Difference between revisions of "Team:EPF Lausanne/Notebook/Ecoli"

 
(80 intermediate revisions by 2 users not shown)
Line 1: Line 1:
−
{{:Team:EPF_Lausanne/Test/Top_Nav}}
+
{{:Team:EPF_Lausanne/Top_Nav}}
 
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr">
 
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr">
 
   <head>
 
   <head>
Line 17: Line 17:
 
th, td {
 
th, td {
 
     padding: 10px;
 
     padding: 10px;
 +
}
 +
 +
p {
 +
  font: 9px;
 
}
 
}
 
</style>
 
</style>
Line 35: Line 39:
 
<div class="prot-section">
 
<div class="prot-section">
 
     <div class="row">
 
     <div class="row">
−
         <div class="col col-md-3 scrollspy">
+
         <div class="col col-md-2 scrollspy">
 
           <ul id="nav" class="nav hidden-xs hidden-sm" data-spy="affix">
 
           <ul id="nav" class="nav hidden-xs hidden-sm" data-spy="affix">
 
             <li class="active"><a href="#pdcas9w">Construction of pdCas9-w</a>
 
             <li class="active"><a href="#pdcas9w">Construction of pdCas9-w</a>
Line 43: Line 47:
 
                 <li><a href="#gibsonpdcas9w">Gibson assembly of pdCas9-w</a></li>
 
                 <li><a href="#gibsonpdcas9w">Gibson assembly of pdCas9-w</a></li>
 
                 <li><a href="#mutagenesis">Site-directed mutagenesis of pdCas9-w</a></li>
 
                 <li><a href="#mutagenesis">Site-directed mutagenesis of pdCas9-w</a></li>
−
                <li><a href="#biobrickpdcas9w">BioBrick mutated pdCas9-w</a></li>
 
 
               </ul>
 
               </ul>
 
             </li>
 
             </li>
 
             <li><a href="#pdcas9wsgrna">Construction of pdCas9-w-sgRNAs</a>
 
             <li><a href="#pdcas9wsgrna">Construction of pdCas9-w-sgRNAs</a>
 
               <ul class="nav">
 
               <ul class="nav">
−
                 <li><a href="#openpdcas9w">Open pdCas9-w by restriction digest</a></li>
+
                 <li><a href="#part1">Part 1: Assemble pdCas9-w + sgRNA</a>
−
                <li><a href="#pcrsgrna">Amplify sgRNA cassettes by PCR</a></li>
+
                  <ul>
−
                <li><a href="#gibsonpdcas9wsgrna">Assemble pdCas9-w-sgRNA constructs by Gibson assembly</a></li>
+
                    <li><a href="#openpdcas9w">Open pdCas9-w by restriction digest</a></li>
 +
                    <li><a href="#pcrsgrna">Amplify sgRNA cassettes by PCR</a></li>
 +
                    <li><a href="#gibsonpdcas9wsgrna">Assemble pdCas9-w-sgRNA constructs</a></li>
 +
                  </ul>
 +
                </li>
 +
                <li><a href="#part2">Part 2: Assemble pdCas9-w-sgRNA + sgRNA</a>
 +
                  <ul>
 +
                    <li><a href="#pcrpdcas9sgrna">Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR</a></li>
 +
                    <li><a href="#gibsonpdcas9wsgrna2">Assemble pdCas9-w-sgRNA-sgRNA constructs</a></li>
 +
                  </ul>
 +
                </li>
 
               </ul>
 
               </ul>
 
             </li>
 
             </li>
Line 58: Line 71:
 
                 <li><a href="#pcrj23117alt">PCR J23117alt promoter</a></li>
 
                 <li><a href="#pcrj23117alt">PCR J23117alt promoter</a></li>
 
                 <li><a href="#gibsonpwj89alt">Gibson assembly of pWJ89alt</a></li>
 
                 <li><a href="#gibsonpwj89alt">Gibson assembly of pWJ89alt</a></li>
−
                 <li><a href="#bbj23117alt">BioBrick J23117alt promoter</a></li>
+
              </ul>
 +
            </li>
 +
            <li><a href="#arac">Construction of pAraC-sgRNA</a>
 +
              <ul class="nav">
 +
                <li><a href="#pcrparac">PCR pAraC and sgRNA</a></li>
 +
                 <li><a href="#gibsonparac">Assemble pAraC-sgRNA constructs</a></li>
 
               </ul>
 
               </ul>
 
             </li>
 
             </li>
Line 68: Line 86:
 
               </ul>
 
               </ul>
 
             </li>
 
             </li>
−
            <li><a href="#double_reporter">Construction of pWJ89_mCherry</a>
+
             <li><a href="#activityassay">Transistor activity assays</a></li>
−
              <ul class="nav">
+
−
                <li><a href="#openpwj89">Open pWJ89 by restriction digest</a></li>
+
−
                <li><a href="#pcrpwj89alt">PCR pWJ89alt</a></li>
+
−
                <li><a href="#cutmcherry">Extract mCherry by restriction digest</a></li>
+
−
                <li><a href="#pcrmcherry">PCR mCherry</a></li>
+
−
                <li><a href="#gibsonpwj89_mcherry">Gibson assembly of pWJ89_mCherry</a></li>
+
−
              </ul>
+
−
            </li>
+
−
             <li><a href="#activityassay">Transistor activity assays</a>
+
−
            <ul class="nav">
+
−
              <li><a href="#">Simple activation and simple inhibition</a></li>
+
−
              <li><a href="#">Effect of tetracyclin on activation and inhibition</a></li>
+
−
              <li><a href="#">Induction of activation/inhibition with PBAD-AraC</a></li>
+
−
              <li><a href="#">Orthogonality of promoters</a></li>
+
−
              <li><a href="#">Chainability of promoters</a></li>
+
−
              <li><a href="#">Simultaneous activation and inhibtion</a></li>
+
−
            </ul>
+
−
            </li>
+
 
             <li><a href="#primers">Primer table</a></li>
 
             <li><a href="#primers">Primer table</a></li>
 +
            <li><a href="#ref">References</a></li>
 
           </ul>
 
           </ul>
 
         </div>
 
         </div>
  
−
         <div class="col-sm-9">
+
         <div class="col-md-offset-1 col-md-9">
−
 
+
    <p><i>Note that all experiments were done by EPFL iGEM team members.</i></p>
−
<!-- CONSTRUCTION PDCAS9-W ++ -->
+
<!-- CONSTRUCTION PDCAS9-W -->
 
     <section id="pdcas9w" class="panel">
 
     <section id="pdcas9w" class="panel">
−
       <h1>Construction of pdCas9-w</h1>
+
       <h1>Construction of pdCas9-w</br><small>07.05.2015 - 01.06.2015 + 28.07.2015 - 05.08.2015</small></h1>
−
       <p>pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP.</p>
+
       <p>pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP, controlled by a Tetracycline inducible promoter.</p>
  
 
       <h2>Materials and method</h2>
 
       <h2>Materials and method</h2>
 
       <ul>
 
       <ul>
−
         <li><b>Open pdCas9-bacteria by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler ladder)</br>pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249).</li>
+
         <li><b>Open pdCas9-bacteria by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products. pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249) [1].</li>
−
         <li><b>Extract w subunit from pWJ66 by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products (with 1kb Generuler)</br>pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570).
+
         <li><b>Extract w subunit from pWJ66 by Phusion PCR</b> (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products. pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570) [2].</li>
−
         <li><b>Gibson assembly (cf. Protocols) of pdCas9-w</b> using purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)</br>Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) <b>+</b> restriction digest (Cf. Protocols) of pdCas9-w (isolated by Miniprep (cf.Protocols)) with BamHI and KpnI seperately + agarose gel electrophoresis of 2 µL digested products (with 1kb Generuler) <b>+</b> sequencing (Microsynth)</li>
+
         <li><b>Gibson assembly (cf. Protocols) of pdCas9-w</b> with purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products <b>+</b> restriction digest (cf. Protocols) of pdCas9-w (isolated by Miniprep (cf. Protocols) with BamHI and KpnI separately + agarose gel electrophoresis of 2 µL digested products <b>+</b> sequencing (Microsynth)</li>
−
         <li><b>Site-directed mutagenesis (cf. Protocols) of dCas9-w</b> with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w (necesary for pdCas9-w to be BioBrick compatible)</br>Control with restriction digest (cf. Protocols) of mutated pdCas9-w (isolated by Miniprep (cf. Protocols)) with EcoRI <b>+</b> sequencing (Microsynth)</li>
+
         <li><b>Site-directed mutagenesis (cf. Protocols) of dCas9-w</b> with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w (necessary for pdCas9-w to be BioBrick compatible). Control with restriction digest (cf. Protocols) of mutated pdCas9-w-mut (isolated by Miniprep (cf. Protocols)) with EcoRI <b>+</b> sequencing (Microsynth)</li>
−
        <li><b>BioBrick mutated dCas9-w</b></li>
+
 
       </ul>
 
       </ul>
  
Line 110: Line 110:
  
 
       <div id="PCRpdcas9" class="panel">
 
       <div id="PCRpdcas9" class="panel">
−
         <h3>Open pdCas9 by PCR</h3>
+
         <h3>Open pdCas9 by PCR</br><small>07.05.2015, 10.05.2015</small></h3>
 
         <div class="row">
 
         <div class="row">
−
           <div class="col-md-8">
+
           <div class="col-md-7">
−
             <p>Linearized pdCas9-w is expected to be 6705 bp.</br>We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. Many, but not all, of our samples were successfully amplified (cf. Fig.1).</br>For next steps, sample from lane 1 (cf. Fig.1) was used.</p>
+
             <p>Linearized pdCas9-w is expected to be 6705 bp.</br>We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. All samples visible on gel were successfully amplified (cf. Fig.1).</br>For next steps, sample from lane 1 (cf. Fig.1) was used.</p>
 
           </div>
 
           </div>
−
           <div class="col-md-4">
+
           <div class="col-md-5">
 
             <figure>
 
             <figure>
−
               <a href="https://static.igem.org/mediawiki/2015/d/d4/Lab_nb_ecoli_fig1.jpg"><img src="https://static.igem.org/mediawiki/2015/d/d4/Lab_nb_ecoli_fig1.jpg" alt="Figure 1"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/archive/d/d4/20150913161250%21Lab_nb_ecoli_fig1.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/d/d4/20150913161250%21Lab_nb_ecoli_fig1.jpg" alt="Figure 1" style="height:100px"></a>
−
               <figcaption><b>Fig.1</b> - Gel of linearized pdCas9</figcaption>
+
               <figcaption><b>Fig.1</b> - Gel of pdCas9 linearized by PCR, successful for all 5 samples. </br><small>Ladder: 1kb Generuler.</small></figcaption>
 
             </figure>
 
             </figure>
 
           </div>
 
           </div>
Line 125: Line 125:
  
 
       <div id="PCRpwj66" class="panel">
 
       <div id="PCRpwj66" class="panel">
−
         <h3>Extract w subunit from pWJ66 by PCR</h3>
+
         <h3>Extract w subunit from pWJ66 by PCR</br><small>07.05.2015</small></h3>
 
         <div class="row">
 
         <div class="row">
−
           <div class="col-md-8">
+
           <div class="col-md-7">
−
             <p>Successful PCR reactions are expected to yield 340 bp fragments.</br>PCR was succesful for sample visible on gel. (cf. Fig.2)</p>
+
             <p>Successful PCR reactions are expected to yield 340 bp fragments.</br>PCR was successful for sample visible on gel. (cf. Fig.2)</p>
 
           </div>
 
           </div>
−
           <div class="col-md-4">
+
           <div class="col-md-5">
 
             <figure>
 
             <figure>
−
               <a href="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig2.jpg"><img src="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig2.jpg" alt="Figure 2"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/archive/e/ef/20150913161422%21Lab_nb_ecoli_fig2.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/e/ef/20150913161422%21Lab_nb_ecoli_fig2.jpg" alt="Figure 2" style="height:100px"></a>
−
               <figcaption><b>Fig.2</b> - Gel of w subunit extracted from pWJ66</figcaption>
+
               <figcaption><b>Fig.2</b> - Gel of w subunit extracted from pWJ66 by PCR, successful for sample in lane 1. </br><small>Ladder: 1kb Generuler.</small></figcaption>
 
