Difference between revisions of "Team:SPSingapore/Notebook-Week-8"

 
(13 intermediate revisions by the same user not shown)
Line 64: Line 64:
 
<div id='cssmenu'>
 
<div id='cssmenu'>
 
<ul>
 
<ul>
−
  <li><a href='https://2015.igem.org/Team:SPSingapore/'><span>Home</span></a></li>
+
<li class = 'active'><a href='https://2015.igem.org/Team:SPSingapore/'><span>Home</span></a></li>
−
  <li><a href='https://2015.igem.org/Team:SPSingapore/Team'><span>Team</span></a></li>
+
<li><a href='https://2015.igem.org/Team:SPSingapore/Team'><span>Team</span></a>
−
  <li><a href='https://2015.igem.org/Team:SPSingapore/Project'><span>Project</span></a></li>
+
<ul>
−
  <li><a href='https://2015.igem.org/Team:SPSingapore/Protocol'><span>Protocol</span></a></li>
+
<li><a href="https://2015.igem.org/Team:SPSingapore/Team">Overview</a></li>
−
  <li><a href='https://2015.igem.org/Team:SPSingapore/Parts'><span>Parts</span></a></li>
+
<li><a href="https://igem.org/Team.cgi?id=1804">Official Profile</a></li>
−
  <li class = 'active'><a href='https://2015.igem.org/Team:SPSingapore/Notebook'><span>Notebook</span></a></li>
+
        <li><a href="https://2015.igem.org/Team:SPSingapore/Team Bios">Team Bios</a></li>
−
  <li><a href='https://2015.igem.org/Team:SPSingapore/Practices'><span>Human Practices</span></a></li>
+
        <li><a href="https://2015.igem.org/Team:SPSingapore/Mentors">Mentors</a></li>
−
  <li class='last'><a href='https://2015.igem.org/Team:SPSingapore/Safety'><span>Safety</span></a></li>
+
        <li><a href="https://2015.igem.org/Team:SPSingapore/Attributions">Attributions</a></li>
 +
</ul>
 +
</li>
 +
<li><a href='https://2015.igem.org/Team:SPSingapore/Project'><span>Project</span></a>
 +
<ul>
 +
<li><a href='https://2015.igem.org/Team:SPSingapore/Project'>Overview</a></li>
 +
        <li><a href="https://2015.igem.org/Team:SPSingapore/Invasin">Invasin + Listerolysin</a></li>
 +
        <li><a href="https://2015.igem.org/Team:SPSingapore/ESAQS">esa Quorum Sensing</a></li>
 +
        <li><a href="https://2015.igem.org/Team:SPSingapore/Anaerobic Promoter">Anaerobic Promoter</a></li>
 +
        <li><a href="https://2015.igem.org/Team:SPSingapore/Parts">Parts</a></li>
 +
</ul>
 +
</li>
 +
<li><a href='https://2015.igem.org/Team:SPSingapore/Notebook'><span>Notebook</span></a>
 +
<ul>
 +
<li><a href="https://2015.igem.org/Team:SPSingapore/Protocol">Protocols</a></li>
 +
        <li><a href="https://2015.igem.org/Team:SPSingapore/Notebook">Entries</a></li>
 +
</ul>
 +
</li>
 +
<li><a href='https://2015.igem.org/Team:SPSingapore/Practices'><span>Human Practices</span></a>
 +
<ul>
 +
<li><a href="https://2015.igem.org/Team:SPSingapore/Practices">Overview</a></li>
 +
<li><a href="https://2015.igem.org/Team:SPSingapore/Workshop">Workshop</a></li>
 +
<li><a href="https://2015.igem.org/Team:SPSingapore/Workshop Materials">Workshop Materials</a></li>
 +
        <li><a href="https://2015.igem.org/Team:SPSingapore/Interview">Consultations</a></li>
 +
</ul>
 +
</li>
 +
<li><a href='https://2015.igem.org/Team:SPSingapore/Safety'><span>Safety</span></a></li>
 +
<li class='last'><a href='https://2015.igem.org/Team:SPSingapore/Medals'><span>Medals</span></a></li>
 
</ul>
 
</ul>
 
</div>
 
</div>
Line 77: Line 104:
 
