Difference between revisions of "Team:Dundee/Sequences"
(60 intermediate revisions by 3 users not shown) | |||
Line 1: | Line 1: | ||
+ | <!DOCTYPE html> | ||
<html> | <html> | ||
− | |||
+ | <meta name="viewport" content="width=device-width, initial-scale=1.0"> | ||
+ | <head> | ||
+ | <title>Dundee iGEM 2015</title> | ||
+ | <meta name="viewport" content="user-scalable=no, initial-scale=1, maximum-scale=1, minimum-scale=1, width=320, height=device-height, target-densitydpi=medium-dpi" /> | ||
− | + | </head> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
+ | <body> | ||
+ | <header id="header-tubes"> | ||
+ | <a class="anchor" id="top"></a> | ||
+ | <center> | ||
+ | <h1><highlight class="highlight">Sequences</highlight></h1> | ||
+ | </center> | ||
+ | </header> | ||
+ | <div class="ribbon"> | ||
+ | <div class="rows"> | ||
+ | <center> | ||
+ | <table border="1" cellspacing="0" cellpadding="0"> | ||
+ | |||
+ | <tbody color="black"> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <b>Registry - ID</b> <!-- e.g. BBa_K1590000--> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Name</strong> <!--e.g. Haemoglobin A --> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Short Description</strong> <!-- --> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Part of which tool</strong> <!--e.g. FluID - Blood detection--> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Sequences</strong> <!--popup-modal with fasta sequence--> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590000" target="_blank">BBa_K1590000</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i> hHBA</i> (Haemoglobin A - <i>Homo sapiens</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in <i>E.coli</i> K12.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Blood Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_haemoglobina_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_haemoglobina_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590001" target="_blank">BBa_K1590001</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong> <i> hHBB</i> (Haemoglobin B - <i>Homo sapiens</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for Human Haemoglobin B in silico optimised for increased expression level in <i>E.coli</i> K12.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Blood Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_haemoglobinb_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_haemoglobinb_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590002" target="_blank">BBa_K1590002</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i> hHBN</i> (Haptoglobin - <i>Homo sapiens</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for Human Haptoglobin in silico optimised for increased expression level in <i>E.coli</i> K12.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Blood Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_haptoglobin_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_haptoglobin_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <!--Chromate Detection--> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1058008" target="_blank">BBa_K1058008 (BIT-2013)</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>P<i><sub>Chr<i></sub>-<i>ChrB</i>-<i>gfp</i></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Partial sequence of chromate resistance operon of <i>Ochrobactrum tritici</i> 5bvl1, containing a chromate-inducible promoter, P<i><sub>Chr</i></sub>, a repressor, <i>ChrB</i>, and a fluorescent reporter, <i>gfp</i>.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Chromate Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_pchrbgfp_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_pchrbgfp_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590003" target="_blank">BBa_K1590003</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>P<i><sub>Chr</i></sub></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Promoter sequence of chromate resistance operon of <i>Ochrobactrum tritici</i> 5bvl1.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Chromate Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_pchr_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_pchr_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>-</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i>ChrB</i></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for unmodified chromate sensitive repressor of P<i><sub>Chr</i></sub>.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Chromate Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_chrbunmodified_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_chrbunmodified_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590004" target="_blank">BBa_K1590004</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i>ChrB</i>(opt)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for partially optimised chromate sensitive repressor of P<i><sub>Chr</i></sub>.