroll]').fadeOut();
 +
} );
 +
$('#scroll').click(function(){
 +
$("html,body").animate({scrollTop:0},500);
 +
});
 +
}
 +
})
 +
</script>
 +
<script type="text/javascript">
 +
$(function(){
 +
showdes();
 +
function showdes(){
 +
$('#to_des').click(function(){
 +
$("html,body").animate({scrollTop:700},800);
 +
});
 +
}
 +
})
 +
</script>
 +
 
 +
</head>
 +
 
 +
<body >
 +
<div id="mid">
 +
<!--上栏-->
 +
<div class="container header" style="top:0px">
 +
 +
<!--悬浮菜单-->
 +
<!--悬浮菜单-->
 +
<div class="navbar">
 +
    <div class="navbar-inner">
 +
      <div class="container">
 +
          <ul class="nav">
 +
              <li class="first-menu"><a href="https://2015.igem.org/Team:HUST-China">HOME</a>
 +
                </li>    
 +
                <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Project">PROJECT<b class="caret"></b></a>
 +
                <ul class="dropdown-menu">
 +
                                <li><a href="https://2015.igem.org/Team:HUST-China/Background">Background</a></li>
 +
                <li class="divider"></li>
 +
                <li><a href="https://2015.igem.org/Team:HUST-China/Description">Description</a></li>
 +
                <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Design">Design</a></li>         
 +
                    </ul>
 +
                        </li>
 +
 
 +
                        <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Wetlab">WETLAB<b class="caret"></b></a>
 +
                <ul class="dropdown-menu">
 +
<li><a href="https://2015.igem.org/Team:HUST-China/Results">Results</a></li>
 +
                        <li class="divider"></li>                      
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Experiments">Experiments&protocol</a></li>
 +
                        <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/InterLab Study">InterLab Study</a></li>
 +
                        <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Notebook">Notebook</a></li>     
 +
                    </ul>
 +
                        </li>
 +
 
 +
                        <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Parts">PARTS<b class="caret"></b></a>
 +
                <ul class="dropdown-menu">                        
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Basic_part">Basic Parts</a></li>
 +
                        <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Basic_part#2">Composite Parts</a></li>                          <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Part_Collection">Part Collection</a></li> 
 +
                    </ul>
 +
                        </li>
 +
               
 +
                <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Modeling">MODELING<b class="caret"></b></a>
 +
                            <ul class="dropdown-menu">
 +
                                        <li><a href="https://2015.igem.org/Team:HUST-China/Modeling">Overiew</a></li>
 +
                                        <li class="divider"></li>
 +
                          <li><a href="https://2015.igem.org/Team:HUST-China/Modeling on Cellular Level">Modeling on Cellular Level</a></li>
 +
                          <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Modeling on Ecosystem Level">Modeling on Ecosystem Level</a></li>
 +
                    </ul>
 +
                </li>
 +
 
 +
                               
 +
                <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Practices">HUMAN PRACTICES</a>
 +
                                       
 +
                </li>
 +
 
 +
              <li class="dropdown other-menu" id="accountmenu"><a href="https://2015.igem.org/Team:HUST-China/Safety">OTHERS<b class="caret"></b></a>
 +
                    <ul class="dropdown-menu">
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Safety">Safety</a></li>
 +
                        <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Collaborations">Collaborations</a></li>
 +
                        <li class="divider"></li>
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Attributions">Attributions</a></li>
 +
                        <li class="divider"></li>                   
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Team">Team</a></li>
 +
                        <li class="divider"></li>                   
 +
                        <li><a href="https://2015.igem.org/Team:HUST-China/Achievements">Achievements</a></li>
 +
                    </ul>
 +
              </li>
 +
          </ul>
 +
      </div>
 +
      </div>
 +
    </div>
 +
    <script type="text/javascript">
 +
        $(document).ready(function () {
 +
          $('.dropdown-toggle').dropdown(); }); </script>
 +
</div>
 +
<!--标题栏-->
 +
<div id="pic" >
 +
<img class="title" src="https://static.igem.org/mediawiki/2015/2/2a/HUST_COLLABORATIONS_1.PNG"/>
 +
<br>
 +
<div class="pic_a" >
 +
<h4 align="center" style="color:white"><b>click it~</b></h4>
 +
    <img style="cursor:pointer;" id="to_des" src="https://static.igem.org/mediawiki/2015/8/80/White.png"/>
 +
</div>
 +
</div>
 +
 