             </figure>
 
             </figure>
 
           </div>
 
           </div>
Line 140: Line 140:
  
 
       <div id="gibsonpdcas9w" class="panel">
 
       <div id="gibsonpdcas9w" class="panel">
−
         <h3>Gibson assembly of pdCas9-w</h3>
+
         <h3>Gibson assembly of pdCas9-w</br><small>Gibson assembly, transformation: 19.05.2015. Colony PCR: 29.05.2015. Restriction analysis: 01.06.2015.</small></h3>
−
        <h4>Colony PCR</h4>
+
 
         <div class="row">
 
         <div class="row">
−
           <div class="col-md-8">
+
           <div class="col-md-7">
−
             <p>Amplicons are 666 bp if Gibson assembly worked and 396 bp if the plasmid self-ligated.</br>Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination.</br>Gibson assembly seems to have worked for some samples. (cf. Fig.3)</br>To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps. We did overnight liquid cultures of these colonies.</p>
+
             <p>Colony PCR yields 666 bp amplicons if Gibson assembly worked and 396 bp amplicons if the plasmid self-ligated.</br>Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination (cf. Fig3d).</br>Colony PCR shows that Gibson assembly worked for some samples (cf. Fig.3). To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps.</p>
 +
            <p>pdCas9-w was analyzed by restriction digest with BamHI and KpnI separately, both are single cutters in pdCas9 and double cutters in pdCas9-w. Digestion by BamHI yields fragments of 6147 bp and 834 bp, digestion by KpnI yields fragments of 4534 bp and 2447 bp (cf. Fig.4).</br> Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see. By looking at the relative heights, we can see that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel.</p>
 +
            <p>Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).</p>
 
           </div>
 
           </div>
−
           <div class="col-md-4">
+
           <div class="col-md-5">
 
             <figure>
 
             <figure>
−
               <a href="https://static.igem.org/mediawiki/2015/f/f9/Lab_nb_ecoli_fig3a.jpg"><img src="https://static.igem.org/mediawiki/2015/f/f9/Lab_nb_ecoli_fig3a.jpg" alt="Figure 3a" style="width:90%"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/archive/f/f9/20150914061631%21Lab_nb_ecoli_fig3a.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/f/f9/20150914061631%21Lab_nb_ecoli_fig3a.jpg" alt="Figure 3a" style="height:100px"></a>
−
               <a href="https://static.igem.org/mediawiki/2015/1/12/Lab_nb_ecoli_fig3b.jpg"><img src="https://static.igem.org/mediawiki/2015/1/12/Lab_nb_ecoli_fig3b.jpg" alt="Figure 3b" style="width:90%"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/archive/1/12/20150914061724%21Lab_nb_ecoli_fig3b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/1/12/20150914061724%21Lab_nb_ecoli_fig3b.jpg" alt="Figure 3b" style="height:100px"></a>
−
               <a href="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fib3c.jpg"><img src="https://static.igem.org/mediawiki/2015/7/77/Lab_nb_ecoli_fib3c.jpg" alt="Figure 3c" style="width:90%"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/archive/7/77/20150914061758%21Lab_nb_ecoli_fib3c.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/7/77/20150914061758%21Lab_nb_ecoli_fib3c.jpg" alt="Figure 3c" style="height:100px"></a>
−
               <a href="https://static.igem.org/mediawiki/2015/f/ff/Lab_nb_ecoli_fig4d.jpg"><img src="https://static.igem.org/mediawiki/2015/f/ff/Lab_nb_ecoli_fig4d.jpg" alt="Figure 3d" style="width:90%"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/4/4f/Lab_nb_ecoli_fig3d.jpg"><img src="https://static.igem.org/mediawiki/2015/4/4f/Lab_nb_ecoli_fig3d.jpg" alt="Figure 3d" style="height:100px"></a>
−
               <figcaption><b>Fig.3</b> - Gels of colony PCR of dCas9-w Gibson assembly products</figcaption>
+
               <figcaption><b>Fig.3</b> - Gels of colony PCR of dCas9-w Gibson assembly products. Gibson assembly worked for samples that have 666 bp amplicons: lanes 5, 6, 16, 22, 25-28, 30, 31, 37, 41, 43. All other lanes are self-ligation (396 bp amplicons). </br><small>Ladder: 1kb Generuler.</small></figcaption>
 +
            </figure>
 +
            <figure>
 +
              <a href="https://static.igem.org/mediawiki/2015/archive/0/0a/20150914061909%21Lab_nb_ecoli_fig4a.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/0/0a/20150914061909%21Lab_nb_ecoli_fig4a.jpg" alt="Figure 4a" style="height:100px"></a>
 +
              <a href="https://static.igem.org/mediawiki/2015/archive/0/0a/20150914061947%21Lab_nb_ecoli_fig4b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/0/0a/20150914061947%21Lab_nb_ecoli_fig4b.jpg" alt="Figure 4b" style="height:100px"></a>
 +
              <a href="https://static.igem.org/mediawiki/2015/archive/9/9c/20150914062022%21Lab_nb_ecoli_fig4c.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/9/9c/20150914062022%21Lab_nb_ecoli_fig4c.jpg" alt="Figure 4c" style="height:100px"></a>
 +
              <figcaption><b>Fig.4</b> - Gels of restriction digest of pdCas9-w Gibson assembly products. Each colony is present on gels in triplicates: undigested (7kb but migrates faster than linear DNA), digested by BamHI (6147 bp + 834 bp) and digested by KpnI (4534 bp + 2447 bp). All digestions worked and show that plasmids contain the w subunit. Undigested plasmid for sample 16 is not visible due to a technical error. </br><small>Ladder: 1kb Generuler.</small></figcaption>
 
             </figure>
 
             </figure>
 
           </div>
 
           </div>
 
         </div>
 
         </div>
−
         <h4>Restriction digest</h4>
+
      </div>
 +
 
 +
      <div id="mutagenesis" class="panel">
 +
         <h3>Site-directed mutagenesis of dCas9-w</br><small>Site-directed mutagenesis: 28.07.2015, 29.07.2015. Restriction digest: 05.08.2015</small></h3>
 
         <div class="row">
 
         <div class="row">
−
           <div class="col-md-8">
+
           <div class="col-md-7">
−
             <p>pdCas9-w samples from different colonies are present on gels in triplicates in the following order:</p>
+
             <p>The first restriction digest analysis of many pdCas9-w-mut colonies was inconclusive, so we chose one colony to do a second restriction digest analysis (cf. Fig.5). First, note that the ladder did not work well so we will ignore it and only look at the relative heights and number of bands. Also, lanes 1, 4 and 6 concerned another experiment so we will ignore them.</p>
−
             <ul>
+
             <p>pdCas9-w and pdCas9-w-mut undigested (cf. Fig.5 lanes 2 and 8) should both contain the 7 kb circular plasmid. pdCas9-w digested with BsrBI (cf. Fig.5 lane 7) and pdCas9-w-mut digested with EcoRI or BsrBI separately (cf. Fig.5 lanes 10 and 11) should contain the linearized 7 kb plasmid. pdCas9-w digeted with EcoRI (cf. Fig.5 lane 5) should contain two fragments of 5.6 kb and 1.4 kb. pdCas9-w digested with EcoRI and BsrBI (cf. Fig.5 lane 3) should contain three fragments of 3.2 kb, 2.4 kb and 1.4 kb, pdCas9-w-mut digested with the same enzymes (cf. Fig.5 lane 9) should contain two fragments of 4.6 kb and 2.4 kb.</br>We can see that the pattern on the gel is correct so the mutagenesis worked. Notice than the circular plasmids migrated less than the linear plasmids and also that the undigested plasmids seem to contain a second smaller fragment which is probably contamination.</p>
−
              <li>Undigested - expected to yield 7 kb circular plasmid (migrates faster than linear fragments of the same size)</li>
+
−
              <li>Digested by BamHI - expected to yield two fragments of 6147 bp and 834 bp if insert is present or one 6705 bp fragment if it is not</li>
+
−
              <li>Digested by KpnI - expected to yield two fragments of 45334 bp and 2447 bp if insert is present or one 6705 bp fragment if it is not</li>
+
−
            </ul>
+
−
            <p>BamHI and KpnI are both unique cutters in pdCas9 (without the insert) and double cutters in pdCas9-w (with the insert).</br>Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see.</br>By looking at the relative heights, we can say that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel. </br>Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).</p>
+
 
           </div>
 
           </div>
−
           <div class="col-md-4">
+
           <div class="col-md-5">
 
             <figure>
 
             <figure>
−
               <a href="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4a.jpg"><img src="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4a.jpg" alt="Figure 4a" style="width:70%"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/2/24/Lab_nb_ecoli_fig5.jpg"><img src="https://static.igem.org/mediawiki/2015/2/24/Lab_nb_ecoli_fig5.jpg" alt="Figure 5" style="height:200px"></a>
−
               <a href="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg"><img src="https://static.igem.org/mediawiki/2015/0/0a/Lab_nb_ecoli_fig4b.jpg" alt="Figure 4b" style="width:70%"></a>
+
               <figcaption><b>Fig.5</b> - Gel of restriction digest of mutagenesis product (note that lanes 1, 4 and 6 can be ignored)</br>Lane 2: pdCas9-w undigested. Lane 3: pdCas9-w digested with BsrBI and EcoRI. Lane 5: pdCas9-w digested with EcoRI. Lane 7: pdCas9-w digested with BsrBI. Lane 8: pdCas9-w-mut undigested. Lane 9: pdCas9-w-mut digested by BsrBI and EcoRI. Lane 10: pdCas9-w-mut digested with EcoRI. Lane 11: pdCas9-w-mut digested with BsrBI. </br><small>Ladder: 1kb Generuler (did not work well)</small></figcaption>
−
              <a href="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9c/Lab_nb_ecoli_fig4c.jpg" alt="Figure 4c" style="width:70%"></a>
+
−
              <figcaption><b>Fig.4</b> - Gels of restriction digest of pdCas9-w Gibson assembly products</figcaption>
+
 
             </figure>
 
             </figure>
 
           </div>
 
           </div>
 
         </div>
 
         </div>
−
        <h4>Sequencing</h4>
 
−
        <p>As dCas9-w is very long, only part of it was sequenced (the w subunit and its surrounding base pairs). No mutations were detected.</p>
 
−
      </div>
 
−
 
−
      <div id="mutagenesis" class="panel">
 
−
        <h3>Site-directed mutagenesis of dCas9-w</h3>
 
−
      </div>
 
−
 
−
      <div id="biobrickpdcas9w" class="panel">
 
−
        <h3>BioBrick mutated dCas9-w</h3>
 
 
       </div>
 
       </div>
 
     </section>
 
     </section>
  
  
−
<!--CONSTRUCTION PDCAS9-W-SGRNAS ++ -->
+
<!--CONSTRUCTION PDCAS9-W-SGRNAS -->
 
       <section id="pdcas9wsgrna" class="panel">
 
       <section id="pdcas9wsgrna" class="panel">
−
         <h1>Construction of pdCas9-w-sgRNAs</h1>
+
         <h1>Construction of pdCas9-w-sgRNAs - 08.07.2015 - 02.09.2015</h1>
−
         <p>These experiments consist of inserting one or two sgRNA producing cassettes (cf. Fig.8a) into pdCas9-w.</p>
+
         <p>pdCas9-w-sgRNAs contain a gene producing dCas9-w controlled by a Tetracycline inducible promoter and sgRNA producing cassette (constitutive promoter).</p>
−
        <h2>Materials and method</h2>
+
 
