Latest revision as of 03:12, 19 September 2015

<!DOCTYPE html> Dundee iGEM 2015

Sequences

Registry - ID	Name	Short Description	Part of which tool	Sequences
BBa_K1590000	hHBA (Haemoglobin A - Homo sapiens)	*Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli* K12.**	FluID - Blood Detection	Fasta Sequence Primers
BBa_K1590001	hHBB (Haemoglobin B - Homo sapiens)	*Coding sequence for Human Haemoglobin B in silico optimised for increased expression level in E.coli* K12.**	FluID - Blood Detection	Fasta Sequence Primers
BBa_K1590002	hHBN (Haptoglobin - Homo sapiens)	*Coding sequence for Human Haptoglobin in silico optimised for increased expression level in E.coli* K12.**	FluID - Blood Detection	Fasta Sequence Primers
BBa_K1058008 (BIT-2013)	P_Chr-ChrB-gfp	*Partial sequence of chromate resistance operon of Ochrobactrum tritici* 5bvl1, containing a chromate-inducible promoter, P_Chr, a repressor, ChrB, and a fluorescent reporter, gfp.**	Chromate Detection	Fasta Sequence Primers
BBa_K1590003	P_Chr	*Promoter sequence of chromate resistance operon of Ochrobactrum tritici* 5bvl1.**	Chromate Detection	Fasta Sequence Primers
-	*ChrB*	Coding sequence for unmodified chromate sensitive repressor of P_Chr.	Chromate Detection	Fasta Sequence Primers
BBa_K1590004	ChrB(opt)	Coding sequence for partially optimised chromate sensitive repressor of P_Chr.	Chromate Detection	Fasta Sequence Primers
-	P_Chr- gfp	*Sequence of fluorescent reporter-fusion, chromate sensitive promoter + gfp.*	Chromate Detection	Fasta Sequence Primers
BBa_K1590006	LSS (Lanosterol Synthase - Homo Sapiens)	*Coding sequence for Human lanosterol synthase in silico optimised for increased expression level in E. coli* K12.**	Fingerprint Ageing	Fasta Sequence Primers
BBa_K1590007	OBP2A (Odorant Binding Protein 2A - Homo sapiens)	*Coding sequence for Human odorant binding 2A protein in silico optimised for increased expression level in E. coli* K12.**	FluID - Nasal Mucus Detection	Fasta Sequence Primers
-	*(Odorant Binding Protein 2A - Homo sapiens) - Helix*	Coding sequence for C-terminal helix of Human odorant binding protein 2A.	FluID - Nasal Mucus Detection	Fasta Sequence Primers
-	OBP2A (Odorant Binding Protein 2A - Homo sapiens) - Barrel	Coding sequence for N-terminal barrel of Human odorant binding protein 2A.	FluID - Nasal Mucus Detection	Fasta Sequence Primers
BBa_K1590008	**LbpA (Lactoferrin Binding Protein A - Neisseria Meningitidis**	Coding sequence for lactoferrin binding protein A.	FluID - Saliva Detection	Fasta Sequence Primers
BBa_K1590009	PotD (Escherichia Coli)	*Unmodified coding sequence for E.coli* MG1655 Spermidine binding periplasmic protein.**	FluID - Semen Detection	Fasta Sequence Primers
BBa_K1590010	Sbp (Spermine Binding Protein - Mus Musculus)	*Coding sequence for murine Spermine Binding Protein in silico optimised for increased expression level in E. coli* K12.**	FluID - Semen Detection	Fasta Sequence Primers

@@ Line 8: / Line 8: @@
      <meta name="viewport" content="user-scalable=no, initial-scale=1, maximum-scale=1, minimum-scale=1, width=320, height=device-height, target-densitydpi=medium-dpi" />
-    <!-- remove when hosted -->
-      <link href="css/bootstrap.css" rel="stylesheet">
-      <link href="css/style.css" rel="stylesheet">
-      <link href="css/font-awesome.css" rel="stylesheet" type="text/css"/>
-        <script src="js/jquery.js"></script>
-        <script src="js/bootstrap.js"></script>
 </head>
 <body>
-<header>
+<header id="header-tubes">
    <a class="anchor" id="top"></a>
      <center>