 +
   
 +
 
 +
<!--描述-->
 +
 +
    <div align="center" class="description"><a name="1"></a><br>
 +
    <div class="dongxi"></div>
 +
    <h2  align="center"><b>Collaborations</b></h2>
 +
        <p>HUST-China, WHU-China and HZAU-China, three universities located in Wuhan region have been keeping close communications and collaborations these years. This summer, we continue the tradition, we three iGEM teams held a seminar in 29st Jul,    during which we reached the consensus to establish Wuhan iGEM Committee in the future and held conferences and Science Fair at regular intervals to spread the idea of synthesis biology. Moreover we discussed about our project and exchanged some valuable suggestions. Here are the three main collaborations we made this summer.
 +
    </p>
 +
    </div>
 +
       
 +
      <div align="center" class="description"><a name="2"></a><br>
 +
    <div class="dongxi"></div>
 +
    <h3  align="left"><b>Construction of CI-PSB1C3</b></h3>
 +
        <p>We helped WHU team constructing a standardized plasmid C1-pSB1C3. Owing to the limit of time and the cost of fragment’s synthesis, WHU decided to generate a short C1 fragment through anneal of single-stranded DNA then insert it into the pSB1C3 between the restriction sites of XbaI and PstI. But they met difficulties and failed after several attempts. <br>
 +
After discussions and new experiment design, we helped them finish the construction through the following protocol:
 +
1. Mix up 2.5μL primer F and R<br>
 +
2. Put the mixture in PCR Amplifier :<br>
 +
  DNA denateration for 5 minutes<br>
 +
  Annealing for 30 seconds <br>
 +
3. Ligation with pSB1C3(XbaI and PstI digested) for 1h<br>
 +
4. Transformation to E.coli<br>
 +
5. Plasmid extract <br>
 +
    </p>
 +
    <p>
 +
    Notes: <br>
 +
F: <br>
 +
5’  CTAGATTGACAAACAAGATACATTGTATGAAAATACAAGAAAGTTTGTTGAACTAGTAGCGGCCGCCTGCA  3’
 +
<br>
 +
<br>
 +
 
 +
R:<br>
 +
5’  GGCGGCCGCTACTAGTTCAACAAACTTTCTTGTATTTTCATACAATGTATCTTGTTTGTCAAT    3’<br>
 +
 
 +
The result of prime F and R pairing:
 +
<div class="box">
 +
<img class="picture" src="https://static.igem.org/mediawiki/2015/5/55/HUST_Dna.png">
 +
<div class="pizhu">The green part is the cohesive end of XbaI restriction enzyme and the orange part is the cohesive end of PstI</div>
 +
</div>
 +
 
 +
    </p>
 +
    </div>
 +
 
 +
 
 +
    <div align="center" class="description"><a name="3"></a><br>
 +
    <div class="dongxi"></div>
 +
    <h3  align="left"><b>Equipment Sharing</b></h3>
 +
        <p>As this year a 96-well plate is required for parts shipment while the lyophilizer in WHU-China team and HZAU-China team was not working, they ask us for assistance on the lyophilization of samples before shipment. In order to share experimental resources and promote work efficiency, we undertook the job to help them submiting all the samples.
 +
    </p>
 +
    </div>
 +
 
 +
 
 +
<div align="center" class="description"><a name="4"></a><br>
 +
    <div class="dongxi"></div>
 +
    <h3  align="left"><b>Help from HZAU</b></h3>
 +
        <p>We met difficulties when amplifying the reporter BBa_E0040 because of certain unknown factors. Considering the limited time, we turned to HZAU-China iGEM team for help. Finally, with the construction of RBS+GFP-pSB1C3 plasmid generously offered from HZAU, they succeeded inserting the reporter gene GFP with RBS respectively to the downstream of the three ptrp mutants.
 +
    </p>
 +
    </div>
 +
 