<div id='sidemenu' style = "float:left">
 
<div id='sidemenu' style = "float:left">
 
<ul>
 
<ul>
−
 
+
  <li><a href = "https://2015.igem.org/Team:SPSingapore/Notebook"><span>NOTEBOOK</span></a>
−
<li><a href = "https://2015.igem.org/Team:SPSingapore/Notebook"><span>NOTEBOOK</span></a>
+
 
   <ul><li class = 'last'>&nbsp;</li></ul></li>
 
   <ul><li class = 'last'>&nbsp;</li></ul></li>
 
    
 
    
Line 102: Line 128:
 
         <li><a href = "https://2015.igem.org/Team:SPSingapore/Notebook-Week-15"><span>Week 15 (30/8 - 5/9)</span></a></li>
 
         <li><a href = "https://2015.igem.org/Team:SPSingapore/Notebook-Week-15"><span>Week 15 (30/8 - 5/9)</span></a></li>
 
         <li><a href = "https://2015.igem.org/Team:SPSingapore/Notebook-Week-16"><span>Week 16 (6/9 - 12/9)</span></a></li>
 
         <li><a href = "https://2015.igem.org/Team:SPSingapore/Notebook-Week-16"><span>Week 16 (6/9 - 12/9)</span></a></li>
−
         <li class = 'last'><a href = "https://2015.igem.org/Team:SPSingapore/Notebook-Week-17"><span>Week 17 (13/8 - 17/9)</span></a></li>
+
         <li class = 'last'><a href = "https://2015.igem.org/Team:SPSingapore/Notebook-Week-17"><span>Week 17 (13/9 - 18/9)</span></a></li>
 
       </ul>
 
       </ul>
 
   </li>
 
   </li>
Line 135: Line 161:
  
 
<!--------------------new day------------------------------>
 
<!--------------------new day------------------------------>
 +
 +
<tr class = "tablenotebook"><td><div class = "paper">
 +
&#9642; July 12
 +
<br><br>
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Adrian &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Prepared restreak of inv/hly plasmid from original stab culture
 +
</span>
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
</div>
 +
<div style = "border-top: 2px solid turquoise;"></div>
 +
</td>
 +
</tr>
 +
 +
 +
<!--------------------new day------------------------------>
 +
  
 
<tr class = "tablenotebook"><td><div class = "paper">
 
<tr class = "tablenotebook"><td><div class = "paper">
Line 161: Line 214:
 
<br> controls grown outside chamber
 
<br> controls grown outside chamber
 
</span>
 
</span>
−
 
−
 
  
 
</div>
 
</div>
Line 225: Line 276:
  
 
<br><br>
 
<br><br>
 +
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yan Ting & Yun Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Colony PCR of invasin
 +
<br> &#9654; Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.
 +
<br> &#9654; Also constituted dNTP w 2.5mM of each atcg triphosphate.
 +
</span>
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
<span class = "brown"> Anaerobic Promoter</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yi Han & Chi Yan &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
 +
<span class = "nbcontent">
 +
Transformation of ligated FNRgfp plasmid into dH5alpha
 +
<br> Cleaned waterbath, de-iced the fridge. Today, we also did a spring cleaning for the lab
 +
</span>
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
<span class = "black"> esa Quorum Sensing</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Clarice &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
 +
<span class = "nbcontent">
 +
Transformation of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)
 +
<br> plate O/N
 +
</span>
 +
 +
</div>
 +
 +
<br><br>
 +
 +
  
  
Line 273: Line 375:
 
<br><br>
 
<br><br>
  
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yun Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
10am : Placed BBa_K299812 plate in incubator for overnight growth.
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
3pm : 100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.
 +
</span>
 +
 +
</div>
 +
 +
<br><br>
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yan Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
RE digest of the miniprepped inv/hly plasmid with EcoRI/PstI from (20/7)
 +
<br> &#9654; Tube C-> 226ng/ul
 +
<br> &#9654;Tube D-> 298ng/ul
 +
</span>
 +
<br>
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td> Buffer </td><td> 3ul </td></tr>
 +
<tr><td> Plasmid </td><td> 4ul each </td></tr>
 +
<tr><td> EcoRI </td><td> 1ul </td></tr>
 +
<tr><td> PstI </td><td> 1ul </td></tr>
 +
<tr><td> H2O </td><td> 21ul each </td></tr>
 +
<tr><td> Total </td><td> 30ul </td></tr>
 +
</table>
 +
<br>
 +
<span>
 +
<br> &#9654; incubated at 37degC for 2h
 +
<br> &#9654; Add 6X loading dye to stop reaction in both tubes
 +
<br> &#9654; Ran gel (1kb, 100bp, cut vector C, D)
 +
</span>
 +
</div>
 +
 +
<br><br>
  