-       <h1><highlight class="highlight">Sequences and Parts</highlight></h1>
+       <h1><highlight class="highlight">Sequences</highlight></h1>
      </center>
 </header>
@@ Line 31: / Line 25: @@
 <div class="rows">
+<center>
 <table border="1" cellspacing="0" cellpadding="0">
@@ Line 42: / Line 37: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Name</strong> <!--e.g. Haemoglobin A-->
+                     <strong>Name</strong> <!--e.g. Haemoglobin A -->
                  </p>
              </td>
@@ Line 52: / Line 47: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Part of which tool</strong> <!--e.g. BioSpray - Blood detection-->
+                     <strong>Part of which tool</strong> <!--e.g. FluID - Blood detection-->
                  </p>
              </td>
@@ Line 70: / Line 65: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Haemoglobin A (Homo sapiens)</strong>
+                     <strong><i> hHBA</i> (Haemoglobin A - <i>Homo sapiens</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12.</strong>
+                     <strong>Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in <i>E.coli</i> K12.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Blood Detection</strong>
+                     <strong>FluID - Blood Detection</strong>
                  </p>
              </td>
@@ Line 101: / Line 96: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Haemoglobin B (Homo sapiens)</strong>
+                     <strong> <i> hHBB</i> (Haemoglobin B - <i>Homo sapiens</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12.</strong>
+                     <strong>Coding sequence for Human Haemoglobin B in silico optimised for increased expression level in <i>E.coli</i> K12.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Blood Detection</strong>
+                     <strong>FluID - Blood Detection</strong>
                  </p>
              </td>
@@ Line 132: / Line 127: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Haptoglobin (Homo sapiens)</strong>
+                     <strong><i> hHBN</i> (Haptoglobin - <i>Homo sapiens</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for Human Haemoglobin A in silico optimised for increased expression level in E.coli K12.</strong>
+                     <strong>Coding sequence for Human Haptoglobin in silico optimised for increased expression level in <i>E.coli</i> K12.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Blood Detection</strong>
+                     <strong>FluID - Blood Detection</strong>
                  </p>
              </td>
@@ Line 164: / Line 159: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>pChr-ChrB-GFP</strong>
+                     <strong>P<i><sub>Chr<i></sub>-<i>ChrB</i>-<i>gfp</i></strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Partial sequence of chromate resistance operon of Ochrobactrum tritici 5bvl1, containing a chromate-inducible promoter, pChr, a repressor, ChrB, and a fluorescen reporter, GFP.</strong>
+                     <strong>Partial sequence of chromate resistance operon of <i>Ochrobactrum tritici</i> 5bvl1, containing a chromate-inducible promoter, P<i><sub>Chr</i></sub>, a repressor, <i>ChrB</i>, and a fluorescent reporter, <i>gfp</i>.</strong>
                  </p>
              </td>
@@ Line 195: / Line 190: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>pChr</strong>
+                     <strong>P<i><sub>Chr</i></sub></strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Promoter sequence of chromate resistance operon of Ochrobactrum tritici 5bvl1.</strong>