 +
 
 +
    <div align="center" class="description"><a name="5"></a><br>
 +
    <div class="dongxi"></div>
 +
    <h3  align="left"><b>Others</b></h3>
 +
        <p>Apart from these collaborations, we also tried to make collaborations away from Wuhan region. For example: We had planned to utilize a device NZAU designed as a fluorescence detector to achieve a part of our characterization work and help them test the accuracy of the device. But it was a pity that we did not achieve the cooperation this year, because we didn’t finish this corresponding reporter plasmid in time. And we also offered some reasonable advise to ZJU team on safety problems of their project, provided the ideas of kill switch in our previous project. But finally after deep considerations, for the reason of not suiting their project, they adopted another kill switch.
 +
    </p>
 +
    </div>
 +
 
 +
 
 +
    <div align="center" class="description"><a name="6"></a><br>
 +
    <div class="dongxi"></div>
 +
    <h3  align="left"><b>Conclusion</b></h3>
 +
        <p><br>All in all, we have achieved several successful collaborations this summer. In the future, we aim at expanding the collaboration region and diversifying the cooperation content, such as helping high school teams with their project.
 +
<br> <br> <br>
 +
 
 +
    </b></p>
 +
    </div>
 +
 +
 
 +
<div class="scroll" id="scroll" style="display:none;"></div>
 +
</div>
 +
    </body>  
 +
  </html>

Latest revision as of 15:52, 18 September 2015

Team:HUST-China:Collaborations


click it~


Collaborations

HUST-China, WHU-China and HZAU-China, three universities located in Wuhan region have been keeping close communications and collaborations these years. This summer, we continue the tradition, we three iGEM teams held a seminar in 29st Jul, during which we reached the consensus to establish Wuhan iGEM Committee in the future and held conferences and Science Fair at regular intervals to spread the idea of synthesis biology. Moreover we discussed about our project and exchanged some valuable suggestions. Here are the three main collaborations we made this summer.


Construction of CI-PSB1C3

We helped WHU team constructing a standardized plasmid C1-pSB1C3. Owing to the limit of time and the cost of fragment’s synthesis, WHU decided to generate a short C1 fragment through anneal of single-stranded DNA then insert it into the pSB1C3 between the restriction sites of XbaI and PstI. But they met difficulties and failed after several attempts.
After discussions and new experiment design, we helped them finish the construction through the following protocol: 1. Mix up 2.5μL primer F and R
2. Put the mixture in PCR Amplifier :
DNA denateration for 5 minutes
Annealing for 30 seconds
3. Ligation with pSB1C3(XbaI and PstI digested) for 1h
4. Transformation to E.coli
5. Plasmid extract

Notes:
F:
5’ CTAGATTGACAAACAAGATACATTGTATGAAAATACAAGAAAGTTTGTTGAACTAGTAGCGGCCGCCTGCA 3’

R:
5’ GGCGGCCGCTACTAGTTCAACAAACTTTCTTGTATTTTCATACAATGTATCTTGTTTGTCAAT 3’
The result of prime F and R pairing:

The green part is the cohesive end of XbaI restriction enzyme and the orange part is the cohesive end of PstI


Equipment Sharing

As this year a 96-well plate is required for parts shipment while the lyophilizer in WHU-China team and HZAU-China team was not working, they ask us for assistance on the lyophilization of samples before shipment. In order to share experimental resources and promote work efficiency, we undertook the job to help them submiting all the samples.


Help from HZAU

We met difficulties when amplifying the reporter BBa_E0040 because of certain unknown factors. Considering the limited time, we turned to HZAU-China iGEM team for help. Finally, with the construction of RBS+GFP-pSB1C3 plasmid generously offered from HZAU, they succeeded inserting the reporter gene GFP with RBS respectively to the downstream of the three ptrp mutants.


Others

Apart from these collaborations, we also tried to make collaborations away from Wuhan region. For example: We had planned to utilize a device NZAU designed as a fluorescence detector to achieve a part of our characterization work and help them test the accuracy of the device. But it was a pity that we did not achieve the cooperation this year, because we didn’t finish this corresponding reporter plasmid in time. And we also offered some reasonable advise to ZJU team on safety problems of their project, provided the ideas of kill switch in our previous project. But finally after deep considerations, for the reason of not suiting their project, they adopted another kill switch.


Conclusion


All in all, we have achieved several successful collaborations this summer. In the future, we aim at expanding the collaboration region and diversifying the cooperation content, such as helping high school teams with their project.