         <div class="row">
 
         <div class="row">
−
           <div class="col-md-8">
+
           <div class="col-md-7">
−
             <ul>
+
             <p>These experiments consist of inserting one or two sgRNA producing cassettes (cf. Fig.6) into pdCas9-w. In <b>part 1</b>, one sgRNA (X0, X4, X35, Z0, Z4 or Z35) was inserted into pdCas9-w by Gibson assembly. For technical reasons, we were unable to make most constructs with two inserted cassettes using this method. In <b>part 2</b>, we extracted sgRNA cassettes from existing constructs and inserted them in other constructs that already contained one other sgRNA cassette.</p>
−
              <li><b>Open pdCas9-w by restriction digest</b> (cf. Protocols) with BsrBI (blunt ends) + agarose gel electrophoresis of 2 µL of digested and undigested product (with 1kb Generuler)</li>
+
−
              <li><b>Amplify sgRNA cassettes by Phusion or Q5 PCR</b> (cf. Protocols) with primers as indicated in table below (->Results->Amplify sgRNA cassettes by PCR) + agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler) + PCR product purification (cf. Protocols). sgRNA cassettes were synthesized by IDT.</br>With this PCR, we added the necessary overlaps for Gibson assembly of two or three sgRNA cassettes (cf. Fig.8b), as the cassettes were synthsized with the overlaps for insertion of one sgRNA cassette.</li>
+
−
              <li><b>Assemble pdCas9-w-sgRNA constructs by Gibson assembly</b>
+
−
                <ul>
+
−
                  <li><b>Part 1: Assemble pdCas9-w + sgRNA by Gibson assembly</b> (cf. Protocols) of linearized pdCas9-w and purified sgRNA PCR products + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)</br>Control with colony PCR (cf. Protocols) with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) (one colony PCR (cf. Fig11a) was done with primers f_Gbs_pdCas9 and r_Scq_pdCas9_w_sgRNA) <b>+</b> sequencing (Microsynth)</li>
+
−
                  <li><b>Part 2: Assembly pdCas9-w-sgRNA + sgRNA by Gibson assembly (of?)</b></li> (cf. Protocols) + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB)</br>Control with colony PCR (cf. Protocols) (primers?) + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler) <b>+</b> sequencing (Microsynth)</li>
+
−
                </ul>
+
−
              </li>
+
−
            </ul>
+
 
           </div>
 
           </div>
−
           <div class="col-md-4">
+
           <div class="col-md-5">
 
             <figure>
 
             <figure>
−
               <a href="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg" alt="Figure ¨8a" style="width:100%"></a>
+
               <a href="https://static.igem.org/mediawiki/2015/2/24/Lab_nb_ecoli_fig6.jpg"><img src="https://static.igem.org/mediawiki/2015/2/24/Lab_nb_ecoli_fig6.jpg" alt="Figure 6" style="height:150px"></a>
−
              <a href="https://static.igem.org/mediawiki/2015/archive/a/a0/20150907074344%21Lab_nb_ecoli_fig8b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/a/a0/20150907074344%21Lab_nb_ecoli_fig8b.jpg" alt="Figure ¨8b" style="width:100%"></a>
+
               <figcaption><b>Fig.6</b> - Schematics of structure of sgRNA cassettes</figcaption>
−
               <figcaption><b>Fig.8:Schematics of structure and assembly of sgRNA cassettes</b></br><small><b>Fig.8a</b> - Structure of a sgRNA cassette</br><b>Fig.8b</b> - Assembly of three sgRNA cassettes</small></figcaption>
+
 
             </figure>
 
             </figure>
 
           </div>
 
           </div>
 
         </div>
 
         </div>
  
−
     
+
        <h2>Materials and method</h2>
 +
        <h4>Part 1: Assemble pdCas9-w + sgRNA</h4>
 +
        <ul>
 +
          <li><b>Open pdCas9-w by restriction digest</b> (cf. Protocols) with BsrBI (blunt ends) + agarose gel electrophoresis of 2 µL of digested and undigested product</li>
 +
          <li><b>Amplify sgRNA cassettes by Phusion or Q5 PCR</b> (cf. Protocols) with primers f_Gbs_sgRNA-A and r_Gbs_sgRNA-B + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols).</li>
 +
          <li><b>Gibson assembly pdCas9-w-sgRNA</b> (cf. Protocols) with linearized pdCas9-w and purified sgRNA PCR products + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs + agarose gel electrophoresis of 2 µL PCR products <b>+</b> sequencing (Microsynth)</li>
 +
        </ul>
 +
 
 +
        <h4>Part 2: Assemble pdCas9-w-sgRNA + sgRNA</h4>
 +
        <ul>
 +
          <li><b>Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR</b> (cf. Protocols) with primers f_Gbs_sgRNAinPd and r_Gbs_sgRNAinPd + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)</li>
 +
          <li><b>Open pdCas9-w-sgRNA by Q5 PCR</b> (cf. Protocols) with primers f_opn_d9w and r_opn_d9w + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)</li>
 +
          <li><b>Gibson assembly of pdCas9-w-sgRNA</b>, as indicated in table below + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Sq_CoP_pdCas92ndIns and r_Sq_CoP_pAraC2ndInsert + agarose gel electrophoresis of 2 µL PCR products <b>+</b> sequencing (Microsynth)</li>
 +
        </ul>
 +
        <table>
 +
          <tr>
 +
            <th>Final constructs</th>
 +
            <th>sgRNA insert</th>
 +
            <th>sgRNA in pdCas9-w-sgRNA (backbone)</th>
 +
          </tr>
 +
          <tr>
 +
            <td>pdCas9-w-Z0-Z4</td>
 +
            <td>Z4</td>
 +
            <td>pdCas9-w-Z0</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pdCas9-w-Z0-Z35</td>
 +
            <td>Z35</td>
 +
            <td>pdCas9-w-Z0</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pdCas9-w-Z4-Z35</td>
 +
            <td>Z35</td>
 +
            <td>pdCas9-w-Z4</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pdCas9-w-X0-X4</td>
 +
            <td>X4</td>
 +
            <td>pdCas9-w-X0</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pdCas9-w-X0-X35</td>
 +
            <td>X35</td>
 +
            <td>pdCas9-w-X0</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pdCas9-w-X4-X35</td>
 +
            <td>X35</td>
 +
            <td>pdCas9-w-X4</td>
 +
          </tr>
 +
          </table>
 +
 
 
         <h2>Results</h2>
 
         <h2>Results</h2>
−
         <div id="openpdcas9w" class="panel">
+
         <div id="part1" class="panel">
−
           <h3>Open pdCas9-w by restriction digest</h3>
+
           <h3>Part 1: Assemble pdCas9-w + sgRNA</br><small>08.07.2015 - 07.08.2015</small></h3>
−
          <div class="row">
+
          <div id="openpdcas9w">
−
            <div class="col-md-8">
+
            <h4>Open pdCas9-w by restriction digest</br><small>16.07.2015, 19.07.2015, 26.07.2015, 02.08.2015 (repeats)</small></h4>
−
              <p>The digested and undigested plasmids should have the same size. Circular fragments migrates faster than linear fragments of the same size. This means that the undigested plasmid should migrate faster than the digested plasmid.</br>Even though the ladder is not clear, by looking at the relative heights we can see that the digested sample migrated more slowly than the undigested sample (cf. Fig.9). The restriction digest was successful.</p>
+
            <div class="row">
−
              <p>Note that this was repeated several times since we needed a lot of linearized pdCas9-w.</p>
+
              <div class="col-md-7">
 +
                <p>The digested and undigested plasmids have the same size. Circular fragments migrates differently (generally faster) than linear fragments of the same size. This means that the undigested and digested plasmid will migrate differently. Even though the ladder is not clear, we see that the digested sample migrated more slowly than the undigested sample (cf. Fig.7). The restriction digest was successful.</br>Digestion was repeated at least 4 times, we needed it for many PCRs.</p>
 +
              </div>
 +
              <div class="col-md-5">
 +
                <figure>
 +
                  <a href="https://static.igem.org/mediawiki/2015/9/95/Lab_nb_ecoli_fig7.jpg"><img src="https://static.igem.org/mediawiki/2015/9/95/Lab_nb_ecoli_fig7.jpg" alt="Figure 7" style="height:150px"></a>
 +
                  <figcaption><b>Fig.7</b> - Gel of pdCas9-w digested by BamHI (lane 1) and undigested (lane 2). Digested plasmid is lower on gel, which means digestion worked. </br><small>Ladder: 1kb Generuler.</small></figcaption>
 +
                </figure>
 +
              </div>
 
             </div>
 
             </div>
−
             <div class="col-md-4">
+
          </div>
−
               <figure>
+
          <div id="pcrsgrna">
−
                 <a href="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg"><img src="https://static.igem.org/mediawiki/2015/2/2e/Lab_nb_ecoli_fig9.jpg" alt="Figure 9"></a>
+
            <h4>Amplify sgRNA cassettes by PCR</br><small>08.07.2015, 09.07.2015, 10.07.2015, 13.07.2015, 14.07.2015, 15.07.2015, 16.07.2015, 02.08.2015, 03.08.2015, 04.08.2015, 06.08.2015</small></h4>
−
                 <figcaption><b>Fig.9</b> - Gel of digested pdCas9-w (lane 1) and undigested pdCas9-w (lane 2)</figcaption>
+
             <div class="row">
−
              </figure>
+
              <div class="col-md-6">
 +
                <p>Amplified sgRNA cassettes are expected to be about 370 bp.</br>sgRNA cassette Z0 was amplified with Q5 PCR, both samples were successfully amplified (cf. Fig.8a). sgRNA cassette Z4 was amplified with Phusion PCR, samples 3 and 4 were successfully amplified (cf. Fig.8b). sgRNA cassette Z35 was successfully amplified with Phusion PCR, it is hardly visible on the gel (cf. Fig.8c). sgRNA cassette X0 was successfully amplified with Phusion PCR (cf. Fig.8d). sgRNA cassette X4 was successfully amplified with Phusion PCR (cf. Fig.8e). sgRNA cassette X35 was successfully amplified with Phusion PCR (cf. Fig.8f).</p>
 +
                <p>Many PCRs were necessary to obtain all sgRNAs because of technical problems, such as PCR reactions not working and contamination of most of our tubes. Figures show only the samples that were used in the next steps.</p>
 +
               </div>
 +
              <div class="col-md-6">
 +
                 <figure>
 +
                  <a href="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig8a.jpg" alt="Figure 8a" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/a/a0/Lab_nb_ecoli_fig8b.jpg"><img src="https://static.igem.org/mediawiki/2015/a/a0/Lab_nb_ecoli_fig8b.jpg" alt="Figure 8b" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/8/88/Lab_nb_ecoli_fig8c.jpg"><img src="https://static.igem.org/mediawiki/2015/8/88/Lab_nb_ecoli_fig8c.jpg" alt="Figure 8c" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/8/87/Lab_nb_ecoli_fig8d.jpg"><img src="https://static.igem.org/mediawiki/2015/8/87/Lab_nb_ecoli_fig8d.jpg" alt="Figure 8d" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/b/b3/Lab_nb_ecoli_fig8e.jpg"><img src="https://static.igem.org/mediawiki/2015/b/b3/Lab_nb_ecoli_fig8e.jpg" alt="Figure 8e" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/2/22/Lab_nb_ecoli_fig8f.jpg"><img src="https://static.igem.org/mediawiki/2015/2/22/Lab_nb_ecoli_fig8f.jpg" alt="Figure 8f" style="height:110px"></a>
 +
                  <figcaption><b>Fig.8: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.8a</b> - Gel of sgRNA cassette Z0 amplicon (lanes 1-2), successful for both samples</br><b>Fig.8b</b> - Gel of sgRNA cassette Z4 amplicon, successful for samples in lanes 3 and 4</br><b>Fig.8c</b> - Gel of sgRNA cassette Z35 amplicon, successful for sample in lane 1</br><b>Fig.8d</b> - Gel of sgRNA cassette X0 amplicon, successful for sample</br><b>Fig.8e</b> - Gel of sgRNA cassette X4 amplicon</br><b>Fig.8f</b> - Gel of sgRNA cassette X35 amplicon, successful for sample</br>Ladder: 1kb Generuler.</small></figcaption>
 +
                 </figure>
 +
              </div>
 +
            </div>
 +
          </div>
 +
          <div id="gibsonpdcas9wsgrna">
 +
            <h4>Assemble pdCas9-w-sgRNA constructs</br><small>Gibson assembly, transformation: 16.07.2015, 17.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 04.08.2015, 05.08.2015</br> Colony PCR: 17.07.2015, 26.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 30.07.2015, 05.08.2015, 06.08.2015, 07.08.2015</small></h4>
 +
            <div class="row">
 +
              <div class="col-md-7">
 +
                <p>In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.</p>
 +
                <p>pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.9a) was confirmed by sequencing to be pdCas9-w-Z0. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.9a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.9b). Sequencing confirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.9c) and sequencing confirmed that is the case. Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.9d). Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.9e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4. Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.9d).</p>
 +
                <p>Sequencing showed some mutations and/or deletions in the promoter and/or terminator for some of these samples. Because of time constraints, we decided to keep working with these and see the effect of the mutations during the activity assay.</p>
 +
              </div>
 +
              <div class="col-md-5">
 +
                <figure>
 +
                  <a href="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig9a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/35/Lab_nb_ecoli_fig9a.jpg" alt="Figure 9a" style="width:100%"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/8/8e/Lab_nb_ecoli_fig9b.jpg"><img src="https://static.igem.org/mediawiki/2015/8/8e/Lab_nb_ecoli_fig9b.jpg" alt="Figure 9b" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/2/2a/Lab_nb_ecoli_fig9c.jpg"><img src="https://static.igem.org/mediawiki/2015/2/2a/Lab_nb_ecoli_fig9c.jpg" alt="Figure 9c" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/f/f9/Lab_nb_ecoli_fig9d.jpg"><img src="https://static.igem.org/mediawiki/2015/f/f9/Lab_nb_ecoli_fig9d.jpg" alt="Figure 9d" style="height:110px"></a>
 +
                  <a href="https://static.igem.org/mediawiki/2015/1/1d/Lab_nb_ecoli_fig9e.jpg"><img src="https://static.igem.org/mediawiki/2015/1/1d/Lab_nb_ecoli_fig9e.jpg" alt="Figure 9e" style="height:110px"></a>
 +
                  <figcaption><b>Fig.9: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products</b></br><small><b>Fig.9a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.</br><b>Fig.9b</b> - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies</br><b>Fig.9c</b> - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others</br><b>Fig.9d</b> - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.</br><b>Fig.9e</b> - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.</br>Ladder: 1kb Generuler.</small></figcaption>
 +
                </figure>
 +
              </div>
 