+                     <strong>Promoter sequence of chromate resistance operon of <i>Ochrobactrum tritici</i> 5bvl1.</strong>
                  </p>
              </td>
@@ Line 226: / Line 221: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>ChrB</strong>
+                     <strong><i>ChrB</i></strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for unmodified chromate sensitive repressor of pChr.</strong>
+                     <strong>Coding sequence for unmodified chromate sensitive repressor of P<i><sub>Chr</i></sub>.</strong>
                  </p>
              </td>
@@ Line 257: / Line 252: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>ChrBopt</strong>
+                     <strong><i>ChrB</i>(opt)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for partially optimised chromate sensitive repressor of pChr.</strong>
+                     <strong>Coding sequence for partially optimised chromate sensitive repressor of P<i><sub>Chr</i></sub>.</strong>
                  </p>
              </td>
@@ Line 283: / Line 278: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong><a href="http://parts.igem.org/Part:BBa_K1590005" target="_blank">BBa_K1590005</a></strong>
+                     <strong>-</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>pChrGFP</strong>
+                     <strong>P<sub><i>Chr</i></sub>- <i>gfp</i></strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Sequence of fluorescent reporter-fusion, chromate sensitive promoter + GFP.</strong>
+                     <strong>Sequence of fluorescent reporter-fusion, chromate sensitive promoter + <i>gfp</i>.</strong>
                  </p>
              </td>
@@ Line 320: / Line 315: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Lanosterol Synthase (Homo Sapiens)</strong>
+                     <strong><i>LSS</i> (Lanosterol Synthase - <i>Homo Sapiens</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for Human lanosterol synthase in silico optimised for increased expression level in E. coli K12.</strong>
+                     <strong>Coding sequence for Human lanosterol synthase in silico optimised for increased expression level in <i>E. coli</i> K12.</strong>
                  </p>
              </td>
@@ Line 352: / Line 347: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Odorant Binding Protein 2A (Homo sapiens)</strong>
+                     <strong><i> OBP2A</i> (Odorant Binding Protein 2A - <i>Homo sapiens</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for human odorant binding 2A protein in silico optimised for increased expression level in E. coli K12.</strong>
+                     <strong>Coding sequence for Human odorant binding 2A protein in silico optimised for increased expression level in <i>E. coli</i> K12.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Nasal Mucus Detection</strong>
+                     <strong>FluID - Nasal Mucus Detection</strong>
                  </p>
              </td>
@@ Line 383: / Line 378: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Odorant Binding Protein (Homo sapiens) - Helix</strong>
+                     <strong><OBP2A</i> (Odorant Binding Protein 2A - <i>Homo sapiens</I>) - Helix</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for C-terminal helix of human odorant binding protein.</strong>
+                     <strong>Coding sequence for C-terminal helix of Human odorant binding protein 2A.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Nasal Mucus Detection</strong>