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Chromate Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_chrbopt_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_chrbopt_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>-</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>P<sub><i>Chr</i></sub>- <i>gfp</i></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Sequence of fluorescent reporter-fusion, chromate sensitive promoter + <i>gfp</i>.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Chromate Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_pchrgfp_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_pchrgfp_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <!--Fingerprint Ageing--> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590006" target="_blank">BBa_K1590006</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i>LSS</i> (Lanosterol Synthase - <i>Homo Sapiens</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for Human lanosterol synthase in silico optimised for increased expression level in <i>E. coli</i> K12.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Fingerprint Ageing</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_lanosterolsynthase_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_lanosterolsynthase_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <!--Nasal Mucus Detection--> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590007" target="_blank">BBa_K1590007</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i> OBP2A</i> (Odorant Binding Protein 2A - <i>Homo sapiens</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for Human odorant binding 2A protein in silico optimised for increased expression level in <i>E. coli</i> K12.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Nasal Mucus Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_odorantbindingprotein_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_odorantbindingprotein_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>-</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><OBP2A</i> (Odorant Binding Protein 2A - <i>Homo sapiens</I>) - Helix</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for C-terminal helix of Human odorant binding protein 2A.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Nasal Mucus Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_obphelix_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_obphelix_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>-</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i> OBP2A</i> (Odorant Binding Protein 2A - <i>Homo sapiens</i>) - Barrel</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for N-terminal barrel of Human odorant binding protein 2A.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Nasal Mucus Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_obpbarrel_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_obpbarrel_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <!--Lactoferrin Binding Protein--> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590008" target="_blank">BBa_K1590008</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i> LbpA</i> (Lactoferrin Binding Protein A - <i>Neisseria Meningitidis</i></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for lactoferrin binding protein A.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Saliva Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_lactoferrinbindingprotein_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_lactoferrinbindingprotein_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <!--PotD--> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590009" target="_blank">BBa_K1590009</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i>PotD</i> (<i>Escherichia Coli</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Unmodified coding sequence for <i>E.coli</i> MG1655 Spermidine binding periplasmic protein.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Semen Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_potd_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_potd_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | <!--Spermine Binding Protein--> | ||
+ | <tr> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a href="http://parts.igem.org/Part:BBa_K1590010" target="_blank">BBa_K1590010</a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><i> Sbp</i> (Spermine Binding Protein - <i>Mus Musculus</i>)</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>Coding sequence for murine Spermine Binding Protein in silico optimised for increased expression level in <i>E. coli</i> K12.</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong>FluID - Semen Detection</strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | <td width="312" valign="top"> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_sperminebindingprotein_modal" class="journal-protocol"> Fasta Sequence </a></strong> | ||