             </div>
 
             </div>
 
           </div>
 
           </div>
 
         </div>
 
         </div>
  
−
         <div id="pcrsgrna" class="panel">
+
         <div id="part2" class="panel">
−
           <h3>Amplify sgRNA cassettes by PCR</h3>
+
           <h3>Part 2: Assemble pdCas9-w-sgRNA + sgRNA</br><small>24.08.2015 - 02.09.2015</small></h3>
−
          <table>
+
          <div id="pcrpdcas9sgrna">
−
            <tr>
+
             <h4>Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR</br><small>24.08.2015, 25.08.2015, 28.08.2015, 31.08.2015</small></h4>
−
              <th>sgRNA cassette(s)</th>
+
             <div class="row">
−
              <th>Forward primer(s) / Reverse primer(s)</th>
+
              <div class="col-md-6">
−
            </tr>
+
                <p>Amplified sgRNA cassettes (Z4, Z35, X4 and X35) are expected to be 400 bp. All were successfully amplified (cf. Fig.10a and Fig.10b).</br>Amplified pdCas9-w-sgRNA (Z0, Z4, X0 and X4) are expected to be about 7000 bp. All were successfully amplified (cf. Fig.10a and Fig.10b).</br>
−
            <tr>
+
               </div>
−
              <td>Z0</td>
+
              <div class="col-md-6">
−
              <td>f_Gbs_sgRNA-A / r_Gbs_sgRNA-B</br>f_Gbs_sgRNA-A / r_Gbs_sgRNA-BtoD</td>
+
−
            </tr>
+
−
            <tr>
+
−
              <td>Z4</td>
+
−
              <td>f_Gbs_sgRNA-A / r_Gbs_sgRNA-B</td>
+
−
            </tr>
+
−
            <tr>
+
−
              <td>Z35</td>
+
−
              <td>f_Gbs_sgRNA-A / r_Gbs_sgRNA-B</td>
+
−
             </tr>
+
−
            <tr>
+
−
              <td>X0</td>
+
−
              <td>f_Gbs_sgRNA-A / r_Gbs_sgRNA-B</td>
+
−
            </tr>
+
−
            <tr>
+
−
              <td>X4</td>
+
−
              <td>f_Gbs_sgRNA-A / r_Gbs_sgRNA-B</td>
+
−
            </tr>
+
−
            <tr>
+
−
              <td>X35</td>
+
−
              <td>f_Gbs_sgRNA-A / r_Gbs_sgRNA-B</td>
+
−
             </tr>   
+
−
          </table>
+
−
          <div class="row">
+
−
            <div class="col-md-8">
+
−
              <p>All amplified sgRNA cassettes are expected to be about 370 bp.</p>
+
−
              <p>sgRNA cassette Z0 was amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Q5 PCR. Both samples were successfully amplified (cf. Fig.10a).</p>
+
−
              <p>sgRNA cassette Z4 was amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. Samples 3 and 4 were successfuly amplified (cf. Fig.10b).</p>
+
−
              <p>sgRNA cassette Z35 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. However, it is not easily visible on the gel. (cf. Fig.10c)</p>
+
−
              <p>sgRNA cassette X0 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10d)</p>
+
−
              <p>sgRNA cassette X4 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10e)</p>
+
−
               <p>sgRNA cassette X35 was successfuly amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B with Phusion PCR. (cf. Fig.10f)</p>
+
−
            </div>
+
−
            <div class="col-md-4">
+
 
               <figure>
 
               <figure>
−
                 <a href="https://static.igem.org/mediawiki/2015/3/3b/Lab_nb_ecoli_fig10a.jpg"><img src="https://static.igem.org/mediawiki/2015/3/3b/Lab_nb_ecoli_fig10a.jpg" alt="Figure 10a" style="width:80%"></a>
+
                 <a href="https://static.igem.org/mediawiki/2015/archive/3/3b/20150915095304%21Lab_nb_ecoli_fig10a.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/3/3b/20150915095304%21Lab_nb_ecoli_fig10a.jpg" alt="Figure 10a" style="height:150px"></a>
−
                 <a href="https://static.igem.org/mediawiki/2015/8/80/Lab_nb_ecoli_fig10b.jpg"><img src="https://static.igem.org/mediawiki/2015/8/80/Lab_nb_ecoli_fig10b.jpg" alt="Figure 10b" style="width:80%"></a>
+
                 <a href="https://static.igem.org/mediawiki/2015/archive/8/80/20150915095837%21Lab_nb_ecoli_fig10b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/8/80/20150915095837%21Lab_nb_ecoli_fig10b.jpg" alt="Figure 10b" style="height:150px"></a>
−
                <a href="https://static.igem.org/mediawiki/2015/9/94/Lab_nb_ecoli_fig10c.jpg"><img src="https://static.igem.org/mediawiki/2015/9/94/Lab_nb_ecoli_fig10c.jpg" alt="Figure 10c" style="width:80%"></a>
+
                 <figcaption><b>Fig.10</b> - Gels of PCR products of pdCas9-w-sgRNA and sgRNA cassettes</br><small><b>Fig.10a</b> - Gel of PCR products for the construction of pdCas9-w-sgRNA: pdCas9-w-Z0 (lane 1), pdCas9-w-Z4 (lane 2), sgRNA Z4 (lane 3), pdCas9-w-X0 (lane 4), pdCas9-w-X4 (lane 5) and sgRNA X4 (lane 6), all were successfully amplified.</br><b>Fig.10b</b> - Gel of PCR products sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), both successfully amplified. (Lanes 1-6 are for the construction of pAraC-sgRNA, see below.)</br>Ladder: 1kb Generuler.</small></figcaption>
−
                <a href="https://static.igem.org/mediawiki/2015/5/57/Lab_nb_ecoli_fig10d.jpg"><img src="https://static.igem.org/mediawiki/2015/5/57/Lab_nb_ecoli_fig10d.jpg" alt="Figure 10d" style="width:80%"></a>
+
−
                <a href="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg"><img src="https://static.igem.org/mediawiki/2015/9/9a/Lab_nb_ecoli_fig10e.jpg" alt="Figure 10e" style="width:80%"></a>
+
−
                <a href="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg"><img src="https://static.igem.org/mediawiki/2015/e/ef/Lab_nb_ecoli_fig10f.jpg" alt="Figure 10f" style="width 80%"></a>
+
−
                 <figcaption><b>Fig.10: Gels of sgRNA cassettes amplified by PCR</b></br><small><b>Fig.10a</b> - Gel of sgRNA cassette Z0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-BtoD (lane 1) and primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B (lane 2)</br><b>Fig.10b</b> - Gel of sgRNA cassette Z4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10c</b> - Gel of sgRNA cassette Z35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10d</b> - Gel of sgRNA cassette X0 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10e</b> - Gel of sgRNA cassette X4 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</br><b>Fig.10f</b> - Gel of sgRNA cassette X35 amplified with primers f_Gbs_sgRNA-A + r_Gbs_sgRNA-B</small></figcaption>
+
 