+                     <strong>FluID - Nasal Mucus Detection</strong>
                  </p>
              </td>
@@ Line 414: / Line 409: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Odorant Binding Protein (Homo sapiens) - Barrel</strong>
+                     <strong><i> OBP2A</i> (Odorant Binding Protein 2A - <i>Homo sapiens</i>) - Barrel</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for N-terminal barrel of human odorant binding protein.</strong>
+                     <strong>Coding sequence for N-terminal barrel of Human odorant binding protein 2A.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Nasal Mucus Detection</strong>
+                     <strong>FluID - Nasal Mucus Detection</strong>
                  </p>
              </td>
@@ Line 446: / Line 441: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Lactoferrin Binding Protein (Neisseria Meningitidis)</strong>
+                     <strong><i> LbpA</i> (Lactoferrin Binding Protein A - <i>Neisseria Meningitidis</i></strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence lactoferrin binding protein.</strong>
+                     <strong>Coding sequence for lactoferrin binding protein A.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Saliva Detection</strong>
+                     <strong>FluID - Saliva Detection</strong>
                  </p>
              </td>
@@ Line 478: / Line 473: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>PotD (Escherichia Coli)</strong>
+                     <strong><i>PotD</i> (<i>Escherichia Coli</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Unmodified coding sequence for E.coli Spermidine Binding Protein PotD.</strong>
+                     <strong>Unmodified coding sequence for <i>E.coli</i> MG1655 Spermidine binding periplasmic protein.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Semen Detection</strong>
+                     <strong>FluID - Semen Detection</strong>
                  </p>
              </td>
@@ Line 510: / Line 505: @@
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Spermine Binding Protein (Mus Musculus)</strong>
+                     <strong><i> Sbp</i> (Spermine Binding Protein - <i>Mus Musculus</i>)</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>Coding sequence for murine Spermine Binding Protein in silico optimised for increased expression level in E. coli K12.</strong>
+                     <strong>Coding sequence for murine Spermine Binding Protein in silico optimised for increased expression level in <i>E. coli</i> K12.</strong>
                  </p>
              </td>
              <td width="312" valign="top">
                  <p align="center">
-                     <strong>BioSpray - Semen Detection</strong>
+                     <strong>FluID - Semen Detection</strong>
                  </p>
              </td>
@@ Line 537: / Line 532: @@
      </table>
+</center>
 </div>
@@ Line 732: / Line 727: @@
          <div class="modal-body">
-             <p class="sequences">>BBa_K1590006 (pChrGFP)
+             <p class="sequences">>Pchr-gfp
              ATTGCTTATTCCTATTGCCATTTGCTTTTATTTTGCAATACGTTTTAGCAACGCACAACACCTTATGGGTGTGCTGCTTCCATTGTGATTGCGCAAATGTCCGTTTTTGCAATCTACTCAAGACTTTATTTCGTAGATCTTATCTCATTATTGTAGTAACATCTACGACTACTAGACACAGAGGAACAGGTATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGCGATGTTAATGGGCAAAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGGAAGCTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGCGTATGGTCTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTACAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAAATGGAATACAACTATAACTCACATAATGTATACATCATGGCAGACAAACCAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTAAAGATGGAAGCGTTCAATTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA</p>