 
</div>
 
</div>
Line 298: Line 445:
  
 
<br><br>
 
<br><br>
 +
 +
 +
<span class = "blue"> Invasin + Listerolysin</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yan Ting & Yun Ting &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.
 +
<br> Primer conc=0.5 uM, template DNA dissolved in 10ul h20.
 +
<br> Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
100V for 34min. Tubes 1-2: FP-prefix, RP-suffix. 3-4: FP-VF2, RP-VR. 5-6: FP-prefix, RP_Inv_M2. 7-8: RP-suffix, FP_Inv_M1. No template control with FP-prefix, RP-suffix.
 +
<br><i>[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG]</i>.
 +
<br> Gel image saved as “7.17_inv colony.sgd”
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
Results:
 +
<br> &#9654; Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.
 +
<br> &#9654; Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time). Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.
 +
<br> &#9654; No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.
 +
</span>
 +
 +
</div>
 +
 +
<br><br>
 +
  
  
Line 310: Line 485:
  
  
 +
<tr class = "tablenotebook"><td><div class = "paper">
 +
&#9642; July 17
 +
<br><br>
 +
<span class = "brown"> Anaerobic Promoter</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Chi Yan &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
RE digest of FNR-GFP fusion PCR with EcoRI and PstI</span><br>
 +
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td> EcoRI </td><td> 1 </td></tr>
 +
<tr><td> PstI </td><td> 1 </td></tr>
 +
<tr><td> Buffer </td><td> 5 </td></tr>
 +
<tr><td> FNR-GFP from 12/7 in RIP box </td><td> 1ug -> 2.5ul </td></tr>
 +
<tr><td> H2O </td><td> 40.5 </td></tr>
 +
<tr><td> Total </td><td> 50 </td></tr>
 +
</table>
 +
<span>
 +
&#9654; RE for 2 hours at 37 degrees
 +
<br> &#9654; Direct purification using Promega kit
 +
</span>
 +
<br><br>
 +
 +
<span class = "nbcontent">
 +
Overnight ligation (4X reaction)
 +
</span><br>
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td> 200ng of gfp plasmid (4.4ul) </td></tr>
 +
<tr><td> 400ng of insert (5:1) (4ul) </td></tr>
 +
<tr><td> 4ul T4 ligase </td></tr>
 +
<tr><td> 8ul T4 ligase buffer </td></tr>
 +
<tr><td> 44.1 H2O </td></tr>
 +
</table>
 +
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
<span class = "black"> ESA Quorum Sensing</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Adrian &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)</span><br>
 +
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td> 10x T4 DNA ligase Buffer </td><td> 1ul </td></tr>
 +
<tr><td> Vector </td><td> 1ul </td></tr>
 +
<tr><td> Insert </td><td> 5ul </td></tr>
 +
<tr><td> H2O </td><td> 10ul </td></tr>
 +
<tr><td> T4 DNA ligase </td><td> 1ul </td></tr>
 +
</table>
 +
<span>
 +
&#9654; Reactions were incubated for 30min at room temperature
 +
</span>
 +
<br><br>
 +
 +
<span class = "nbcontent">
 +
Transformation
 +
<br> &emsp; pSB1A2 esaRBSGFP
 +
<br> &emsp; pSB1A2 RNG GFP
 +
<br> &emsp; Control cut pSB1A2
 +
</span>
 +
</div>
 +
 +
<br><br>
 +
 +
<span class = "brown"> Anaerobic Promoter</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Yi Han &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
For plates on LB alone there was a lawn
 +
</span><br>
 +
<span class = "nbcontent">
 +
For pUC19, the transformation worked, and separated colonies were produced
 +
</span><br>
 +
<span class = "nbcontent">
 +
No colonies were produced for the FNR-gfp plasmid
 +
</span>
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
</div>
 +
<div style = "border-top: 2px solid turquoise;"></div>
 +
</td>
 +
</tr>
  
  
Line 315: Line 587:
  
  
 +
<tr class = "tablenotebook"><td><div class = "paper">
 +
&#9642; July 18
 +
<br><br>
 +
<span class = "brown"> Anaerobic Promoter</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Xin Yi &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Transformation of FNRGFP ligated product into BL21 (from Chi Yan 17/7)
 +
<br> &emsp;&emsp; 1. 3ul pUC19 control +10ul BL21
 +
<br> &emsp;&emsp; 2. 20ul Ligation product + 20ul BL21
 +
<br> &emsp;&emsp; 3. 5ul Ligation product + 20ul BL21
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
Plated on LB+amp plates
 +
<br> &emsp;&emsp; 40ul of transformed bacteria in SOC media on LB+amp
 +
<br> &emsp;&emsp; 20ul of transformed bacteria in SOC media on LB alone
 +
</span>
 +
 +
</div>
 +
 +
<br><br>
 +
 +
<span class = "black"> esa Quorum Sensing</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Adrian &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Confirmation of gfp plasmid
 +
</span><br>
 +
<span class = "nbcontent">
 +
RE digest of gfp plasmid with EcoRI/PStI
 +
</span><br>
 +
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td> EcoRI </td><td> 2ul </td></tr>
 +
<tr><td> PstI </td><td> 2ul </td></tr>
 +
<tr><td> Buffer </td><td> 4ul </td></tr>
 +
<tr><td> DNA </td><td> 10ul </td></tr>
 +
<tr><td> H2O </td><td> 22ul </td></tr>
 +
<tr><td> Total </td><td> 40ul </td></tr>
 +
</table>
 +
<br><br>
 +
 +
<span class = "nbcontent">
 +
Ran gel, band size was correct
 +
<br> gel extraction -> 101ng/ul
 +
</span><br><br>
 +
<span class = "nbcontent">
 +
Master plates
 +
<br> RNG - 4 colonies
 +
<br> esaRGFP- 6 colonies
 +
</span><br>
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
<span class = "black"> esa Quorum Sensing</span>
 +
&emsp;&emsp;
 +
<font style = "color:blue;font-weight:bold;font-size:11pt;">&#9728; Adrian &#9728;</font>
 +
<br><br>
 +
<div class = "divnbcontent">
 +
<span class = "nbcontent">
 +
Vector dimer check
 +
<br> 8 colonies were selected from the control plate (26/7)
 +
</span><br>
 +
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td colspan = 2><b> PCR mastermix </b> </td></tr>
 +
<tr><td> H2O </td><td> 222ul </td></tr>
 +
<tr><td> Buffer </td><td> 80ul </td></tr>
 +
<tr><td> MgCl2 </td><td> 32ul </td></tr>
 +
<tr><td> dNTP </td><td> 32ul 1ug </td></tr>
 +
<tr><td> FP_Biobricks_Prefix </td><td> 16ul </td></tr>
 +
<tr><td> RP_Biobricks_Prefix </td><td> 16ul </td></tr>
 +
<tr><td> GoTaq </td><td> 2ul </td></tr>
 +
<tr><td> Total </td><td> 400ul </td></tr>
 +
</table>
 +
<br>
 +
 +
<span class = "nbcontent">
 +
The control plate had plasmids with a 800bp insert
 +
<br> Gel extract was performed on a 2kb band
 +
</span><br><br>
 +
 +
<span class = "nbcontent">
 +
Ligation Troubleshooting
 +
</span><br>
 +
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td colspan = 2><b> Ligation Mastermix </b> </td></tr>
 +
<tr><td> H2O </td><td> 222ul </td></tr>
 +
<tr><td> Buffer </td><td> 80ul </td></tr>
 +
<tr><td> MgCl2 </td><td> 32ul </td></tr>
 +
<tr><td> dNTP </td><td> 32ul </td></tr>
 +
<tr><td> FP_Biobricks_Suffix </td><td> 16ul </td></tr>
 +
<tr><td> RP_Biobricks_Suffix </td><td> 16ul </td></tr>
 +
<tr><td> GoTaq </td><td> 2ul </td></tr>
 +
<tr><td> Total </td><td> 400ul </td></tr>
 +
</table>
 +
<br><br>
 +
 +
<span class = "nbcontent">
 +
Colony PCR
 +
<br> 8 colonies were selected from esaR and RNG each, total 16 colonies
 +
</span><br>
 +
 +
<table class = "nbtable" style = "margin-left:50px;">
 +
<tr><td colspan = 2><b> PCR Mastermix </b> </td></tr>
 +
<tr><td> H2O </td><td> 444ul </td></tr>
 +
<tr><td> Buffer </td><td> 160ul </td></tr>
 +
<tr><td> MgCl2 </td><td> 64ul </td></tr>
 +
<tr><td> dNTP </td><td> 64ul </td></tr>
 +
<tr><td> FP_Biobricks_Suffix </td><td> 32ul </td></tr>
 +
<tr><td> RP_Biobricks_Suffix </td><td> 32ul </td></tr>
 +
<tr><td> GoTaq </td><td> 4ul </td></tr>
 +
<tr><td> Total </td><td> 800ul </td></tr>
 +
</table>
 +
<br><br>
 +
 +
<span class = "nbcontent">
 +
Ran gel
 +
<br>
 +
Lanes:
 +
<br>&emsp;&emsp; 1. Vector Backbone (EcoRI/PstI)
 +
<br>&emsp;&emsp; 2. Control Ligation mix
 +
<br>&emsp;&emsp; 3. esaR ligation mix
 +
<br>&emsp;&emsp; 4. RNG ligation mix
 +
<br>&emsp;&emsp; 5. T4 Ligation buffer
 +
<br>&emsp;&emsp; 6. Blank
 +
</span>
 +
 +
 +
</div>
 +
 +
<br><br>
 +
 +
 +
</div>
 +
<div style = "border-top: 2px solid turquoise;"></div>
 +
</td>
 +
</tr>
  
  
Line 335: Line 753:
  
 
<! ------------------------------- Footer START ------------------------------------------------>
 
<! ------------------------------- Footer START ------------------------------------------------>
 +
  
 
<div id="footer1">
 
<div id="footer1">
Line 340: Line 759:
 
<div class="left_sec">
 
<div class="left_sec">
 
<p>
 
<p>
−
<img src = "https://static.igem.org/mediawiki/2015/a/ab/SPSingapore_Team-Logo-New.png" height = "80px">
+
<img src = "https://static.igem.org/mediawiki/2015/a/ab/SPSingapore_Team-Logo-New.png" height = "60px" style="margin-top:5px;margin-left:-130px;">
 
</p>
 
</p>
 
</div>
 
</div>
 
<div class="right_sec">
 
<div class="right_sec">
 
<p>
 
<p>
−
<img src = "https://static.igem.org/mediawiki/2015/0/05/SPSingapore_NUS-Logo.png" height = "60px" style = "margin-top:10px;margin-right:30px;padding-right:30px;border-right: 3px solid lightgrey;">
+
<img src="https://static.igem.org/mediawiki/2015/0/05/SPSingapore_NUS-Logo.png" height="50px" style="margin-top:10px;margin-right:30px;padding-right:30px;border-right: 3px solid lightgrey;">
−
<img src = "https://static.igem.org/mediawiki/2015/7/72/SPSingapore_SPS-Logo.png" height = "60px" style = "margin-top:10px;margin-right:50px;"></a>
+
<img src="https://static.igem.org/mediawiki/2015/7/72/SPSingapore_SPS-Logo.png" height="50px" style="margin-top:10px;margin-right:30px;">
 
</p>
 
</p>
 
</div>
 
</div>

Latest revision as of 23:18, 18 September 2015


Research Notebook

Week 8 (12/7 - 18/7)

▪ July 12

Invasin + Listerolysin    ☀ Adrian ☀

Prepared restreak of inv/hly plasmid from original stab culture


▪ July 13

Anaerobic Promoter    ☀ Yi Han & Yun Ting ☀

Ligation for FNRgfp (4X)
200ng of gfp plasmid (4.36ul)
297.5 ng insert (7:1) 10.3
1ul 10Buffer (53.34)
4ul T4 ligase

Trial run of anaerobe chamber
open sachet to decrease O2 at 3.30pm
takes 2.5h to activate
streak plate of P. putida a strict aerobe and E. coli, facultative aerobe in chamber at 30deg C to grow O/N
P. putida is an obligate aerobe and if chamber works ,it will not grow
E. coli should grow in both conditions
controls grown outside chamber


▪ July 14

Anaerobic Promoter    Invasin + Listerolysin
☀ Yi Han ☀

No colonies for FNRgfp plasmid
Inv Plasmid Verification
buffer 1
EcoRI 0.5
in plasmid 0.5
dH2O 8
Total 10ul


Gel extraction RE digest of EsaR-GFP plasmid
LigationControl
Vector (45ng) 1 1
insert 1 1
Buffer 1 1
dH2O 6 7
ligase 1 1


Transformation of FNRgfp
Anaerobe jar
E. coli grew in both conditions
P putida-> some growth in anaerobe chamber
Proper streak plate in aerobic conditions
Packet runs out after 16 hours


Invasin + Listerolysin    ☀ Yan Ting & Yun Ting ☀

Colony PCR of invasin
▶ Picked out 8 colonies (marked 1-8) from BBa_K299812 plate stored at 4deg (Adrian, 12/7). Colony PCR using prefix suffix primers for first 4 rxn and universal primers VP & VF2 for last 4 rxn. Used thermocycler "Colony" protocol.
▶ Also constituted dNTP w 2.5mM of each atcg triphosphate.


Anaerobic Promoter    ☀ Yi Han & Chi Yan ☀

Transformation of ligated FNRgfp plasmid into dH5alpha
Cleaned waterbath, de-iced the fridge. Today, we also did a spring cleaning for the lab


esa Quorum Sensing    ☀ Clarice ☀

Transformation of EsaGFP plasmid (30ul BL21 + 5ul ligation reaction)
plate O/N


▪ July 15

Anaerobic Promoter    ☀ Yi Han ☀

FNRgfp-> no colonies after transformation
religation (4X reaction)
200ng of gfp plasmid (4.4ul)
2125ng of insert (8ul)
4ul T4 ligase
55.6 H2O


Anaerobic Promoter    ☀ Yi Han & Chi Yan ☀

Transformation of FNR gfp into 20ul of BL21


Invasin + Listerolysin    ☀ Yun Ting ☀

10am : Placed BBa_K299812 plate in incubator for overnight growth.

3pm : 100V at 30min. Ladder, 4 prefix suffix rxn, 4 universal primers rxn. Saved as “7.15_inv colony”. When I ran for longer (after storing gel at 4deg), the bands were longer but the 250bp marker as well as the primer-dimers are pretty close to dye front.


Invasin + Listerolysin    ☀ Yan Ting ☀

RE digest of the miniprepped inv/hly plasmid with EcoRI/PstI from (20/7)
▶ Tube C-> 226ng/ul
▶Tube D-> 298ng/ul
Buffer 3ul
Plasmid 4ul each
EcoRI 1ul
PstI 1ul
H2O 21ul each
Total 30ul


▶ incubated at 37degC for 2h
▶ Add 6X loading dye to stop reaction in both tubes
▶ Ran gel (1kb, 100bp, cut vector C, D)


▪ July 16

Anaerobic Promoter    ☀ Yi Han ☀

No colonies grew
Ran a gel, FNRgfp pcr, gfp pcr, fnr, 100bp ladder
▶ Seems to be band shift.


Invasin + Listerolysin    ☀ Yan Ting & Yun Ting ☀

Colony PCR of 8 colonies (marked A-H) from BBa_K299812 plate, and also spotted on a save plate. Both plates placed back in incubator.
Primer conc=0.5 uM, template DNA dissolved in 10ul h20.
Thermocycler “colony_inv” protocol, with adjusted extension time and annealing time&temp from standard “colony” protocol.