               </figure>
 
               </figure>
 
             </div>
 
             </div>
 
           </div>
 
           </div>
−
        </div>
+
          <div id="gibsonpdcas9wsgrna2">
−
 
+
            <h4>Assemble pdCas9-w-sgRNA-sgRNA constructs</br><small>Gibson assembly, transformation: 26.08.2015, 31.08.2015. Colony PCR: 31.08.2015, 02.09.2015</small></h4>
−
        <div id="gibsonpdcas9wsgrna" class="panel">
+
            <div class="row">
−
          <h3>Assemble pdCas9-w-sgRNA constructs by Gibson assembly</h3>
+
              <div class="col-md-6">
−
          <h4>Part 1: pdCas9-w + sgRNA assembly</h4>
+
                <p>Colony PCR primers are placed such as amplicons are 724 bp if Gibson assembly worked and are 390 bp if it did not (self-ligation). </br>All necessary constructs were successfully obtained. Following colonies were kept for our constructs: colony #1 for pdCas9-w-Z0-Z4 (cf. Fig.11a), colony #4 (2nd attempt) for pdCas9-w-Z0-Z35 (cf. Fig.11c), colony #6 for pdCas9-w-Z4-Z35 (cf. Fig.11b), colony #4 for pdCas9-w-X0-X4 (cf. Fig.11c), colony #2 for pdCas9-w-X0-X35 (cf. Fig.11d) and colony #1 for pdCas9-w-X4-X35 (cf. Fig.11e).</p>
−
          <div class="row">
+
              </div>
−
            <div class="col-md-8">
+
              <div class="col-md-6">
−
              <p>In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.</p>
+
                <figure>
−
              <p>pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.11a) was confirmed by sequencing to be pdCas9-w-Z0 and to not contain any mutations that may have an effect on its activity. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.11a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. (This sample will be used again in Part 2.)</br>Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.11b). Sequencing comfirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.11c) and sequencing confirmed that is the case. Sequencing also showed some mutations or deletions in the promoter and/or terminator for these 2 samples. We decided to keep working with these and test whether these mutations are significative with an activity assay.</br>Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.11d). However, it contains a mutation in the promoter. A 2nd pdCas9-w-X0 without mutations will be constructed in part 2, after which we will be able to compare the activity of this promoter with/without a mutation.</br>Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.11e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4 and that it does not contain any mutations.</br>Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.11d) and no mutations were found in the sequence.</p>
+
                  <a href="https://static.igem.org/mediawiki/2015/archive/f/f8/20150915132009%21Lab_nb_ecoli_fig11a.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/f/f8/20150915132009%21Lab_nb_ecoli_fig11a.jpg" alt="Figure 11a" style="height:110px"></a>
−
            </div>
+
                  <a href="https://static.igem.org/mediawiki/2015/archive/c/c4/20150915132151%21Lab_nb_ecoli_fig11b.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/c/c4/20150915132151%21Lab_nb_ecoli_fig11b.jpg" alt="Figure 11b" style="height:110px"></a>
−
            <div class="col-md-4">
+
                  <a href="https://static.igem.org/mediawiki/2015/archive/e/e0/20150915132316%21Lab_nb_ecoli_fig11c.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/e/e0/20150915132316%21Lab_nb_ecoli_fig11c.jpg" alt="Figure 11c" style="height:110px"></a>
−
              <figure>
+
                  <a href="https://static.igem.org/mediawiki/2015/archive/6/64/20150915132549%21Lab_nb_ecoli_fig11d.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/6/64/20150915132549%21Lab_nb_ecoli_fig11d.jpg" alt="Figure 11d" style="height:110px"></a>
−
                <a href="https://static.igem.org/mediawiki/2015/f/f8/Lab_nb_ecoli_fig11a.jpg"><img src="https://static.igem.org/mediawiki/2015/f/f8/Lab_nb_ecoli_fig11a.jpg" alt="Figure 11a" style="width:100%"></a>
+
                  <a href="https://static.igem.org/mediawiki/2015/archive/a/ae/20150915132703%21Lab_nb_ecoli_fig11e.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/a/ae/20150915132703%21Lab_nb_ecoli_fig11e.jpg" alt="Figure 11e" style="height:110px"></a>
−
                <a href="https://static.igem.org/mediawiki/2015/c/c4/Lab_nb_ecoli_fig11b.jpg"><img src="https://static.igem.org/mediawiki/2015/c/c4/Lab_nb_ecoli_fig11b.jpg" alt="Figure 11b" style="width:80%"></a>
+
                  <figcaption><b>Fig.11</b> - Gels of colony PCR of pdCas9-w-sgRNAs</br><small><b>Fig.11a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-2), successful for colony #1, and colony PCR of pdCas9-w-Z0-Z35, self-ligation for all colonies. Ladder: 1kb Generuler.</br><b>Fig.11b</b> - Gel of colony PCR of pdCas9-w-Z4-Z35, successful for all colonies. Ladder: 2-log DNA ladder.</br><b>Fig.11c</b> - Gel of colony PCR of pdCas9-w-Z0-Z35 (2nd attempt), successful for colonies #1 and #4, and colony PCR of pdCas9-w-X0-X4 (part 1), successful for colonies #2 and #4. Ladder: 2-log DNA ladder.</br><b>Fig.11d</b> - Gel of colony PCR of pdCas9-w-X0-X4 (part 2), maybe successful for colonies #8, #9 and #10 (gel unclear), and colony PCR of pdCas9-w-X0-X35, successful for colony #2. Ladder: 2-log DNA ladder.</br><b>Fig.11e</b> - Gel of colony PCR of pdCas9-w-X4-X35, successful for colony #1 (maybe others, gel unclear). Ladder: 2-log DNA ladder.</small></figcaption>
−
                <a href="https://static.igem.org/mediawiki/2015/e/e0/Lab_nb_ecoli_fig11c.jpg"><img src="https://static.igem.org/mediawiki/2015/e/e0/Lab_nb_ecoli_fig11c.jpg" alt="Figure 11c" style="width:100%"></a>
+
                </figure>
−
                <a href="https://static.igem.org/mediawiki/2015/archive/6/64/20150902094918%21Lab_nb_ecoli_fig11d.jpg.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/6/64/20150902094918%21Lab_nb_ecoli_fig11d.jpg" alt="Figure 11d" style="width:100%"></a>
+
              </div>
−
                <a href="https://static.igem.org/mediawiki/2015/a/ae/Lab_nb_ecoli_fig11e.jpg"><img src="https://static.igem.org/mediawiki/2015/a/ae/Lab_nb_ecoli_fig11e.jpg" alt="Figure 11e" style="width:80%"></a>
+
−
                <figcaption><b>Fig.11: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products</b></br><small><b>Fig.11a</b> - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.</br><b>Fig.11b</b> - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies</br><b>Fig.11c</b> - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others</br><b>Fig.11d</b> - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.</br><b>Fig.11e</b> - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.</small></figcaption>
+
−
              </figure>
+
 
             </div>
 
             </div>
 
           </div>
 
           </div>
−
          <h4>Part 2: pdCas9-w-sgRNA + sgRNA assembly</h4>
 
 
         </div>
 
         </div>
 
       </section>
 
       </section>
  
−
<!--CONSTRUCTION PWJ89ALT (OK)-->
+
<!--CONSTRUCTION PWJ89ALT-->
 
       <section id="pwj89alt" class="panel">
 
       <section id="pwj89alt" class="panel">
−
         <h1>Construction of pWJ89alt</h1>
+
         <h1>Construction of pWJ89alt</br><small>05.08.2015 - 13.08.2015</small></h1>
 
         <p>pWJ89alt contains GFP controlled by the promoter J23117alt, which can be activated by dCas9-w bound to sgRNA X4 and inhibited by dCas9-w bound to sgRNA X0 or X35.</p>
 
         <p>pWJ89alt contains GFP controlled by the promoter J23117alt, which can be activated by dCas9-w bound to sgRNA X4 and inhibited by dCas9-w bound to sgRNA X0 or X35.</p>
  
 
         <h2>Materials and method</h2>
 
         <h2>Materials and method</h2>
 
         <ul>
 
         <ul>
−
           <li>PCR pWJ89 wihtout its J23117 promoter. pWJ89 was a gift from David Bikard.
+
           <li><b>Phusion and Q5 PCR (cf. Protocols) pWJ89 without its J23117 promoter</b> with primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89 + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols). pWJ89 was a gift from David Bikard.</li>
−
            <ul>
+
           <li><b>Phusion and Q5 PCR J23117alt promoter</b> with primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols). J23117alt was synthesized by IDT.</li>
−
              <li>Miniprep (cf. Protocols) liquid culture of bacteria containing pWJ89</li>
+
           <li><b>Gibson assembly of pWJ89alt</b> with purified PCR products pWJ89 (without J23117) and J23117alt promoter + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR products <b>+</b> sequencing (Microsynth)</li>
−
              <li>20 µL Phusion PCR and 25 µL Q5 PCR (cf. Protocols) of pWJ89 using primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89.</li>
+
−
              <li>Agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)</li>
+
−
              <li>PCR product purification (cf. Protocols)</li>
+
−
            </ul>
+
−
           </li>
+
−
          <li>PCR J23117alt promoter (synthsized by IDT)
+
−
            <ul>
+
−
              <li>20 µL Phusion PCR and 25 µL Q5 PCR (cf. Protocols) of J23117alt using primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT.</li>
+
−
              <li>Agarose gel electrophoresis of 2 µL PCR products (with 1kb Generuler)</li>
+
−
              <li>PCR product purification (cf. Protocols)</li>
+
−
            </ul>
+
−
           </li>
+
−
          <li>Gibson assembly of pWJ89alt
+
−
            <ul>
+
−
              <li>Gibson assembly (cf. Protocols) with purified PCR products pWJ89 (without J23117) and J23117alt promoter</li>
+
−
              <li>Transformation (cf. Protocols) of ultra-competent DH5a cells (NEB) with Gibson assembly product, spreading on  Kanamycin plates</li>
+
−
              <li>Colony PCR (cf. Protocols) of colonies from plate used for culture of transformed cells with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR prodcuts (with 1kb Generuler)</li>
+
−
              <li>Miniprep (cf. Protocols) of overnight liquid cultures in 5 mL LB with Kanamycin and sequencing (Microsynth) of one colony for which Gibson assembly worked according to colony PCR</li>
+
−
            </ul>
+
−
          </li>
+
−
          <li>BioBrick J23117alt promoter</li>
+
 
         </ul>
 
         </ul>
  
 
         <h2>Results</h2>
 
         <h2>Results</h2>
−
       
+
 
 
         <div id="pcrpwj89" class="panel">
 
         <div id="pcrpwj89" class="panel">
−
           <h3>PCR pWJ89</h3>
+
           <h3>PCR pWJ89</br><small>05.08.2015</small></h3>
 
           <div class="row">
 
           <div class="row">
−
             <div class="col-md-6">
+
             <div class="col-md-7">
−
               <p>Successful PCR reactions are expected to yield 4400 bp amplicons.</br>Both negative control lanes (cf. Fig.13) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.13). We will work with this sample for next steps.</p>
+
               <p>Successful PCR reactions are expected to yield 4400 bp amplicons.</br>Both negative control lanes (cf. Fig.12) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.12). We will work with this sample for next steps.</p>
 
             </div>
 
             </div>
−
             <div class="col-md-6">
+
             <div class="col-md-5">
 
               <figure>
 
               <figure>
−
                 <a href="https://static.igem.org/mediawiki/2015/7/71/Lab_nb_ecoli_fig13.jpg"><img src="https://static.igem.org/mediawiki/2015/7/71/Lab_nb_ecoli_fig13.jpg" alt="Figure 13" style="width:40%"></a>
+
                 <a href="https://static.igem.org/mediawiki/2015/7/75/Lab_nb_ecoli_fig12.jpg"><img src="https://static.igem.org/mediawiki/2015/7/75/Lab_nb_ecoli_fig12.jpg" alt="Figure 12" style="height:130px"></a>
−
                 <figcaption><b>Fig.13</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control</figcaption>
+
                 <figcaption><b>Fig.12</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control.</br><small>Ladder: 1kb Generuler.</small></figcaption>
 
               </figure>
 
               </figure>
 
             </div>
 
             </div>
Line 365: Line 377:
  
 
         <div id="pcrj23117alt" class="panel">
 
         <div id="pcrj23117alt" class="panel">
−
           <h3>PCR J23117alt promoter</h3>
+
           <h3>PCR J23117alt promoter</br><small>05.08.2015</small></h3>
 
           <div class="row">
 
           <div class="row">
−
             <div class="col-md-6">
+
             <div class="col-md-7">
−
               <p>Successful PCR reactions are expected to yield 340 bp amplicons.</br>Both negative control lanes (cf. Fig.14) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.</p>
+
               <p>Successful PCR reactions are expected to yield 340 bp amplicons.</br>Both negative control lanes (cf. Fig.13) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.</p>
 
             </div>
 
             </div>
−
             <div class="col-md-6">
+
             <div class="col-md-5">
 
               <figure>
 
               <figure>
−
                 <a href="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg"><img src="https://static.igem.org/mediawiki/2015/1/19/Lab_nb_ecoli_fig14.jpg" alt="Figure 13" style="width:30%"></a>
+
                 <a href="https://static.igem.org/mediawiki/2015/archive/7/71/20150915133041%21Lab_nb_ecoli_fig13.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/7/71/20150915133041%21Lab_nb_ecoli_fig13.jpg" alt="Figure 13" style="height:130px"></a>
−
                 <figcaption><b>Fig.14</b> - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control</figcaption>
+
                 <figcaption><b>Fig.13</b> - Gel of J23117alt promoter amplified by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control. </br><small>Ladder: 1kb Generuler.</small></figcaption>
 
               </figure>
 
               </figure>
 
             </div>
 
             </div>
Line 380: Line 392:
  
 
         <div id="gibsonpwj89alt" class="panel">
 
         <div id="gibsonpwj89alt" class="panel">
−
           <h3>Gibson assembly of pWJ89alt</h3>
+
           <h3>Gibson assembly of pWJ89alt</br><small>Gibson assembly, transformation: 10.08.2015, Colony PCR: 11.08.2015</small></h3>
 
           <p>Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.</br>Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).</p>
 
           <p>Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.</br>Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).</p>
 
         </div>
 
         </div>
 +
      </section>
  
−
         <div id="bbj23117alt" class="panel">
+
<!--CONSTRUCTION PARAC-SGRNA-->
−
           <h3>BioBrick J23117alt promoter</h3>
+
      <section id="arac" class="panel">
 +
        <h1>Construction of pAraC-sgRNA</br><small>25.08.2015 - 03.09.2015</small></h1>
 +
        <p>We made 3 pAraC-sgRNA constructs: pAraC-Z0 and pAraC-Z4 contain sgRNA Z0 or Z4 producing cassettes controlled by promoter pBAD-AraC (positively regulated by arabinose) and pAraC-Z0-Z4 contains sgRNA Z0 producing cassette controlled by promoter pBAD-AraC and sgRNA Z4 producing cassette controlled by promoter pBAD (constitutively active).</p>
 +
 