          </div>
@@ Line 759: / Line 754: @@
          <div class="modal-body">
-             <p class="sequences">>BBa_K1590007 (Lanosterol Synthase)
+             <p class="sequences">>BBa_K1590006 (Lanosterol Synthase)
              GCGCGAATTCGCGGCCGCTTCTAGATGACCGAAGGAACCTGCCTGCGTCGTCGTGGTGGTCCGTACAAAACCGAACCGGCGACCGACCTGGGTCGTTGGCGTCTGAACTGCGAACGTGGTCGTCAGACCTGGACCTACCTACAGGACGAACGTGCGGGTCGTGAACAGACCGGTCTGGAAGCGTACGCGCTGGGTCTGGACACCAAAAACTACTTCAAAGACCTGCCGAAAGCGCACACCGCGTTCGAAGGTGCGCTGAACGGTATGACCTTCTACGTTGGTCTACAGGCGGAAGACGGTCACTGGACCGGTGACTACGGTGGTCCGCTGTTCCTGCTGCCGGGTCTGCTGATCACCTGCCACGTTGCGCGTATCCCGCTGCCAGCTGGTTACCGAGAGGAAATTGTCCGATATCTACGATCAGTACAACTGCCGGACGGTGGTTGGGGTCTGCACATCGAAGACAAATCTACCGTTTTCGGAACCGCGCTGAACTACGTTTCTCTGCGTATCCTGGGTGTTGGTCCGGACGACCCGGACCTGGTTCGTGCGCGTAACATCCTGCACAAAAAAGGTGGTGCGGTTGCGATCCCGTCTTGGGGTAAATTCTGGCTGGCGGTTCTGAACGTTTACTCTTGGGAAGGTCTGAACACCCTGTTCCCGGAAATGTGGCTGTTCCCGGACTGGGCGCCGGCGCACCCGTCTACCCTGTGGTGCCACTGCCGTCAGGTTTACCTGCCGATGTCTTACTGCTACGCGGTTCGTCTGTCTGCGGCGGAAGACCCGCTGGTTCAGTCTCTGCGTCAGGAACTGTACGTTGAAGACTTCGCGTCTATAGATTGGCTAGCACAACGTAACAATGTTGCTCCAGATGAACTGTACACCCCGCACTCTTGGCTGCTGCGTGTTGTTTACGCGCTGCTGAACCTGTACGAACACCACCACTCTGCGCACCTGCGTCAGCGTGCGGTTCAGAAACTGTACGAACACATCGTTGCGGACGACCGTTTCACCAAATCTATCTCTATCGGTCCGATCTCTAAAACCATCAACATGCTGGTTCGTTGGTACGTTGACGGTCCGGCGTCTACCGCGTTCCAGGAACACGTTTCTCGTATCCCGGACTACCTGTGGATGGGTCTGGACGGTATGAAAATGCAGGGCACCAACGGTTCTCAGATATGGGACACCGCGTTCGCGATCCAGGCGCTGCTGGAAGCGGGTGGTCACCACCGTCCGGAGTTCTCTTCTTGCCTACAGAAAGCGCACGAGTTCCTGCGTCTGTCTCAGGTTCCAGATAATCCACCTGATTACCAGAAATACTACCGTCAGATGCGTAAAGGTGGTTTCTCTTTCTCTACCCTGGACTGCGGTTGGATCGTTTCTGACTGCACCGCGGAAGCGCTGAAAGCGGTTCTGCTGCTACAGGAAAAATGCCCGCACGTTACCGAACACATCCCGCGTGAACGTCTGTGCGACGCGGTTGCGGTTCTGCTGAACATGCGTAACCCGGACGGTGGTTTCGCGACCTACGAAACCAAACGTGGTGGTCACCTGCTGGAACTGCTGAACCCGTCTGAAGTTTTCGGTGACATCATGATCGACTACACCTATGTTGAATGCACCAGTGCGGTGATGCAGGCATTAAAATACTTCCACAAGCGCTTTCCGGAACACCGCGCAGCGGAAATCCGCGAAACGTTGACCCAAGGTCTGGAGTTCTGCCGTCGTCAGCAGCGTGCGGACGGTTCTTGGGAAGGTTCTTGGGGTGTTTGCTTCACCTACGGCACCTGGTTCGGTCTGGAAGCGTTCGCGTGCATGGGTCAGACCTACCGTGACGGAACCGCGTGCGCGGAAGTTTCTCGTGCGTGCGACTTCCTGCTGTCTCGTCAGATGGCGGACGGTGGTTGGGGTGAAGACTTCGAATCTTGCGAAGAACGTCGTTACCTACAGTCTGCGCAGTCTCAGATCCACAACACCTGCTGGGCGATGATGGGTCTGATGGCGGTTCGTCACCCGGACATCGAAGCGCAGGAACGTGGTGTTCGTTGCCTGCTGGAAAAACAGCTGCCGAACGGTGACTGGCCGCAGGAAAACATCGCGGGTGTTTTCAACAAATCTTGCGCGATCTCTTACACCTCTTACCGTAACATCTTCCCGATCTGGGCGCTGGGTCGTTTCTCTCAGCTGTACCCGGAACGTGCGCTGGCGGGTCACCCGTAATAATACTAGTAGCGGCCGCTGCAGGCGC</p>
          </div>
@@ Line 786: / Line 781: @@
          <div class="modal-body">
-             <p class="sequences">>BBa_K1590008 (Odorant Binding Protein 2A)
+             <p class="sequences">>BBa_K1590007 (Odorant Binding Protein 2A)
                    ATGCTGTCTTTCACCCTGGAAGAAGAAGACATCACCGGCACCTGGTACGTTAAAGCGATGGTTGTTGACAAAGACTTCCCGGAAGACCGTCGTCCGCGTAAAGTTTCTCCGGTTAAAGTTACCGCGCTGGGTGGTGGTAACCTGGAAGCGACCTTCACCTTCATGCGTGAAGACCGTTGCATCCAGAAAAAAATCCTGATGCGTAAAACCGAAGAACCGGGTAAATTCTCTGCGTACGGTGGTCGTAAACTGATCTACCTGCAAGAACTGCCGGGCACCGACGACTACGTTTTCTACTGCAAAGACCAGCGTCGTGGTGGTCTGCGTTACATGGGTAAACTGGTTGGTCGTAACCCGAACACCAACCTGGAAGCGCTGGAAGAATTTAAAAAACTGGTTCAGCACAAAGGTCTGTCTGAAGAAGACATCTTCATGCCGCTGCAAACCGGTTCTTGCGTTCTGGAACAC</p>
          </div>

Difference between revisions of "Team:Dundee/Sequences"

Latest revision as of 03:12, 19 September 2015