+ | </p> | ||
+ | <p align="center"> | ||
+ | <strong><a data-toggle="modal" data-target="#sequence_sperminebindingprotein_primer_modal" class="journal-protocol"> Primers </a></strong> | ||
+ | </p> | ||
+ | </td> | ||
+ | </tr> | ||
+ | |||
+ | |||
+ | </tbody> | ||
+ | |||
+ | </table> | ||
+ | </center> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--sequence modals--> | ||
+ | |||
+ | |||
+ | <!--Blood--> | ||
+ | |||
+ | <!--Haemoglobin A--> | ||
+ | |||
+ | |||
+ | <div class="modal fade" id="sequence_haemoglobina_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590000 (Haemoglobin A) | ||
+ | ATGGTTCTGTCTCCGGCGGACAAAACCAACGTTAAAGCGGCGTGGGGTAAAGTTGGTGCGCACGCGGGTGAATACGGTGCGGAAGCGCTGGAACGTATGTTCCTGTCTTTCCCGACCACCAAAACCTACTTCCCGCACTTCGACCTGTCTCACGGTTCTGCGCAGGTTAAAGGTCACGGTAAAAAAGTTGCGGACGCGCTGACCAACGCGGTTGCGCACGTTGACGACATGCCGAACGCGCTGTCTGCGCTGTCTGACCTGCACGCGCACAAACTGCGTGTTGACCCGGTTAACTTCAAACTGCTGTCTCACTGCCTGCTGGTTACCCTGGCGGCGCACCTGCCGGCGGAGTTCACCCCGGCGGTTCACGCGTCTCTGGACAAATTCCTGGCGTCTGTTTCTACCGTTCTGACCTCTAAATACCGTTAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Haemoglobin B--> | ||
+ | <div class="modal fade" id="sequence_haemoglobinb_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590001 (Haemoglobin B) | ||
+ | ATGGTTCACCTGACCCCGGAAGAAAAATCTGCGGTTACCGCGCTGTGGGGTAAAGTTAACGTTGACGAAGTTGGTGGTGAAGCGCTGGGTCGTCTGCTGGTTGTTTACCCGTGGACCCAGCGTTTCTTCGAATCTTTCGGTGACCTGTCTACCCCGGACGCGGTTATGGGTAACCCGAAAGTTAAAGCGCACGGTAAAAAAGTTCTGGGTGCGTTCTCTGACGGTCTGGCGCACCTGGACAACCTGAAAGGCACCTTCGCGACCCTGTCTGAACTGCACTGCGACAAACTGCACGTTGACCCGGAAAACTTCCGTCTGCTGGGTAACGTTCTGGTTTGCGTTCTGGCGCACCACTTCGGTAAAGAGTTCACCCCGCCGGTTCAGGCGGCGTACCAGAAAGTTGTTGCGGGTGTTGCGAACGCGCTGGCGCACAAATACCACTAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Haptoglobin--> | ||
+ | <div class="modal fade" id="sequence_haptoglobin_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590002 (Haptoglobin) | ||
+ | ATGTCTGCGCTGGGTGCGGTTATCGCGCTGCTGCTGTGGGGTCAGCTGTTCGCGGTTGACTCTGGTAACGACGTTACCGACATCGCGGACGACGGTTGCCCGAAACCGCCGGAAATCGCGCACGGTTACGTTGAACACTCTGTTCGTTACCAGTGCAAAAACTACTACAAACTGCGTACCGAAGGTGACGGTGTTTACACCCTGAACGACAAAAAACAGTGGATCAACAAAGCAGTAGGCGACAAACTGCCGGAATGCGAAGCCGATGACGGCTGTCCGAAACCACCGGAGATCGCTCATGGCTACGTCGAACACTCGGTGCGTTATCAGTGCAAAAACTACTACAAACTGCGCACGGAAGGAGACGGGGTGTACACTCTTAATAACGAGAAACAGTGGATTAACAAAGCGGTTGGCGATAAGCTGCCGGAATGTGAGGCAGTCTGCGGTAAACCGAAAAACCCGGCGAACCCGGTTCAGCGTATCTTGGGCGGGCACTTAGATGCGAAAGGTTCATTCCCGTGGCAGGCCAAAATGGTTTCCCACCACAATCTCACGACAGGGGCGACCCTGATCAACGAGCAGTGGTTGCTGACCACTGCTAAAAATCTGTTTCTGAACCATAGCGAAAATGCGACGGCGAAAGACATCGCGCCGACCCTGACCCTGTACGTTGGTAAAAAACAGCTGGTTGAAATCGAAAAAGTTGTTCTGCACCCGAACTACTCTCAGGTTGACATCGGTCTGATCAAACTGAAACAGAAAGTTTCTGTTAACGAACGTGTTATGCCGATCTGCCTGCCGTCTAAAGACTACGCGGAAGTTGGTCGTGTTGGTTACGTTTCTGGTTGGGGTCGTAACGCGAACTTCAAATTCACCGACCACCTGAAATACGTTATGCTGCCGGTTGCGGACCAGGACCAGTGCATCCGTCACTACGAAGGTTCTACCGTTCCGGAAAAAAAAACCCCGAAATCTCCGGTTGGTGTTCAGCCGATCCTGAACGAACACACCTTCTGCGCGGGTATGTCTAAATACCAGGAAGACACCTGCTACGGTGACGCGGGTTCTGCGTTCGCGGTTCACGACCTGGAAGAAGACACCTGGTACGCGACCGGTATCCTGTCTTTCGACAAATCTTGCGCGGTTGCGGAATACGGTGTTTACGTTAAAGTTACCTCTATCCAGGACTGGGTTCAGAAAACCATCGCGGAAAACTAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--Chromate--> | ||
+ | |||
+ | <!--BBa_K1058008--> | ||
+ | <div class="modal fade" id="sequence_pchrbgfp_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1058008 | ||
+ | ATTGCTTATTCCTATTGCCATTTGCTTTTATTTTGCAATACGTTTTAGCAACGCACAACACCTTATGGGTGTGCTGCTTCCATTGTGATTGCGCAAATGTCCGTTTTTGCAATCTACTCAAGACTTTATTTCGTAGATCTTATCTCATTATTGTAGTAACATCTACGACATGAATTTGCTTTCGCCTATCCTTTCCTTGCCTACTGAAAACGCGACCGTCCGGCAACGGACGTGGCGTGCCCTCAAAGCCTCCGGCGCTGCGGTGCTGCGCGACGGCGTGTACCTGATGCCCGACCGCGACGAATGCCGCGCGGTGCTGGATAACTTGGCCTCCGATGTGCGTGAAGGCGGTGGGGTCGCTCATGTGCTGCGTATGGAAGACCCTGAAGGGGTCAACTTCGTCGCATTATTCGACCGCAGCAACGATTTTGCTGCCTTGCTGGTCGATGTCCATCATCTCAGGCAGACGCTGACATTGGATACCGTGCAAGACGTGCTGCGGCAGGTGCGTAAGCTTCGCAAATCCTTTACTACGCTGGTTGAAATCGACTTCTACCCCGGCGAGGCTCAGCGTCAAGCGGACAGTGCGTTGTGTGAACTGGAACAAGCTTGCGCCCGCACGCTGTCGCCGGACGAGCCGCACGCTGTAGAGGGGACTATTACCCGCTTGGATCGTTTGGATTACCAGGCCCGTACCTGGGCCACTCGCGCACGTCCTTGGGTTGATCGGCTCGCCAGCGCATGGCTGATCCGGCGCTTCATCGACCCGCAGGCGCGCATCCTTTGGTTGGCAACCCCTGCGGACTGCCCGCCGGATGCGTTGGGCTTCGACTTCGATGGCGCGACGTTCAGCCATGTCGGCAGCCGTGTCACGTTCGAGGTCCTGGCGGCGAGCTTTGGGCTGGAACAGCCCGCCATCACAAGGATTGGCCTTGTGGTGCATTACCTCGACGTGGGCGGCATCCAGCCGCCAGAGGCCACTGGTATCGAAAGCGTACTGGCCGGTTTGCGGGAAACGGTTGACCACGACGATCAACTATTGGCCATCGCCTCCACTGTGTTCGATGGCTTACTGGCCAGCTTTGAAAAAGGGACCCTCACCGTATGAGGATCCGAAGGAGATATACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--pChr--> | ||
+ | <div class="modal fade" id="sequence_pchr_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590003 (pChr) | ||
+ | ATTGCTTATTCCTATTGCCATTTGCTTTTATTTTGCAATACGTTTTAGCAACGCACAACACCTTATGGGTGTGCTGCTTCCATTGTGATTGCGCAAATGTCCGTTTTTGCAATCTACTCAAGACTTTATTTCGTAGATCTTATCTCATTATTGTAGTAACATCTACGAC</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--ChrB unmodified--> | ||
+ | <div class="modal fade" id="sequence_chrbunmodified_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>Unmodified ChrB | ||
+ | ATGAATTTGCTTTCGCCTATCCTTTCCTTGCCTACTGAAAACGCGACCGTCCGGCAACGGACGTGGCGTGCCCTCAAAGCCTCCGGCGCTGCGGTGCTGCGCGACGGCGTGTACCTGATGCCCGACCGCGACGAATGCCGCGCGGTGCTGGATAACTTGGCCTCCGATGTGCGTGAAGGCGGTGGGGTCGCTCATGTGCTGCGTATGGAAGACCCTGAAGGGGTCAACTTCGTCGCATTATTCGACCGCAGCAACGATTTTGCTGCCTTGCTGGTCGATGTCCATCATCTCAGGCAGACGCTGACATTGGATACCGTGCAAGACGTGCTGCGGCAGGTGCGTAAGCTTCGCAAATCCTTTACTACGCTGGTTGAAATCGACTTCTACCCCGGCGAGGCTCAGCGTCAAGCGGACAGTGCGTTGTGTGAACTGGAACAAGCTTGCGCCCGCACGCTGTCGCCGGACGAGCCGCACGCTGTAGAGGGGACTATTACCCGCTTGGATCGTTTGGATTACCAGGCCCGTACCTGGGCCACTCGCGCACGTCCTTGGGTTGATCGGCTCGCCAGCGCATGGCTGATCCGGCGCTTCATCGACCCGCAGGCGCGCATCCTTTGGTTGGCAACCCCTGCGGACTGCCCGCCGGATGCGTTGGGCTTCGACTTCGATGGCGCGACGTTCAGCCATGTCGGCAGCCGTGTCACGTTCGAGGTCCTGGCGGCGAGCTTTGGGCTGGAACAGCCCGCCATCACAAGGATTGGCCTTGTGGTGCATTACCTCGACGTGGGCGGCATCCAGCCGCCAGAGGCCACTGGTATCGAAAGCGTACTGGCCGGTTTGCGGGAAACGGTTGACCACGACGATCAACTATTGGCCATCGCCTCCACTGTGTTCGATGGCTTACTGGCCAGCTTTGAAAAAGGGACCCTCACCGTATGA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--ChrBopt--> | ||
+ | <div class="modal fade" id="sequence_chrbopt_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590004 (Partially optimised ChrB) | ||
+ | ATGAACCTGCTGTCTCCGATCCTGTCTCTGCCGACCGAAAACGCGACCGTCCGGCAACGGACGTGGCGTGCCCTCAAAGCCTCCGGCGCTGCGGTGCTGCGCGACGGCGTGTACCTGATGCCCGACCGCGACGAATGCCGCGCGGTGCTGGATAACTTGGCCTCCGATGTGCGTGAAGGCGGTGGGGTCGCTCATGTGCTGCGTATGGAAGACCCTGAAGGGGTCAACTTCGTCGCATTATTCGACCGCAGCAACGATTTTGCTGCCTTGCTGGTCGATGTCCATCATCTCAGGCAGACGCTGACATTGGATACCGTGCAAGACGTGCTGCGGCAGGTGCGTAAGCTTCGCAAATCCTTTACTACGCTGGTTGAAATCGACTTCTACCCCGGCGAGGCTCAGCGTCAAGCGGACAGTGCGTTGTGTGAACTGGAACAAGCTTGCGCCCGCACGCTGTCGCCGGACGAGCCGCACGCTGTAGAGGGGACTATTACCCGCTTGGATCGTTTGGATTACCAGGCCCGTACCTGGGCCACTCGCGCACGTCCTTGGGTTGATCGGCTCGCCAGCGCATGGCTGATCCGGCGCTTCATCGACCCGCAGGCGCGCATCCTTTGGTTGGCAACCCCTGCGGACTGCCCGCCGGATGCGTTGGGCTTCGACTTCGATGGCGCGACGTTCAGCCATGTCGGCAGCCGTGTCACGTTCGAGGTCCTGGCGGCGAGCTTTGGGCTGGAACAGCCCGCCATCACAAGGATTGGCCTTGTGGTGCATTACCTCGACGTGGGCGGCATCCAGCCGCCAGAGGCCACTGGTATCGAAAGCGTACTGGCCGGTTTGCGGGAAACGGTTGACCACGACGATCAACTATTGGCCATCGCCTCCACTGTGTTCGATGGCTTACTGGCCAGCTTTGAAAAAGGGACCCTCACCGTATGA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--pChrGFP--> | ||
+ | <div class="modal fade" id="sequence_pchrgfp_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>Pchr-gfp | ||
+ | ATTGCTTATTCCTATTGCCATTTGCTTTTATTTTGCAATACGTTTTAGCAACGCACAACACCTTATGGGTGTGCTGCTTCCATTGTGATTGCGCAAATGTCCGTTTTTGCAATCTACTCAAGACTTTATTTCGTAGATCTTATCTCATTATTGTAGTAACATCTACGACTACTAGACACAGAGGAACAGGTATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGCGTATGGTCTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGCAGACAAACCAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--Fingerprint Ageing--> | ||
+ | |||
+ | <!--Lanosterol Synthase--> | ||
+ | <div class="modal fade" id="sequence_lanosterolsynthase_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590006 (Lanosterol Synthase) | ||
+ | GCGCGAATTCGCGGCCGCTTCTAGATGACCGAAGGAACCTGCCTGCGTCGTCGTGGTGGTCCGTACAAAACCGAACCGGCGACCGACCTGGGTCGTTGGCGTCTGAACTGCGAACGTGGTCGTCAGACCTGGACCTACCTACAGGACGAACGTGCGGGTCGTGAACAGACCGGTCTGGAAGCGTACGCGCTGGGTCTGGACACCAAAAACTACTTCAAAGACCTGCCGAAAGCGCACACCGCGTTCGAAGGTGCGCTGAACGGTATGACCTTCTACGTTGGTCTACAGGCGGAAGACGGTCACTGGACCGGTGACTACGGTGGTCCGCTGTTCCTGCTGCCGGGTCTGCTGATCACCTGCCACGTTGCGCGTATCCCGCTGCCAGCTGGTTACCGAGAGGAAATTGTCCGATATCTACGATCAGTACAACTGCCGGACGGTGGTTGGGGTCTGCACATCGAAGACAAATCTACCGTTTTCGGAACCGCGCTGAACTACGTTTCTCTGCGTATCCTGGGTGTTGGTCCGGACGACCCGGACCTGGTTCGTGCGCGTAACATCCTGCACAAAAAAGGTGGTGCGGTTGCGATCCCGTCTTGGGGTAAATTCTGGCTGGCGGTTCTGAACGTTTACTCTTGGGAAGGTCTGAACACCCTGTTCCCGGAAATGTGGCTGTTCCCGGACTGGGCGCCGGCGCACCCGTCTACCCTGTGGTGCCACTGCCGTCAGGTTTACCTGCCGATGTCTTACTGCTACGCGGTTCGTCTGTCTGCGGCGGAAGACCCGCTGGTTCAGTCTCTGCGTCAGGAACTGTACGTTGAAGACTTCGCGTCTATAGATTGGCTAGCACAACGTAACAATGTTGCTCCAGATGAACTGTACACCCCGCACTCTTGGCTGCTGCGTGTTGTTTACGCGCTGCTGAACCTGTACGAACACCACCACTCTGCGCACCTGCGTCAGCGTGCGGTTCAGAAACTGTACGAACACATCGTTGCGGACGACCGTTTCACCAAATCTATCTCTATCGGTCCGATCTCTAAAACCATCAACATGCTGGTTCGTTGGTACGTTGACGGTCCGGCGTCTACCGCGTTCCAGGAACACGTTTCTCGTATCCCGGACTACCTGTGGATGGGTCTGGACGGTATGAAAATGCAGGGCACCAACGGTTCTCAGATATGGGACACCGCGTTCGCGATCCAGGCGCTGCTGGAAGCGGGTGGTCACCACCGTCCGGAGTTCTCTTCTTGCCTACAGAAAGCGCACGAGTTCCTGCGTCTGTCTCAGGTTCCAGATAATCCACCTGATTACCAGAAATACTACCGTCAGATGCGTAAAGGTGGTTTCTCTTTCTCTACCCTGGACTGCGGTTGGATCGTTTCTGACTGCACCGCGGAAGCGCTGAAAGCGGTTCTGCTGCTACAGGAAAAATGCCCGCACGTTACCGAACACATCCCGCGTGAACGTCTGTGCGACGCGGTTGCGGTTCTGCTGAACATGCGTAACCCGGACGGTGGTTTCGCGACCTACGAAACCAAACGTGGTGGTCACCTGCTGGAACTGCTGAACCCGTCTGAAGTTTTCGGTGACATCATGATCGACTACACCTATGTTGAATGCACCAGTGCGGTGATGCAGGCATTAAAATACTTCCACAAGCGCTTTCCGGAACACCGCGCAGCGGAAATCCGCGAAACGTTGACCCAAGGTCTGGAGTTCTGCCGTCGTCAGCAGCGTGCGGACGGTTCTTGGGAAGGTTCTTGGGGTGTTTGCTTCACCTACGGCACCTGGTTCGGTCTGGAAGCGTTCGCGTGCATGGGTCAGACCTACCGTGACGGAACCGCGTGCGCGGAAGTTTCTCGTGCGTGCGACTTCCTGCTGTCTCGTCAGATGGCGGACGGTGGTTGGGGTGAAGACTTCGAATCTTGCGAAGAACGTCGTTACCTACAGTCTGCGCAGTCTCAGATCCACAACACCTGCTGGGCGATGATGGGTCTGATGGCGGTTCGTCACCCGGACATCGAAGCGCAGGAACGTGGTGTTCGTTGCCTGCTGGAAAAACAGCTGCCGAACGGTGACTGGCCGCAGGAAAACATCGCGGGTGTTTTCAACAAATCTTGCGCGATCTCTTACACCTCTTACCGTAACATCTTCCCGATCTGGGCGCTGGGTCGTTTCTCTCAGCTGTACCCGGAACGTGCGCTGGCGGGTCACCCGTAATAATACTAGTAGCGGCCGCTGCAGGCGC</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--Nasal Mucus detection--> | ||
+ | |||
+ | <!--Odorant binding protein 2A--> | ||
+ | <div class="modal fade" id="sequence_odorantbindingprotein_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590007 (Odorant Binding Protein 2A) | ||
+ | ATGCTGTCTTTCACCCTGGAAGAAGAAGACATCACCGGCACCTGGTACGTTAAAGCGATGGTTGTTGACAAAGACTTCCCGGAAGACCGTCGTCCGCGTAAAGTTTCTCCGGTTAAAGTTACCGCGCTGGGTGGTGGTAACCTGGAAGCGACCTTCACCTTCATGCGTGAAGACCGTTGCATCCAGAAAAAAATCCTGATGCGTAAAACCGAAGAACCGGGTAAATTCTCTGCGTACGGTGGTCGTAAACTGATCTACCTGCAAGAACTGCCGGGCACCGACGACTACGTTTTCTACTGCAAAGACCAGCGTCGTGGTGGTCTGCGTTACATGGGTAAACTGGTTGGTCGTAACCCGAACACCAACCTGGAAGCGCTGGAAGAATTTAAAAAACTGGTTCAGCACAAAGGTCTGTCTGAAGAAGACATCTTCATGCCGCTGCAAACCGGTTCTTGCGTTCTGGAACAC</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Odorant binding protein - Helix--> | ||
+ | <div class="modal fade" id="sequence_obphelix_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>Odorant Binding Protein 2A - Helix | ||
+ | CCGAACACCAACCTGGAAGCGCTGGAAGAATTTAAAAAACTGGTTCAGCACAAAGGTCTGTCTGAAGAAGACATCTTCATGCCGCTGCAAACCGGTTCTTGCGTTCTGGAACAC</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Odorant binding protein - Barrel--> | ||
+ | <div class="modal fade" id="sequence_obpbarrel_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>Odorant Binding Protein 2A - Barrel | ||
+ | ATGCTGTCTTTCACCCTGGAAGAAGAAGACATCACCGGCACCTGGTACGTTAAAGCGATGGTTGTTGACAAAGACTTCCCGGAAGACCGTCGTCCGCGTAAAGTTTCTCCGGTTAAAGTTACCGCGCTGGGTGGTGGTAACCTGGAAGCGACCTTCACCTTCATGCGTGAAGACCGTTGCATCCAGAAAAAAATCCTGATGCGTAAAACCGAAGAACCGGGTAAATTCTCTGCGTACGGTGGTCGTAAACTGATCTACCTGCAAGAACTGCCGGGCACCGACGACTACGTTTTCTACTGCAAAGACCAGCGTCGTGGTGGTCTGCGTTACATGGGTAAACTGGTTGGTCGTAAC</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!-- Saliva detection --> | ||
+ | |||
+ | <!--Lactoferrin binding protein--> | ||
+ | <div class="modal fade" id="sequence_lactoferrinbindingprotein_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590008 (Lactoferrin Binding Protein) | ||
+ | ATGAATAAGAAACACGGTTTTCCGCTGACTCTGACTGCCTTGGCCATTGCAACCGCTTTTCCGGCTTATGCTGCCCAAGCGGGGGGGGCGACACCTGATGCCGCGCAGACCCAATCCCTGAAAGAGATTACCGTCCGTGCCGCCAAAGTGGGACGGCGATCGAAAGAGGCGACCGGTTTGGGCAAAATCGTCAAAACGTCGGAAACGTTGAACAAAGAACAGGTACTCGGTATCCGCGACCTGACGCGCTACGATCCGGGCGTGGCGGTTGTCGAACAGGGCAACGGCGCGAGCGGCGGCTACTCGATACGCGGCGTGGATAAAAACCGTGTGGCGGTTTCGGTCGACGGTGTTGCCCAAATACAGGCGTTTACCGTGCAGGGATCGTTGAGCGGATACGGCGGACGCGGCGGCAGCGGTGCAATCAACGAAATCGAATATGAAAACATCAGCACGGTGGAAATCGACAAAGGTGCCGGTTCGTCCGATCACGGCAGCGGCGCACTCGGCGGCGCGGTCGCCTTCCGCACCAAAGAGGCGGCAGACCTGATTTCAGACGGCAAAAGTTGGGGGATACAGGCAAAAACCGCCTACGGCAGTAAAAACCGCCAATTTATGAAGTCGCTCGGCGCGGGGTTCAGCAAAGACGGTTGGGAAGGGCTGTTAATCCGAACCGAACGCCAAGGGCGGGAAACGCGCCCGCACGGCGATATTGCGGACGGGGTGGAATACGGCATAGACCGTTTGGACGCGTTCCGTCAGACATACGATATTAAACGCAAGACAAGAGAGCCATTTTTCTCAGTAGAGGGCGAGCGTGAATCCAAGCCCGTGGCAAAATTGGCGGGCTACGGGAAATATTTGAACAACCAGCTCAACCGCTGGGTAAAAGAACGTATTGAACAAAATCAGCCTTTAAGTGCTGAAGAAGAGGCGCAGGTGCGGGAGGCGCAGGCGCGCCACGAAAATCTGTCCGCCCAAGCTTACACGGGCGGCGGCAGGATATTGCCCGATCCGATGGATTACCGCAGCGGCTCTTGGCTTGCCAAGCTGGGCTACCGCTTCGGCGGCAGGCATTATGTCGGCGGCGTGTTTGAGGATACCAAACAGCGTTACGATATCCGCGATATGACGGAAAAACAGTATTACGGTACGGACGAGGCGGAAAAGTTTAGAGACAAGAGCGGGGTGTACGACGGCGACGATTTCCGCGACGGCTTGTATTTTGTGCCGAATATAGAAGAGTGGAAGGGCGATAAAAATTTGGTCAGGGGCATAGGTTTGAAATATTCCCGCACCAAATTTATTGACGAACATCACCGCCGCCGCCGTATGGGTTTGCTGTATCGTTATGAAAACGAAGCGTATTCTGACAATTGGGCGGATAAGGCGGTGTTGTCGTTTGACAAACAGGGCGTGGCAACCGATAACAACACGCTGAAGCTGAATTGCGCCGTGTATCCTGCTGTGGACAAATCCTGCCGCGCGTCGGCGGACAAACCGTATTCCTACGACAGCAGCGACCGTTTCCACTACCGCGAACAGCACAATGTTTTGAATGCCTCGTTTGAGAAATCGCTGAAAAACAAATGGACGAAACACCATCTGACTTTGGGCTTCGGTTACGATGCTTCCAAAGCGATTTCCCGCCCCGAACAGCTTTCCCACAATGCGGCAAGGATTTCGGAATCCACGGGATTCGATGAAAACAATCAAGATAAGTATCTTTTGGGTAAGCCCGAAGTCGTCGAAGGGTCGGTCTGCGGCTACATCGAAACCCTGCGTTCCCGCAAATGCGTGCCAAGAAAAATCAACGGCAGCAATATCCATATTTCTTTGAACGACCGTTTTTCAATCGGCAAATATTTCGATTTCAGCTTGGGCGGCAGGTACGACCGGAAAAACTTCACCACGTCGGAAGAACTCGTCCGCAGCGGGCGGTATGTTGACCGTTCGTGGAACAGCGGCATCTTGTTCAAACCGAACCGGCATTTTTCCGTGTCTTACCGTGCCTCCAGCGGCTTCAGAACGCCCTCATTCCAAGAACTTTTCGGGATAGACATTTATCACGATTATCCGAAAGGCTGGCAGCGTCCCGCCCTGAAATCGGAAAAGGCAGCCAACCGGGAAATCGGTTTGCAGTGGAAGGGCGATTTCGGCTTTTTGGAAATCAGCAGCTTCCGCAACCGTTATACCGATATGATTGCCGTTGCCGATCACAAAACCAAATTGCCGAATCAGGCAGGACAATTGACAGAGATTGATATACGCGATTATTACAATGCCCAAAATATGTCGCTTCAAGGCGTTAATATATTGGGAAAAATCGACTGGAACGGCGTGTATGGCAAACTGCCCGAAGGTTTGTACACCACATTGGCGTACAACCGCATCAAACCGAAATCGGTATCCAACCGGCCGGGACTGTCCCTCCGCAGCTATGCTTTGGATGCGGTACAGCCGTCGCGTTATGTTTTGGGGTTCGGATACGACCAGCCTGAGGGGAAATGGGGCGCAAACATTATGCTGACCTATTCCAAAGGGAAAAACCCTGACGAGCTTGCTTATCTGGCAGGCGATCAAAAACGATATTCGACAAAAAGAGCGTCGTCTTCTTGGTCGACGGCAGACGTTTCCGCCTATCTGAATCTGAAAAAACGGCTGACCTTGAGGGCGGCTATCTACAATATCGGCAACTACCGCTACGTTACTTGGGAATCCTTGCGCCAGACTGCGGAAAGCACGGCAAACCGGCACGGCGGCGACAGCAACTATGGAAGGTATGCCGCACCGGGCAGGAACTTCAGTCTCGCGCTCGAAATGAAGTTTTAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!-- Semen detection --> | ||
+ | |||
+ | <!--PotD--> | ||
+ | <div class="modal fade" id="sequence_potd_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590009 (PotD) | ||
+ | ATGAAAAAATGGTCACGCCACCTGCTCGCGGCGGGTGCTCTGGCACTGGGCATGAGCGCCGCTCACGCCGATGACAACAACACGCTGTATTTCTACAACTGGACCGAGTACGTGCCGCCAGGACTGCTTGAACAGTTCACCAAAGAAACCGGTATTAAGGTTATCTATTCGACTTACGAGTCGAACGAAACCATGTACGCCAAGCTGAAAACATACAAAGACGGTGCCTATGATCTGGTGGTTCCTTCAACCTATTACGTTGATAAAATGCGTAAAGAAGGGATGATCCAGAAGATCGACAAGTCGAAGTTAACAAACTTCAGCAATCTCGATCCAGACATGCTCAACAAGCCTTTTGACCCGAATAACGACTACTCCATTCCGTATATCTGGGGTGCGACGGCGATTGGTGTTAACGGTGATGCGGTGGATCCGAAATCTGTCACCAGCTGGGCCGATCTGTGGAAGCCAGAGTACAAAGGCAGCCTGCTGTTGACCGACGATGCCCGTGAAGTGTTCCAGATGGCGCTGCGTAAGCTGGGCTACTCCGGTAACACCACCGATCCGAAAGAGATTGAAGCTGCATATAACGAGCTGAAAAAACTGATGCCAAACGTGGCAGCCTTTAACTCCGATAACCCGGCGAACCCGTACATGGAAGGCGAAGTTAACCTCGGCATGATCTGGAACGGTTCTGCTTTCGTTGCACGCCAGGCGGGTACGCCAATTGACGTGGTGTGGCCGAAAGAAGGCGGCATTTTCTGGATGGACAGCCTGGCGATCCCGGCAAATGCCAAAAACAAAGAAGGCGCGCTGAAATTGATCAACTTCCTGCTGCGCCCGGATGTGGCAAAACAGGTTGCTGAAACTATCGGTTATCCAACGCCAAACCTTGCGGCGCGTAAGCTGTTAAGTCCAGAAGTGGCGAACGATAAAACACTCTACCCGGATGCTGAAACCATTAAAAATGGCGAATGGCAGAATGACGTTGGCGCAGCCAGCAGCATTTATGAAGAGTATTATCAGAAGCTGAAAGCAGGACGTTAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Spermine Binding Protein--> | ||
+ | <div class="modal fade" id="sequence_sperminebindingprotein_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body"> | ||
+ | <p class="sequences">>BBa_K1590010 (Spermine Binding Protein) | ||
+ | ATGCTGCTGCTGCTGACCCTGGCGTTCCTGGCGTCTCCGACCTGCCGTGCGCAGAACGTTCTGGGTAACGCGGCGGGTAAATACTTCTACGTTCAGGGTGAAGACCAGGGTCAGCTGAAAGGTATGCGTATCTTCCTGTCTGTTTTCAAATTCATCAAAGGTTTCCAGCTCCAGTTCGGTTCTAACTGGACCGACGTTTACGGCACCCGTTCTGACAACTTCATCGACTTCCTGCTGGAAGACGGTGAACACGTTATCAAAGTTGAAGGTTCTGCGGTTATCTGCCTGACCTCTCTGACCTTCACCACCAACAAAGGTCGTGTTGCGACCTTCGGTGTTCGTCGTGGTCGTTACTTCTCTGACACCGGTGGTTCTGACAAACACCTGGTTACCGTTAACGGTATGCACGCGCCGGGTCTGTGCGTTCGTGGTATCGGTTTCAAATGGGGTAACATCAACGCGAACGGTAACGACCACTACAACAACAAAGAAGACAAAGCGGACAACAAAGACGCGGACAACAAAGACGCTGACAATAAAGACGATGGCGATGAGGATGATGATGGAAACGATGACGATGATCAGAAGGACGAATCTTAA</p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--primer modals--> | ||
+ | |||
+ | |||
+ | <!--Blood--> | ||
+ | |||
+ | <!--Haemoglobin A--> | ||
+ | <div class="modal fade" id="sequence_haemoglobina_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Haemoglobin A into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCGTTCTGTCTCCGGCGGAC</li> | ||
+ | <li>Reverse: GCGCGGTACCTTACGGTATTTAGAGGT</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning Haemoglobin A into vector for bacterial 2-hybrid system, pT25. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCAGTTCTGTCTCCGGCGGAC</li> | ||
+ | <li>Reverse: GCGCGGTACCTTACGGGGTGAACTCCGCCGG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Haemoglobin B--> | ||
+ | <div class="modal fade" id="sequence_haemoglobinb_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Haemoglobin B into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCGTTCACCTGACCCCGGAAG</li> | ||
+ | <li>Reverse: GCGCGGTACCTTAGTGGTATTTGTGCGC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning Haemoglobin B into vector for bacterial 2-hybrid system, pUT18. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCATGGTTCACCTGACCCCGGAAG (incorrect?)</li> | ||
+ | <li>Reverse: GCGCGAATTCTATTAGTGGTATTTGTGCGCCAG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Haptoglobin--> | ||
+ | <div class="modal fade" id="sequence_haptoglobin_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Haptoglobin into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCTCTGCGCTGGGTGCGGTT</li> | ||
+ | <li>Reverse: GCGCGGTACCTTAGTTTTCCGCGATGGT</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning Haptoglobin into vector for bacterial 2-hybrid system, pUT18. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCATGTCTGCGCTGGGTGCG</li> | ||
+ | <li>Reverse: GCGCGAATTCGAGTTTTCCGCGATGGTTTTC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning Haptoglobin into vector for bacterial 2-hybrid system, pT25. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGTACCTTAGTTTTCCGCGATGGT</li> | ||
+ | <li>Reverse: GCGCGGATCCATGAACCTGCTGTCTCCGATCCTGTCT</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Chromate--> | ||
+ | |||
+ | <!--BBa_K1058008--> | ||
+ | <div class="modal fade" id="sequence_pchrbgfp_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Intermediate sequencing primer for sequencing BBa_K1058008. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCCGGACAGTGCGTTGTGTG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--pChr--> | ||