 +
        <h2>Materials and method</h2>
 +
        <ul>
 +
          <li><b>Linearize pAraC by Q5 PCR</b> (cf. Protocols) with primers f_opn_pAraC and r_opn_pAraC + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols). pAraC, called pFIP on Addgene, was a gift from Jay Keasling (Addgene plasmid #17565) [3].</li>
 +
          <li><b>Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR</b> (cf. Protocols) with primers as indicated in table below  + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)</li>
 +
          <li><b>Gibson assembly of pAraC-sgRNA constructs</b> with purified PCR products pAraC and sgRNA + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Sqc2_CoP_pAraCsgRNAs_sg1 and r_CoP_pAraCsgRNAs primers + agarose gel electrophoresis of 2 µL PCR products <b>+</b> sequencing (Microsynth)</li>
 +
        </ul>
 +
        <table>
 +
          <tr>
 +
            <th>Construct</th>
 +
            <th>sgRNA cassette(s)</th>
 +
            <th>Forward primer(s) / Reverse primer(s)
 +
          </tr>
 +
          <tr>
 +
            <td>pAraC-Z0</td>
 +
            <td>Z0</td>
 +
            <td>f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAinpAraC</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pAraC-Z4</td>
 +
            <td>Z4</td>
 +
            <td>f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAinpAraC</td>
 +
          </tr>
 +
          <tr>
 +
            <td>pAraC-Z0-Z4</td>
 +
            <td>Z0</br>Z4</td>
 +
            <td>f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAwoAra</br>f_Gbs_sgRNAwoAra_VS / r_Gbs_sgRNAinpAraC</td>
 +
          </tr>
 +
        </table>
 +
 
 +
        <h2>Results</h2>
 +
         <div id="pcrparac" class="panel">
 +
           <h3>PCR pAraC and sgRNA</br><small>25.08.2015, 26.08.2015</small></h3>
 +
          <div class="row">
 +
            <div class="col-md-7">
 +
              <p>Successfully amplified PCR products should be 5612 bp for pAraC and 370 bp for the sgRNAs.</br> pAraC was successfully amplified and we will use sample #1 for the next steps (cf. Fig.14b). sgRNAs Z0 and Z4 were successfully amplified with different sets of primers, as indicated in table above (cf. Fig.14a).</p>
 +
            </div>
 +
            <div class="col-md-5">
 +
              <figure>
 +
                <a href="https://static.igem.org/mediawiki/2015/0/03/Lab_nb_ecoli_fig14a.jpg"><img src="https://static.igem.org/mediawiki/2015/0/03/Lab_nb_ecoli_fig14a.jpg" alt="Figure 14a" style="height:110px"></a>
 +
                <a href="https://static.igem.org/mediawiki/2015/c/ce/Lab_nb_ecoli_fig14b.jpg"><img src="https://static.igem.org/mediawiki/2015/c/ce/Lab_nb_ecoli_fig14b.jpg" alt="Figure 14b" style="height:110px"></a>
 +
                <figcaption><b>Fig.14</b> - Gels of pArac and sgRNA PCR products</br><small><b>Fig.14a</b> (same as Fig.10b) - Gel of PCR products pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 and Z4 (1) for pAraC-Z0 and pAraC-Z4 (lanes 3-4), sgRNA Z0 and Z4 (2) for pAraC-Z0-Z4 (lanes 5-6), successfully amplified. (Lanes 7-8 are for the construction of pdCas9-w-sgRNA, see above.)</br><b>Fig.14b</b> - Gel of pAraC PCR product, both successfully amplified but sample #1 is clearer.</br>Ladder: 1kb Generuler.</small></figcaption>
 +
              </figure>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <div id="gibsonparac" class="panel">
 +
          <h3>Assemble pAraC-sgRNA constructs</br><small>Gibson assembly and transformation: 28.08.2015, 01.09.2015, Colony PCR: 31.08.2015, 02.09.2015</small></h3>
 +
          <p>Colony PCR (pictures of gels are were not very conclusive) and sequencing confirmed Gibson assembly was successful for one colony for each construct.</p>
 
         </div>
 
         </div>
 
       </section>
 
       </section>
Line 392: Line 456:
 
<!--CONSTRUCTION PWJ89ALT-Z4-TO-X4-->
 
<!--CONSTRUCTION PWJ89ALT-Z4-TO-X4-->
 
       <section id="plink" class="panel">
 
       <section id="plink" class="panel">
−
         <h1>Construction of pWJ89alt_Z4-to-X4</h1>
+
         <h1>Construction of pWJ89alt_Z4-to-X4</br><small>18.08.2015 - 02.09.2015</small></h1>
 
         <p>pWJ89alt_Z4-to-X4 contains a cassette producing sgRNA X4 (activator for J23117alt) controlled by the promoter J23117 and GFP under the J23117alt promoter (corresponds to pWJ89alt).</p>
 
         <p>pWJ89alt_Z4-to-X4 contains a cassette producing sgRNA X4 (activator for J23117alt) controlled by the promoter J23117 and GFP under the J23117alt promoter (corresponds to pWJ89alt).</p>
  
 
         <h2>Materials and method</h2>
 
         <h2>Materials and method</h2>
 
         <ul>
 
         <ul>
−
           <li>Open pWJ89alt by restriction digest + Agarose gel electrophoresis of 2 µL of digested product (with 1kb Generuler)</li>
+
           <li><b>Open pWJ89alt by restriction digest with AfeI</b> + Agarose gel electrophoresis of 2 µL of digested product + Gel extraction (cf. Protocols)</li>
−
           <li>
+
           <li><b>Amplify Z4-to-X4 by Q5 PCR</b> (cf. Protocols) with primers f_Gb_pWJ89alt and r_Gb_pWJ89alt + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)</li>
−
            
+
           <li><b>Gibson assembly of pWJ89alt_Z4-to-X4</b> with linearized pWJ89alt and purified PCR product of Z4-to-X4 + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Cl_pWJ89 and r_Sqc_T2reporter + agarose gel electrophoresis of 2 µL PCR products <b>+</b> sequencing (Microsynth)</li>
−
 
+
        </ul>
  
−
 
+
         <h2>Results</h2>
−
         It was constructed from pWJ89alt (as described above) and Z4-to-X4, the cassette producing sgRNA X4 controlled by the promoter J23117</p>
+
−
        <p>pWJ89alt was linearized by restriction digest by AfeI, Z4-to-X4 was amplified by PCR and both were assembled by Gibson assembly.</p>
+
  
 
         <div id="openpwj89alt" class="panel">
 
         <div id="openpwj89alt" class="panel">
−
           <h2>Open pWJ89alt by restriction digest</h2>
+
           <h3>Open pWJ89alt by restriction digest</br><small>18.08.2015</small></h3>
−
           <p>Coming soon</p>
+
           <div class="row">
 +
            <div class="col-md-7">
 +
              <p>Undigested pWJ89alt is expected to migrate faster than digested pWJ89alt. We observe both bands at the same height (cf. Fig.15). As there is a smear for the digested sample, it may have been partially digested.</p>
 +
            </div>
 +
            <div class="col-md-5">
 +
              <figure>
 +
                <a href="https://static.igem.org/mediawiki/2015/archive/6/6a/20150915133644%21Lab_nb_ecoli_fig15.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/6/6a/20150915133644%21Lab_nb_ecoli_fig15.jpg" alt="Figure 15" style="height:110px"></a>
 +
                <figcaption><b>Fig.15</b> - Gel of pWJ89alt digested by AfeI (lane 1) and undigested (lane 2).</br><small>Ladder: 1kb Generuler.</small></figcaption>
 +
              </figure>
 +
            </div>
 +
          </div>
 
         </div>
 
         </div>
  
 
         <div id="pcrz4-to-x4" class="panel">
 
         <div id="pcrz4-to-x4" class="panel">
−
           <h2>PCR Z4-to-X4</h2>
+
           <h3>PCR Z4-to-X4</br><small>19.08.2015</small></h3>
−
           <p>Coming soon</p>
+
           <div class="row">
 +
            <div class="col-md-7">
 +
              <p>Amplicons should be 425 bp.</br> We did 4 samples with slightly different thermocycling settings. All were successfully amplified (cf. Fig.16) and we kept sample in lane 1 for next steps.</p>
 +
            </div>
 +
            <div class="col-md-5">
 +
              <figure>
 +
                <a href="https://static.igem.org/mediawiki/2015/3/33/Lab_nb_ecoli_fig16.jpg"><img src="https://static.igem.org/mediawiki/2015/3/33/Lab_nb_ecoli_fig16.jpg" alt="Figure 16" style="height:110px"></a>
 +
                <figcaption><b>Fig.16</b> - Gel of Z4-to-X4 PCR products. Different samples had different thermocycling settings. PCR was successful for all samples.</br><small>Ladder: 1kb Generuler.</small></figcaption>
 +
              </figure>
 +
            </div>
 +
          </div>
 
         </div>
 
         </div>
  
 
         <div id="#gibsonplink" class="panel">
 
         <div id="#gibsonplink" class="panel">
−
           <h2>Gibson assembly pWJ89alt_Z4-to-X4</h2>
+
           <h3>Gibson assembly pWJ89alt_Z4-to-X4</br><small>Gibson assembly and transformation: 28.08.2015, Colony PCR: 31.08.2015</small></h3>
−
           <p>Coming soon</p>
+
           <div class="row">
 +
            <div class="col-md-7">
 +
              <p>Colony PCR primers were placed such as colonies for which the Gibson assembly worked would yield 2000 bp amplicons and those for which the Gibson assembly did not work (self-ligation) would yield 1500 bp amplicons.</p>
 +
              <p>The gel of the colony PCR shows that Gibson assembly worked for 3 of the tested colonies (cf. Fig.17). However, the other lanes do not show self-ligation, it seems like PCR did not work. We did not investigate this further.</br>Sequencing of pWJ89alt_Z4-to-X4 from one of the 3 colonies confirmed that Gibson assembly did work and did not reveal any mutations.</p>
 +
            </div>
 +
            <div class="col-md-5">
 +
              <figure>
 +
                <a href="https://static.igem.org/mediawiki/2015/archive/f/f9/20150915162445%21Lab_nb_ecoli_fig17.jpg"><img src="https://static.igem.org/mediawiki/2015/archive/f/f9/20150915162445%21Lab_nb_ecoli_fig17.jpg" alt="Figure 17" style="height:140px"></a>
 +
                <figcaption><b>Fig.17</b> - Gel of colony PCR products of pWJ89alt_Z4-to-X4. Colony PCR shows Gibson worked for colonies tested in lanes 3, 5 and 6. <small>Ladder: 2-log DNA ladder</small></figcaption>
 +
              </figure>
 +
            </div>
 +
          </div>
 
         </div>
 
         </div>
 
       </section>
 
       </section>
−
 
−
 
−
<!--CONSTRUCTION PWJ89_MCHERRY-->
 
−
      <section id="double_reporter" class="panel">
 
−
        <h1>Construction of pWJ89_mCherry</h1>
 
−
        <p>Coming soon</p>
 
−
 
−
        <div id="openpwj89" class="panel">
 
−
          <h2>Open pWJ89 by restriction digest</h2>
 
−
          <p>Coming soon</p>
 
−
        </div>
 
−
 
−
        <div id="pcrpwj89alt" class="panel">
 
−
          <h2>PCR pWJ89alt</h2>
 
−
          <p>Coming soon</p>
 
−
        </div>
 
−
 
−
        <div id="cutmcherry" class="panel">
 
−
          <h2>Extract mCherry by restriction digest</h2>
 
−
          <p>Coming soon</p>
 
−
        </div>
 
−
 
−
        <div id="pcrmcherry" class="panel">
 
−
          <h2>PCR mCherry</h2>
 
−
          <p>Coming soon</p>
 
−
        </div>
 
−
 
−
        <div id="gibsonpwj89_mcherry" class="panel">
 
−
          <h2>Gibson assembly of pWJ89_mCherry</h2>
 
−
          <p>Coming soon</p>
 
−
        </div>
 
−
      </section>
 
−
 
  
 
<!--ACTIVITY ASSAY-->
 
<!--ACTIVITY ASSAY-->
 
     <section id="activityassay" class="panel">
 
     <section id="activityassay" class="panel">
 
       <h1>Transistor activity assay</h1>
 
       <h1>Transistor activity assay</h1>
−
       <p>Coming soon</p>
+
       <p>To do activity assays, we transformed (cf. Transformation Protocol) JEN202 cells with different constructs and measured the fluorescence with a plate reader or by flow cytometry. Results can be found on our <a href="https://2015.igem.org/Team:EPF_Lausanne/Results">Results</a> page. A more detailed protocol can be found in this <a href= "https://docs.google.com/spreadsheets/d/143C4c2Au-__z6s9XR80Y6LGBv4h3EFTPyevmLi3bjhs/edit#gid=1765145613"> sheet </a> </p>
 
     </section>
 
     </section>
  
Line 470: Line 530:
 
           <th>Sequence</th>
 
           <th>Sequence</th>
 
           <th>Associated part</th>
 
           <th>Associated part</th>
 +
        </tr>
 +
        <tr>
 +
          <td>f_Cl_pWJ89</td>
 +
          <td>gtgagcggataacaatttcacac</td>
 +
          <td>pWJ89/pWJ89alt</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_ColPCR_sgRNAs</td>
 +
          <td>GGAAGCCGCTGAATTACAAGCCG</td>
 +
          <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_G_J23117Alt1IDT</td>
 +
          <td>acatcctgtccgtccGGCGTATCACGAGGCCCT</td>
 +
          <td>J23117alt</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_Gb_pWJ89alt</td>
 +
          <td>caggtttgccggctgaaagcAAGCAGAGGAGCAAAAGC</td>
 +
          <td>pWJ89alt</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
Line 477: Line 557:
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
−
           <td>f_Gbs_sgRNA-CtoA</td>
+
           <td>f_Gbs_sgRNA-A</td>
−
           <td>GTCGGCGATGGTGGTAGCTAATTATGTTCCctcgctcactgactcgctac</td>
+
           <td>ctcgctcactgactcgctac</td>
 
           <td>sgRNA cassettes</td>
 
           <td>sgRNA cassettes</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
−
           <td>f_Gbs_sgRNA-DtoA</td>
+
           <td>f_Gbs_sgRNAinpAraC</td>
−
           <td>CTAGACCTAACTGAGATACTGTCATAGACGctcgctcactgactcgctac</td>
+
           <td>acaaagcgggaccaaagccatga</td>
−
           <td>sgRNA cassettes</td>
+
           <td>pdCas9-w-sgRNA</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
−
           <td>f_Gbs_sgRNA-A</td>
+
           <td>f_Gbs_sgRNAinPd</td>
−
           <td>ctcgctcactgactcgctac</td>
+
           <td>atttatctcttcaaatgtagcacctgaagtctcgctcactgactcgct</td>
−
           <td>sgRNA cassettes</td>
+
           <td>pdCas9-w-sgRNA</td>
 
         </tr>
 
         </tr>
 +
        <tr>
 +
          <td>f_Gbs_sgRNAwoAra</td>
 +
          <td>TTATAACATATCGTTCCATGAAGGCCAGAAgcgggaccaaagccatga</td>
 +
          <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 
           <td>f_Gbs_w</td>
 
           <td>f_Gbs_w</td>
 
           <td>ACACGCATTGATTTGAGTCA</td>
 
           <td>ACACGCATTGATTTGAGTCA</td>
Line 499: Line 585:
 
           <td>TGACTTTTCGcATTCCTTATTATGTTG</td>
 
           <td>TGACTTTTCGcATTCCTTATTATGTTG</td>
 
           <td>pdCas9-w</td>
 
           <td>pdCas9-w</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_opn_d9w</td>
 +
          <td>cagccccatacgatataagt</td>
 +
          <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_opn_pAraC</td>
 +
          <td>tcactatagggcgaattggag</td>
 +
          <td>pAraC</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_Sq_CoP_pdCas92ndIns</td>
 +
          <td>cctccaagccagttacctcg</td>
 +
          <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_Sqc2_CoP_pAraCsgRNAs_sg1</td>
 +
          <td>aacctttcattcccagcggt</td>
 +
          <td>pAraC-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>f_Rmv_J23117_of_pWJ89</td>
 +
          <td>GGATTGTGCTAGCgAATTCCT</td>
 +
          <td>pWJ89</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_G_J23117Alt1IDT</td>
 +
          <td>ttcgctagcacaatccGCTAGCACAATCCCGATATCTC</td>
 +
          <td>J23117alt</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_ColPCR_sgRNAs</td>
 +
          <td>cgcctggtatctttatagtcctgtcggg</td>
 +
          <td>pdCas9-w-sgRNA</td>
 +
        <tr>
 +
          <td>r_CoP_pAraCsgRNAs</td>
 +
          <td>ggaataagggcgacacgg</td>
 +
          <td>pAraC-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_G_J23117Alt1IDT</td>
 +
          <td>ttcgctagcacaatccGCTAGCACAATCCCGATATCTC</td>
 +
          <td>J23117alt</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_Gb_pWJ89alt</td>
 +
          <td>gcaattctggaagaaatagcAAAAAAAGCACCGACTCG</td>
 +
          <td>pWJ89alt</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
Line 511: Line 646:
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
−
           <td>r_Gbs_sgRNA-BtoC</td>
+
           <td>r_Gbs_sgRNAinpAraC</td>
−
           <td>GGAACATAATTAGCTACCACCATCGCCGACtggcatcttccaggaaatc</td>
+
           <td>cggccccagctccaattcgccctatagtgactggcatcttccaggaaatctcc</td>
−
           <td>sgRNA cassettes</td>
+
           <td>pdCas9-w-sgRNA</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
−
           <td>r_Gbs_sgRNA-BtoD</td>
+
           <td>r_Gbs_sgRNAinPd</td>
−
           <td>CGTCTATGACAGTATCTCAGTTAGGTCTAGtggcatcttccaggaaatc</td>
+
          <td>actagtaacaacttatatcgtatggggctgccgttcgtaagccatttccg</td>
−
           <td>sgRNA cassettes/td>
+
          <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
           <td>r_Gbs_sgRNAwoAra</td>
 +
           <td>TTCTGGCCTTCATGGAACGATATGTTATAAtggcatcttccaggaaatctcc</td>
 +
          <td>pdCas9-w-sgRNA</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
Line 529: Line 669:
 
           <td>AGATTTTTTCAATCTTCTCACG</td>
 
           <td>AGATTTTTTCAATCTTCTCACG</td>
 
           <td>pdCas9-w</td>
 
           <td>pdCas9-w</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_opn_d9w</td>
 +
          <td>acttcaggtgctacatttga</td>
 +
          <td>pdCas9w-w-sgRNAS</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_opn_pAraC</td>
 +
          <td>gtttttgtcatggctttggtcc</td>
 +
          <td>pAraC</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_Rmv_J23117_of_pWJ89</td>
 +
          <td>ggacggacaggatgtatgct</td>
 +
          <td>pWJ89</td>
 
         </tr>
 
         </tr>
 
         <tr>
 
         <tr>
Line 534: Line 689:
 
           <td>ctgatttgagcgtcagat</td>
 
           <td>ctgatttgagcgtcagat</td>
 
           <td>pdCas9-w-sgRNA</td>
 
           <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_Sq_CoP_pAraC2ndInsert</td>
 +
          <td>gtactgcgatgagtggcagg</td>
 +
          <td>pdCas9-w-sgRNA</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_Sq_J23117alt</td>
 +
          <td>ATATGATCTGGGTATCTCGCAAAG</td>
 +
          <td>pWJ89/pWJ89alt</td>
 +
        </tr>
 +
        <tr>
 +
          <td>r_Sqc_T2reporter</td>
 +
          <td>gaaacaggcgatgctgctta</td>
 +
          <td>pWJ89alt</td>
 
         </tr>
 
         </tr>
 
       </table>
 
       </table>
 +
    </section>
 +
 +
    <section id="ref" class="panel">
 +
      <h1>References</h1>
 +
      <p>[1] Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022. 10.1016/j.cell.2013.02.022 PubMed 23452860</br>[2] Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Bikard D, Jiang W, Samai P, Hochschild A, Zhang F, Marraffini LA. Nucleic Acids Res. 2013 Jun 12. 10.1093/nar/gkt520 PubMed 23761437</br>[3] A tightly regulated inducible expression system utilizing the fim inversion recombination switch. Ham TS, Lee SK, Keasling JD, Arkin AP. Biotechnol Bioeng. 2006 May 5. 94(1):1-4. 10.1002/bit.20916 PubMed 16534780</p>
 
     </section>
 
     </section>
  
Line 545: Line 720:
 
$('#nav').affix({
 
$('#nav').affix({
 
     offset: {
 
     offset: {
−
         top: $('#nav').offset().top
+
         top: 100,
−
    }
+
         bottom: 600
−
});
+
      }
−
$('#nav').affix({
+
−
    offset: {
+
−
         bottom: ($('#DNA-banner').outerHeight(true) +
+
−
                $('#sponsors').outerHeight(true) +
+
−
                $('#footer').outerHeight(true))
+
−
    }
+
 
});
 
});
 
</script>
 
</script>
 
</body>
 
</body>
 
</html>
 
</html>
−
{{:Team:EPF_Lausanne/Test/footer}}
+
{{:Team:EPF_Lausanne/Footer}}

Latest revision as of 03:56, 19 September 2015

EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits

E. Coli Laboratory Notebook

Note that all experiments were done by EPFL iGEM team members.

Construction of pdCas9-w
07.05.2015 - 01.06.2015 + 28.07.2015 - 05.08.2015

pdCas9-w contains a gene that produces dCas9 fused to the w subunit of RNA polymerase (RNAP), which recruits RNAP, controlled by a Tetracycline inducible promoter.

Materials and method

  • Open pdCas9-bacteria by Phusion PCR (cf. Protocols) with primers f_Gbs_pdCas9 and r_Gbs_pdCas9 + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products. pdCas9-bacteria was a gift from Stanley Qi (Addgene plasmid # 44249) [1].
  • Extract w subunit from pWJ66 by Phusion PCR (cf. Protocols) with primers f_Gbs_w and r_Gbs_w + PCR product purification (cf. Protocols) + agarose gel electrophoresis of 2 µL purified PCR products. pWJ66 was a gift from Luciano Marraffini (Addgene plasmid # 46570) [2].
  • Gibson assembly (cf. Protocols) of pdCas9-w with purified PCR products of pdCas9-bacteria and w subunit + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Gbs_w and r_Scq_pdCas9_w_sgRNA primers + agarose gel electrophoresis of 2 µL PCR products + restriction digest (cf. Protocols) of pdCas9-w (isolated by Miniprep (cf. Protocols) with BamHI and KpnI separately + agarose gel electrophoresis of 2 µL digested products + sequencing (Microsynth)
  • Site-directed mutagenesis (cf. Protocols) of dCas9-w with primers f_Mt_A2080C_pdCas9-w and r_Mt_A2080C_pdCas9-w (necessary for pdCas9-w to be BioBrick compatible). Control with restriction digest (cf. Protocols) of mutated pdCas9-w-mut (isolated by Miniprep (cf. Protocols)) with EcoRI + sequencing (Microsynth)

Results

Open pdCas9 by PCR
07.05.2015, 10.05.2015

Linearized pdCas9-w is expected to be 6705 bp.
We tested many parameters: HF vs. GC buffer, different annealing temperatures and different extension times. All samples visible on gel were successfully amplified (cf. Fig.1).
For next steps, sample from lane 1 (cf. Fig.1) was used.

Figure 1
Fig.1 - Gel of pdCas9 linearized by PCR, successful for all 5 samples.
Ladder: 1kb Generuler.

Extract w subunit from pWJ66 by PCR
07.05.2015

Successful PCR reactions are expected to yield 340 bp fragments.
PCR was successful for sample visible on gel. (cf. Fig.2)

Figure 2
Fig.2 - Gel of w subunit extracted from pWJ66 by PCR, successful for sample in lane 1.
Ladder: 1kb Generuler.

Gibson assembly of pdCas9-w
Gibson assembly, transformation: 19.05.2015. Colony PCR: 29.05.2015. Restriction analysis: 01.06.2015.

Colony PCR yields 666 bp amplicons if Gibson assembly worked and 396 bp amplicons if the plasmid self-ligated.
Lane "C" is a negative control: PCR was run with all components except template DNA. It is empty which means there is no contamination (cf. Fig3d).
Colony PCR shows that Gibson assembly worked for some samples (cf. Fig.3). To avoid working with too many samples, we kept the ones from lanes 16, 22, 25, 31, 37 and 43 for the next steps.

pdCas9-w was analyzed by restriction digest with BamHI and KpnI separately, both are single cutters in pdCas9 and double cutters in pdCas9-w. Digestion by BamHI yields fragments of 6147 bp and 834 bp, digestion by KpnI yields fragments of 4534 bp and 2447 bp (cf. Fig.4).
Too much ladder was loaded so it is difficult to estimate the size of the fragments. The smaller fragments are also very difficult to see. By looking at the relative heights, we can see that all colonies seem to have the w subunit insert. There is only the undigested sample for colony 16 that is not visible, probably due to an error while loading the gel.

Sequencing confirmed that sample 22 is in fact pdCas9-w. We used this sample for the next steps and stored it as a glycerol stock (c.f. Protocols).

Figure 3a Figure 3b Figure 3c Figure 3d
Fig.3 - Gels of colony PCR of dCas9-w Gibson assembly products. Gibson assembly worked for samples that have 666 bp amplicons: lanes 5, 6, 16, 22, 25-28, 30, 31, 37, 41, 43. All other lanes are self-ligation (396 bp amplicons).
Ladder: 1kb Generuler.
Figure 4a Figure 4b Figure 4c
Fig.4 - Gels of restriction digest of pdCas9-w Gibson assembly products. Each colony is present on gels in triplicates: undigested (7kb but migrates faster than linear DNA), digested by BamHI (6147 bp + 834 bp) and digested by KpnI (4534 bp + 2447 bp). All digestions worked and show that plasmids contain the w subunit. Undigested plasmid for sample 16 is not visible due to a technical error.
Ladder: 1kb Generuler.

Site-directed mutagenesis of dCas9-w
Site-directed mutagenesis: 28.07.2015, 29.07.2015. Restriction digest: 05.08.2015

The first restriction digest analysis of many pdCas9-w-mut colonies was inconclusive, so we chose one colony to do a second restriction digest analysis (cf. Fig.5). First, note that the ladder did not work well so we will ignore it and only look at the relative heights and number of bands. Also, lanes 1, 4 and 6 concerned another experiment so we will ignore them.

pdCas9-w and pdCas9-w-mut undigested (cf. Fig.5 lanes 2 and 8) should both contain the 7 kb circular plasmid. pdCas9-w digested with BsrBI (cf. Fig.5 lane 7) and pdCas9-w-mut digested with EcoRI or BsrBI separately (cf. Fig.5 lanes 10 and 11) should contain the linearized 7 kb plasmid. pdCas9-w digeted with EcoRI (cf. Fig.5 lane 5) should contain two fragments of 5.6 kb and 1.4 kb. pdCas9-w digested with EcoRI and BsrBI (cf. Fig.5 lane 3) should contain three fragments of 3.2 kb, 2.4 kb and 1.4 kb, pdCas9-w-mut digested with the same enzymes (cf. Fig.5 lane 9) should contain two fragments of 4.6 kb and 2.4 kb.
We can see that the pattern on the gel is correct so the mutagenesis worked. Notice than the circular plasmids migrated less than the linear plasmids and also that the undigested plasmids seem to contain a second smaller fragment which is probably contamination.

Figure 5
Fig.5 - Gel of restriction digest of mutagenesis product (note that lanes 1, 4 and 6 can be ignored)
Lane 2: pdCas9-w undigested. Lane 3: pdCas9-w digested with BsrBI and EcoRI. Lane 5: pdCas9-w digested with EcoRI. Lane 7: pdCas9-w digested with BsrBI. Lane 8: pdCas9-w-mut undigested. Lane 9: pdCas9-w-mut digested by BsrBI and EcoRI. Lane 10: pdCas9-w-mut digested with EcoRI. Lane 11: pdCas9-w-mut digested with BsrBI.
Ladder: 1kb Generuler (did not work well)

Construction of pdCas9-w-sgRNAs - 08.07.2015 - 02.09.2015

pdCas9-w-sgRNAs contain a gene producing dCas9-w controlled by a Tetracycline inducible promoter and sgRNA producing cassette (constitutive promoter).

These experiments consist of inserting one or two sgRNA producing cassettes (cf. Fig.6) into pdCas9-w. In part 1, one sgRNA (X0, X4, X35, Z0, Z4 or Z35) was inserted into pdCas9-w by Gibson assembly. For technical reasons, we were unable to make most constructs with two inserted cassettes using this method. In part 2, we extracted sgRNA cassettes from existing constructs and inserted them in other constructs that already contained one other sgRNA cassette.

Figure 6
Fig.6 - Schematics of structure of sgRNA cassettes

Materials and method

Part 1: Assemble pdCas9-w + sgRNA

  • Open pdCas9-w by restriction digest (cf. Protocols) with BsrBI (blunt ends) + agarose gel electrophoresis of 2 µL of digested and undigested product
  • Amplify sgRNA cassettes by Phusion or Q5 PCR (cf. Protocols) with primers f_Gbs_sgRNA-A and r_Gbs_sgRNA-B + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols).
  • Gibson assembly pdCas9-w-sgRNA (cf. Protocols) with linearized pdCas9-w and purified sgRNA PCR products + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_ColPCR_sgRNAs and r_ColPCR_sgRNAs + agarose gel electrophoresis of 2 µL PCR products + sequencing (Microsynth)

Part 2: Assemble pdCas9-w-sgRNA + sgRNA

  • Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers f_Gbs_sgRNAinPd and r_Gbs_sgRNAinPd + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)
  • Open pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers f_opn_d9w and r_opn_d9w + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)
  • Gibson assembly of pdCas9-w-sgRNA, as indicated in table below + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Sq_CoP_pdCas92ndIns and r_Sq_CoP_pAraC2ndInsert + agarose gel electrophoresis of 2 µL PCR products + sequencing (Microsynth)
Final constructs sgRNA insert sgRNA in pdCas9-w-sgRNA (backbone)
pdCas9-w-Z0-Z4 Z4 pdCas9-w-Z0
pdCas9-w-Z0-Z35 Z35 pdCas9-w-Z0
pdCas9-w-Z4-Z35 Z35 pdCas9-w-Z4
pdCas9-w-X0-X4 X4 pdCas9-w-X0
pdCas9-w-X0-X35 X35 pdCas9-w-X0
pdCas9-w-X4-X35 X35 pdCas9-w-X4

Results

Part 1: Assemble pdCas9-w + sgRNA
08.07.2015 - 07.08.2015

Open pdCas9-w by restriction digest
16.07.2015, 19.07.2015, 26.07.2015, 02.08.2015 (repeats)

The digested and undigested plasmids have the same size. Circular fragments migrates differently (generally faster) than linear fragments of the same size. This means that the undigested and digested plasmid will migrate differently. Even though the ladder is not clear, we see that the digested sample migrated more slowly than the undigested sample (cf. Fig.7). The restriction digest was successful.
Digestion was repeated at least 4 times, we needed it for many PCRs.

Figure 7
Fig.7 - Gel of pdCas9-w digested by BamHI (lane 1) and undigested (lane 2). Digested plasmid is lower on gel, which means digestion worked.
Ladder: 1kb Generuler.

Amplify sgRNA cassettes by PCR
08.07.2015, 09.07.2015, 10.07.2015, 13.07.2015, 14.07.2015, 15.07.2015, 16.07.2015, 02.08.2015, 03.08.2015, 04.08.2015, 06.08.2015

Amplified sgRNA cassettes are expected to be about 370 bp.
sgRNA cassette Z0 was amplified with Q5 PCR, both samples were successfully amplified (cf. Fig.8a). sgRNA cassette Z4 was amplified with Phusion PCR, samples 3 and 4 were successfully amplified (cf. Fig.8b). sgRNA cassette Z35 was successfully amplified with Phusion PCR, it is hardly visible on the gel (cf. Fig.8c). sgRNA cassette X0 was successfully amplified with Phusion PCR (cf. Fig.8d). sgRNA cassette X4 was successfully amplified with Phusion PCR (cf. Fig.8e). sgRNA cassette X35 was successfully amplified with Phusion PCR (cf. Fig.8f).

Many PCRs were necessary to obtain all sgRNAs because of technical problems, such as PCR reactions not working and contamination of most of our tubes. Figures show only the samples that were used in the next steps.

Figure 8a Figure 8b Figure 8c Figure 8d Figure 8e Figure 8f
Fig.8: Gels of sgRNA cassettes amplified by PCR
Fig.8a - Gel of sgRNA cassette Z0 amplicon (lanes 1-2), successful for both samples
Fig.8b - Gel of sgRNA cassette Z4 amplicon, successful for samples in lanes 3 and 4
Fig.8c - Gel of sgRNA cassette Z35 amplicon, successful for sample in lane 1
Fig.8d - Gel of sgRNA cassette X0 amplicon, successful for sample
Fig.8e - Gel of sgRNA cassette X4 amplicon
Fig.8f - Gel of sgRNA cassette X35 amplicon, successful for sample
Ladder: 1kb Generuler.

Assemble pdCas9-w-sgRNA constructs
Gibson assembly, transformation: 16.07.2015, 17.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 04.08.2015, 05.08.2015
Colony PCR: 17.07.2015, 26.07.2015, 27.07.2015, 28.07.2015, 29.07.2015, 30.07.2015, 05.08.2015, 06.08.2015, 07.08.2015

In colony PCR, primers were placed such as amplicons are 445 bp if the plasmid self-ligated, 723 bp if Gibson assembly of 1 sgRNA cassette worked and 1120 bp if Gibson assembly of 2 sgRNA cassettes worked.

pdCas9-w-Z0 was obtained by a faulty assembly of pdCas9-w-Z0-Z4 that only took up 1 of the 2 sgRNA cassettes. Sample 20 of the colony PCR (cf. Fig.9a) was confirmed by sequencing to be pdCas9-w-Z0. Sample 13 seems to be pdCas9-w-Z0-Z4 according to colony PCR (cf. Fig.9a), but sequencing showed that it is pdCas9-w-X0-Z0, probably due to contamination of a tube. Colony PCR showed that all colonies tested for pdCas9-w-Z4 have the inserted sgRNA cassette (cf. Fig.9b). Sequencing confirmed that sample 5 is in fact pdCas9-w-Z4. Colony PCR showed that the Gibson assembly for sample 5 of pdCas9-w-Z35 seems to have worked (cf. Fig.9c) and sequencing confirmed that is the case. Colony PCR and sequencing showed that Gibson assembly was successful for sample 5 of pdCas9-w-X0 (cf. Fig.9d). Colony PCR of pdCas9-w-X4 showed many potentially good samples (cf. Fig.9e). Sequencing of sample 10 confirmed that it is in fact pdCas9-w-X4. Colony PCR and sequencing showed that Gibson assembly was successful for the colony of pdCas9-w-X35 (cf. Fig.9d).

Sequencing showed some mutations and/or deletions in the promoter and/or terminator for some of these samples. Because of time constraints, we decided to keep working with these and see the effect of the mutations during the activity assay.

Figure 9a Figure 9b Figure 9c Figure 9d Figure 9e
Fig.9: Gels of colony PCR of pdCas9-w-sgRNA Gibson assembly products
Fig.9a - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-10) and self-ligation control pdCas9-w (lane "C"). Lane 2 seems to be pdCas9-w-Z0-Z4 and lanes 5, 8 and 9 seem to only have 1 inserted sgRNA cassette, being either pdCas9-w-Z0 or pdCas9-w-Z4.
Fig.9b - Gel of colony PCR of pdCas9-w-Z4 (lanes 1-11). Gibson assembly seems to have worked for all colonies
Fig.9c - Gel of colony PCR of pdCas9-w-Z35 (lanes 1-8), seems to have worked for lane 5, self-ligation for all others
Fig.9d - Gel of colony PCR of pdCas9-w-X0 (lanes 1-5) and pdCas9-w-X35 (lane 6). Gibson assembly of pdCas9-w-X0 seems to have worked for lanes 2-5, but sample in lane 5 looks slightly better than the others. The faint band in lane 1 is self-ligation. Gibson assembly of pdCas9-w-X35 seems to have worked.
Fig.9e - