Difference between revisions of "Team:SZU China/Basic parts"

 
(22 intermediate revisions by 4 users not shown)
Line 27: Line 27:
 
<br>
 
<br>
 
<br>
 
<br>
     <p id="heading"><small>Basic parts</small></p>
+
     <p id="heading">Basic parts</p>
 
     </div></br>
 
     </div></br>
 
<br>
 
<br>
Line 36: Line 36:
  
 
      
 
      
      <div class="row">
 
 
        <div class="col-sm-8 blog-main">
 
 
          <div class="blog-post">
 
            <h2 class="blog-post-title">Basic parts</h2>
 
<div class="content-text">
 
      <div class="improved part">
 
 
           <div class="row">
 
           <div class="row">
  
Line 50: Line 42:
 
   <div class="col-sm-4">
 
   <div class="col-sm-4">
 
             <div class="part_name">
 
             <div class="part_name">
                 <h3>hUPll</h3>
+
                 <h3><strong>New Basic Part :</strong> hUPll</h3>
 
             </div>
 
             </div>
 
             <div class="part_info">
 
             <div class="part_info">
 
                 <p><a href="http://parts.igem.org/Part:BBa_K1722000">BBa_K1722000</a><br>   
 
                 <p><a href="http://parts.igem.org/Part:BBa_K1722000">BBa_K1722000</a><br>   
SV40 is a strong promoter with enhancer in the upstream. Rluc is a widely used reporter gene which can produce Renilla Luciferase. However, different from normal Rluc reporter gene, this one is being amber mutated and the mRNA chain being transcriped out has a terminator inside it. In this way, the whole chain of Renilla Luciferase cannot be translated in natural condition. Only with two other composite parts of our project (BBa_K1722010& BBa_K1722010) can Renilla Luciferase protein being produced.
+
hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells. 2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized.  
 
</p>
 
</p>
 
             </div>
 
             </div>
Line 63: Line 55:
 
               <div class="col-sm-4">
 
               <div class="col-sm-4">
 
           <div class="part_name">
 
           <div class="part_name">
               <h3>TERT</h3>
+
               <h3><strong>Another Basic Part :</strong> hTERT</h3>
 
               </div>
 
               </div>
 
               <div class="part_info">
 
               <div class="part_info">
 
                 <p><a href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a><br>
 
                 <p><a href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a><br>
hUPⅡ is a bladder specific promoter that can only drive gene expression in urothelium cells. As the output gene of this recombinant plasmid, AckRS can produce an RNA synthetase which can achieve the attachment of Ack and tRNA. This composite part will perform its function together with two other plasmids (BBa_K1722010& BBa_K1722012)
+
hTERT, which is short for human telomerase reverse transcriptase, is recognized as a cancer specific promoter for various cancers. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells.  
 
</p>
 
</p>
 
                 </div>
 
                 </div>
Line 74: Line 66:
 
             <div class="col-sm-4">
 
             <div class="col-sm-4">
 
             <div class="part_name">
 
             <div class="part_name">
                 <h3>aatRNA</h3>
+
                 <h3><strong>Another Basic Part :</strong> tRNA</h3>
 
             </div>
 
             </div>
 
             <div class="part_info">
 
             <div class="part_info">
 
                 <p><a href="http://parts.igem.org/Part:BBa_K1722004">BBa_K1722004</a><br>
 
                 <p><a href="http://parts.igem.org/Part:BBa_K1722004">BBa_K1722004</a><br>
hTERT is recognized as a cancer specific promoter for various cancers. The tRNA that is expressed by tRNA gene has CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Together with BBa_K1722007 and BBa_K1722012, this genetic circuit can specifically recognize bladder cancer cells and express the therapeutic gene out.
+
This tRNA gene can produce an tRNA with CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Only with this tRNA can the mRNA chain with UAG terminator being fully translated. The aminoacyl-tRNA came from barchaebacteria, and it is generally applied to unnatural amino acid orthogonal system.
 
</p>
 
</p>
 
             </div>
 
             </div>
 
             </div>
 
             </div>
           
+
    </div></br>
     
+
 
              
+
</div>
 +
 
 +
    <div class="container" style="padding:20px;">
 +
 
 +
   
 +
          <div class="row">
 +
 
 +
 
 +
 
 +
    <div class="col-sm-4">
 +
          <div class="part_name">
 +
              <h3><strong>Another Basic Part :</strong> shTERT</h3>
 +
              </div>
 +
             <div class="part_info">
 +
                <p><a href="http://parts.igem.org/Part:BBa_K1722001">BBa_K1722001</a><br> 
 +
shTERT is short for super human telomerase reverse transcriptase, which is improved from hTERT promoter(<a href="http://parts.igem.org/Part:BBa_K404106">BBa_K404106</a>), a cancer specific promoter. Three base pairs in hTERT promoter were mutated and the drive efficiency of the promoter was verified to be increased significantly.
 +
</p>
 
             </div>
 
             </div>
        <div class="other">
 
            <h3>Favorite parts</h3>                               
 
            <p><strong>hUPⅡ+AckRS:</strong><a href="http://parts.igem.org/Part:BBa_K1722007">BBa_K1722007</a></p><br>
 
            <p><strong>hTERT+tRNA:</strong><a href="http://parts.igem.org/Part:BBa_K1722010">BBa_K1722010</a></p><br>
 
            <p><strong>SV40+Rluc:</strong><a href="http://parts.igem.org/Part:BBa_K1722012">BBa_K1722012</a></p><br>
 
                <p>ACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGACGTGTCAGTCAGGCTAGCTAGCT</p>
 
 
             </div>
 
             </div>
 
            
 
            
 +
 +
 +
              <div class="col-sm-4">
 +
          <div class="part_name">
 +
              <h3><strong>Another Basic Part :</strong> Rluc</h3>
 +
              </div>
 +
              <div class="part_info">
 +
                <p><a href="http://parts.igem.org/Part:BBa_K1722005">BBa_K1722005</a><br>
 +
The Rluc was improved from <a href="http://parts.igem.org/Part:BBa_J52012">BBa_J52012</a>,which was being amber mutated.It can be transcripted to an mRNA chain with one codon being mutated to stop codon UAG. It cannot be fully expressed in natural biology system but can be used as a reporter gene in unnatural amino acid orthogonal system which has a tRNA whose anticodon can pair with the stop codon.
 +
</p>
 +
                </div>
 +
              </div>
 +
           
 +
            <div class="col-sm-4">
 +
          <div class="part_name">
 +
              <h3><strong>Another Basic Part :</strong> SV40</h3>
 +
              </div>
 +
            <div class="part_info">
 +
                  <p><a href="http://parts.igem.org/Part:BBa_K1722006">BBa_K1722006</a><br>
 +
Different from the SV40 promoter distributed by iGEM13_Freiburg(<a href="http://parts.igem.org/Part:BBa_K1150011">BBa_K1150011</a>), the promoter we are submitting this year includes an enhancer sequence(74bp) upstream of the promoter gene. It is a widely used strong promoter that can improve the gene expression level of many host cells. the therapeutic gene out.
 +
</p>
 +
            </div>
 +
            </div>           
 +
    </div></br>
 +
 
</div>
 
</div>
  
     
+
    <div class="container" style="padding:20px;">
       
+
  
   
+
   
 +
          <div class="row">
  
  
 +
 +
  <div class="col-sm-4">
 +
            <div class="part_name">
 +
                <h3><strong>All our parts :</strong></h3>
 +
<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722000">BBa_K1722000</a> : Hupll part<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722001">BBa_K1722001</a> : shTERT part<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722002">BBa_K1722002</a> : hTERT part<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722004">BBa_K1722004</a> : tRNA part <br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722005">BBa_K1722005</a> : Rlu part<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722006">BBa_K1722006</a> : SV40(with enhancer) part<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722007">BBa_K1722007</a> : hUPⅡ+AckRS Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722009">BBa_K1722009</a> : hTERT+GFP Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722010">BBa_K1722010</a> : hTERT+tRNA Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722011">BBa_K1722011</a> : shTERT+tRNA Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722012">BBa_K1722012</a> : SV40(with enhancer)+Rluc Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722013">BBa_K1722013</a> : Sv40+Rlu Composite<br>           
 +
            </div>
 +
            </div>
 +
         
 +
 +
 +
              <div class="col-sm-4">
 +
          <div class="part_name">
 +
              <h3><strong>Favorite parts :</strong> </h3>
 +
<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722007">BBa_K1722007</a> : hUPⅡ+AckRS Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722010">BBa_K1722010</a> : hTERT+tRNA Composite<br>
 +
            <a  href="http://parts.igem.org/Part:BBa_K1722012">BBa_K1722012</a> : SV40(with enhancer)+Rluc Composite<br>     
 +
</p>
 +
                </div>
 +
              </div>
 +
           
 +
           
 +
</p>
 +
            </div>
 +
            </div>           
 +
                   
 +
<br>
 +
<br>         
 +
<br>
 +
<br>
 +
     
 +
       
 +
 
 
       </div><!-- /.row -->
 
       </div><!-- /.row -->
  
Line 109: Line 181:
 
</body>
 
</body>
 
</html>
 
</html>
 +
{{Template:SZU_China/Playground/footer}}

Latest revision as of 22:46, 18 September 2015



Basic parts




New Basic Part : hUPll

BBa_K1722000
hUPll is a bladder tissue-specific promoter being found in human urothelium. Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells. 2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized.

Another Basic Part : hTERT

BBa_K1722002
hTERT, which is short for human telomerase reverse transcriptase, is recognized as a cancer specific promoter for various cancers. Researches show that hTERT promoters are activated in tumor cells that are telomerase positive while being inhibited in normal cells that are telomerase negative, which indicates that hTERT promoter may specifically target at tumor cells.

Another Basic Part : tRNA

BBa_K1722004
This tRNA gene can produce an tRNA with CUA as its anticodon, which can pair with the amber mutated stop codon UAG in the mRNA chain to continue the translation of the amber mutated mRNA. Only with this tRNA can the mRNA chain with UAG terminator being fully translated. The aminoacyl-tRNA came from barchaebacteria, and it is generally applied to unnatural amino acid orthogonal system.


Another Basic Part : shTERT

BBa_K1722001
shTERT is short for super human telomerase reverse transcriptase, which is improved from hTERT promoter(BBa_K404106), a cancer specific promoter. Three base pairs in hTERT promoter were mutated and the drive efficiency of the promoter was verified to be increased significantly.

Another Basic Part : Rluc

BBa_K1722005
The Rluc was improved from BBa_J52012,which was being amber mutated.It can be transcripted to an mRNA chain with one codon being mutated to stop codon UAG. It cannot be fully expressed in natural biology system but can be used as a reporter gene in unnatural amino acid orthogonal system which has a tRNA whose anticodon can pair with the stop codon.

Another Basic Part : SV40

BBa_K1722006
Different from the SV40 promoter distributed by iGEM13_Freiburg(BBa_K1150011), the promoter we are submitting this year includes an enhancer sequence(74bp) upstream of the promoter gene. It is a widely used strong promoter that can improve the gene expression level of many host cells. the therapeutic gene out.


All our parts :


BBa_K1722000 : Hupll part
BBa_K1722001 : shTERT part
BBa_K1722002 : hTERT part
BBa_K1722004 : tRNA part
BBa_K1722005 : Rlu part
BBa_K1722006 : SV40(with enhancer) part
BBa_K1722007 : hUPⅡ+AckRS Composite
BBa_K1722009 : hTERT+GFP Composite
BBa_K1722010 : hTERT+tRNA Composite
BBa_K1722011 : shTERT+tRNA Composite
BBa_K1722012 : SV40(with enhancer)+Rluc Composite
BBa_K1722013 : Sv40+Rlu Composite

Favorite parts :


BBa_K1722007 : hUPⅡ+AckRS Composite
BBa_K1722010 : hTERT+tRNA Composite
BBa_K1722012 : SV40(with enhancer)+Rluc Composite