100V for 34min. Tubes 1-2: FP-prefix, RP-suffix. 3-4: FP-VF2, RP-VR. 5-6: FP-prefix, RP_Inv_M2. 7-8: RP-suffix, FP_Inv_M1. No template control with FP-prefix, RP-suffix.
[Note: RP_M2 = FP_M2. Check future uses agn seq on the primer master file. Just in case, the sequence used in this expt is INV_FP_M2->GCTCATTATAGTCCGCGAAATCACG].
Gel image saved as “7.17_inv colony.sgd”

Results:
▶ Tubes 3&4 with universal primers VF2 VR have a band between 4&5kb - Inv+LLO is 4.1kb, probably are positive colonies.
▶ Tubes 1&2, 5&6 have bands <750bp as well as primer dimers (but the annealing temperature was calculated for prefix suffix primers not universal ones…I’ll try thermo-gradient thermocycler protocol next time). Expected band size for 5&6 (FP-prefix, RP_Inv_M2 (ends 1928)) = 1.9kb.
▶ No bands for tubes 7&8. Expected band size for 7&8 (RP-suffix, FP_Inv_M1 (starts 1046)) = 2.2kb.


▪ July 17

Anaerobic Promoter    ☀ Chi Yan ☀

RE digest of FNR-GFP fusion PCR with EcoRI and PstI
EcoRI 1
PstI 1
Buffer 5
FNR-GFP from 12/7 in RIP box 1ug -> 2.5ul
H2O 40.5
Total 50
▶ RE for 2 hours at 37 degrees
▶ Direct purification using Promega kit

Overnight ligation (4X reaction)
200ng of gfp plasmid (4.4ul)
400ng of insert (5:1) (4ul)
4ul T4 ligase
8ul T4 ligase buffer
44.1 H2O


ESA Quorum Sensing    ☀ Adrian ☀

Ligation of esaRBS-GFP (EcoRI/PstI) and RNG-GFP (EcoRI/PstI) into pSB1A2 (EcoRI/PstI)
10x T4 DNA ligase Buffer 1ul
Vector 1ul
Insert 5ul
H2O 10ul
T4 DNA ligase 1ul
▶ Reactions were incubated for 30min at room temperature

Transformation
  pSB1A2 esaRBSGFP
  pSB1A2 RNG GFP
  Control cut pSB1A2


Anaerobic Promoter    ☀ Yi Han ☀

For plates on LB alone there was a lawn
For pUC19, the transformation worked, and separated colonies were produced
No colonies were produced for the FNR-gfp plasmid


▪ July 18

Anaerobic Promoter    ☀ Xin Yi ☀

Transformation of FNRGFP ligated product into BL21 (from Chi Yan 17/7)
   1. 3ul pUC19 control +10ul BL21
   2. 20ul Ligation product + 20ul BL21
   3. 5ul Ligation product + 20ul BL21

Plated on LB+amp plates
   40ul of transformed bacteria in SOC media on LB+amp
   20ul of transformed bacteria in SOC media on LB alone


esa Quorum Sensing    ☀ Adrian ☀

Confirmation of gfp plasmid
RE digest of gfp plasmid with EcoRI/PStI
EcoRI 2ul
PstI 2ul
Buffer 4ul
DNA 10ul
H2O 22ul
Total 40ul


Ran gel, band size was correct
gel extraction -> 101ng/ul

Master plates
RNG - 4 colonies
esaRGFP- 6 colonies


esa Quorum Sensing    ☀ Adrian ☀

Vector dimer check
8 colonies were selected from the control plate (26/7)
PCR mastermix
H2O 222ul
Buffer 80ul
MgCl2 32ul
dNTP 32ul 1ug
FP_Biobricks_Prefix 16ul
RP_Biobricks_Prefix 16ul
GoTaq 2ul
Total 400ul

The control plate had plasmids with a 800bp insert
Gel extract was performed on a 2kb band

Ligation Troubleshooting
Ligation Mastermix
H2O 222ul
Buffer 80ul
MgCl2 32ul
dNTP 32ul
FP_Biobricks_Suffix 16ul
RP_Biobricks_Suffix 16ul
GoTaq 2ul
Total 400ul


Colony PCR
8 colonies were selected from esaR and RNG each, total 16 colonies
PCR Mastermix
H2O 444ul
Buffer 160ul
MgCl2 64ul
dNTP 64ul
FP_Biobricks_Suffix 32ul
RP_Biobricks_Suffix 32ul
GoTaq 4ul
Total 800ul


Ran gel
Lanes:
   1. Vector Backbone (EcoRI/PstI)
   2. Control Ligation mix
   3. esaR ligation mix
   4. RNG ligation mix
   5. T4 Ligation buffer
   6. Blank