+ | <div class="modal fade" id="sequence_pchr_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for amplification of pChr from BBa_K1058008. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGAGATTGCTTATTCCTATTGC</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTAGTCGTAGATGTTACTACA</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--ChrB unmodified--> | ||
+ | <div class="modal fade" id="sequence_chrbunmodified_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for amplification of unmodified ChrB from BBa_K1058008 for subsequent insertion into pUniprom. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCATGAATTTGCTTTCGCCTATCCTTTCC</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTATACGGTGAGGGTCCC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--ChrBopt--> | ||
+ | <div class="modal fade" id="sequence_chrbopt_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers used for amplification of ChrB coding-region, while optimising the 15 codons, adding a standard prefix, and a standard suffix to it. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGATGAACCTGCTGTCTCCGATCCTGTCTCTGCCGACCGAAAACGCG</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTATACGGTGAGGGTCCC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for amplification of partially optimised ChrB from BBa_K1058008 and adding a standard prefix, a PstI restriction site, and a His6-tag to it. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGATGAACCTGCTGTCTCCGATCCTGTCTCTGCCGACCGAAAACGCG</li> | ||
+ | <li>Reverse: GCGCCTGCAGTTATTAATGGTGATGGTGATGGTGTACGGTGAGGGTCCC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for amplification of partially optimised ChrB from recombinant plasmid and adding BamHI/PstI restriction sites and a His6-tag to it. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCATGAACCTGCTGTCTCCGATCCTGTCT</li> | ||
+ | <li>Reverse: GCGCCTGCAGTTATTAATGGTGATGGTGATGGTGTACGGTGAGGGTCCC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--pChrGFP--> | ||
+ | <div class="modal fade" id="sequence_pchrgfp_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for amplification of GFP for subsequent ligation with pChr and into pSB1C3. The primers add an XbaI restriction site, a Ribosomal binding site, and a standard suffix to it. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCTCTAGACACAGAGGAACAGGTATGAGTAAAGGAGAAGAA</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTATTTGTATAGTTCATC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--Fingerprint Ageing--> | ||
+ | |||
+ | <!--Lanosterol Synthase--> | ||
+ | <div class="modal fade" id="sequence_lanosterolsynthase_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Intermediate primers for sequencing Lanosterol Synthase. | ||
+ | <ul> | ||
+ | <li>Forward: GGCTGTTCCCGGACTGGG</li> | ||
+ | <li>Reverse: CGGTGACATCATGATCGAC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning Lanosterol Synthase into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCATGACCGAAGGAACCTGC</li> | ||
+ | <li>Reverse: GCGCGGTACCTTACGGGTGACCCGCCAGCGC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!--Nasal Mucus detection--> | ||
+ | |||
+ | <!--Odorant binding protein 2A--> | ||
+ | <div class="modal fade" id="sequence_odorantbindingprotein_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Odorant Binding Protein 2A into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGATGCTGTCTTTCACCCTGGAAGAA</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTAGTGTTCCAGAACGCAAG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Odorant binding protein - Helix--> | ||
+ | <div class="modal fade" id="sequence_obphelix_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Odorant Binding Protein 2A - Helix into vector for bacterial 2-hybrid system, pUT25. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCGCCGAACACCAACCTGGAAGCG</li> | ||
+ | <li>Reverse: GCGCGGTACCTTAGTGTTCCAGAACGCAAGA</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | |||
+ | <!--Odorant binding protein - Barrel--> | ||
+ | <div class="modal fade" id="sequence_obpbarrel_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Odorant Binding Protein 2A - Barrel into vector for bacterial 2-hybrid system, pT18. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGATGCTGTCTTTCACCCTGGAAGAA</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTAGTGTTCCAGAACGCAAG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!-- Saliva detection --> | ||
+ | |||
+ | <!--Lactoferrin binding protein--> | ||
+ | <div class="modal fade" id="sequence_lactoferrinbindingprotein_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Forward primer for amplifying lactoferrin binding protein A from Neisseria meningitidis MC58. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGATGAATAAGAAACACGGTTTTCCG</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTAAAACTTCATTTCGAGCG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Intermediate sequencing primers for Lactoferrin Binding Protein. | ||
+ | <ul> | ||
+ | <li>Forward 1: GAAGTCGCTCGGCGCGGGG</li> | ||
+ | <li>Forward 2: GACAAGAGCGGGGTGTACG</li> | ||
+ | <li>Reverse: GCCGAATCAGGCAGGAC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning Lactoferrin Binding Protein into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCAATAAGAAACACGGTTTTCC</li> | ||
+ | <li>Reverse: GCGCGGTACCTTAAAACTTCATTTCGAGCG</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | |||
+ | <!-- Semen detection --> | ||
+ | |||
+ | <!--PotD--> | ||
+ | <div class="modal fade" id="sequence_potd_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for amplification of PotD from E. coli MG1655 gDNA and subsequent insertion into pSB1C3. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGAATTCGCGGCCGCTTCTAGATGAAAAAATGGTCACGCCAC</li> | ||
+ | <li>Reverse: GCGCCTGCAGCGGCCGCTACTAGTATTATTAACGTCCTGCTTTCAGCTT</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | |||
+ | <p>Primers for cloning PotD into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCAGATCTAAAAAATGGTCACGCCAC</li> | ||
+ | <li>Reverse: GCGCGGTACCTTAACGTCCTGCTTTCAGCTTC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <!--Spermine Binding Protein--> | ||
+ | <div class="modal fade" id="sequence_sperminebindingprotein_primer_modal" tabindex="-1" role="dialog" aria-labelledby="myModalLabel"> | ||
+ | <div class="modal-dialog" role="document"> | ||
+ | <div class="modal-content"> | ||
+ | |||
+ | <div class="modal-header"> | ||
+ | <button type="button" class="close" data-dismiss="modal" aria-label="close" aria-hidden="true" role="dialog" tabindex="-1"><span aria-hidden="true">×</span></button> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-title" id="myModalLabel"></div> <!-- Add text before /div tag to add header --> | ||
+ | |||
+ | <div class="modal-body sequences"> | ||
+ | <p>Primers for cloning Spermine Binding Protein into overexpression vector pQE80-L. | ||
+ | <ul> | ||
+ | <li>Forward: GCGCGGATCCCTGCTGCTGCTGACCCTGGCG</li> | ||
+ | <li>Reverse: GCGCGGTACCTTAAGATTCGTCCTTCTGATC</li> | ||
+ | </ul> | ||
+ | </p> | ||
+ | </div> | ||
+ | |||
+ | <div class="modal-footer"> | ||
+ | <button type="button" class="btn btn-primary" data-dismiss="modal">Close</button> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
Line 38: | Line 1,448: | ||
}); | }); | ||
+ | </script> | ||
− | + | </body> | |
− | + | ||
− | + | ||
− | + | ||
</html> | </html> | ||
{{:Team:Dundee/navbar}} | {{:Team:Dundee/navbar}} | ||
− |
Latest revision as of 03:12, 19 September 2015
<!DOCTYPE html>
Sequences
Registry - ID |
Name |
Short Description |
Part of which tool |
Sequences |
hHBA (Haemoglobin A - Homo sapiens) |
Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12. |
FluID - Blood Detection |
||
hHBB (Haemoglobin B - Homo sapiens) |
Coding sequence for Human Haemoglobin B in silico optimised for increased expression level in E.coli K12. |
FluID - Blood Detection |
||
hHBN (Haptoglobin - Homo sapiens) |
Coding sequence for Human Haptoglobin in silico optimised for increased expression level in E.coli K12. |
FluID - Blood Detection |
||
PChr-ChrB-gfp |
Partial sequence of chromate resistance operon of Ochrobactrum tritici 5bvl1, containing a chromate-inducible promoter, PChr, a repressor, ChrB, and a fluorescent reporter, gfp. |
Chromate Detection |
||
PChr |
Promoter sequence of chromate resistance operon of Ochrobactrum tritici 5bvl1. |
Chromate Detection |
||
- |
ChrB |
Coding sequence for unmodified chromate sensitive repressor of PChr. |
Chromate Detection |
|
ChrB(opt) |
Coding sequence for partially optimised chromate sensitive repressor of PChr. |
Chromate Detection |
||
- |
PChr- gfp |
Sequence of fluorescent reporter-fusion, chromate sensitive promoter + gfp. |
Chromate Detection |
|
LSS (Lanosterol Synthase - Homo Sapiens) |
Coding sequence for Human lanosterol synthase in silico optimised for increased expression level in E. coli K12. |
Fingerprint Ageing |
||
OBP2A (Odorant Binding Protein 2A - Homo sapiens) |
Coding sequence for Human odorant binding 2A protein in silico optimised for increased expression level in E. coli K12. |
FluID - Nasal Mucus Detection |
||
- |
|
Coding sequence for C-terminal helix of Human odorant binding protein 2A. |
FluID - Nasal Mucus Detection |
|
- |
OBP2A (Odorant Binding Protein 2A - Homo sapiens) - Barrel |
Coding sequence for N-terminal barrel of Human odorant binding protein 2A. |
FluID - Nasal Mucus Detection |
|
LbpA (Lactoferrin Binding Protein A - Neisseria Meningitidis |
Coding sequence for lactoferrin binding protein A. |
FluID - Saliva Detection |
||
PotD (Escherichia Coli) |
Unmodified coding sequence for E.coli MG1655 Spermidine binding periplasmic protein. |
FluID - Semen Detection |
||
Sbp (Spermine Binding Protein - Mus Musculus) |
Coding sequence for murine Spermine Binding Protein in silico optimised for increased expression level in E. coli K12. |
FluID - Semen Detection |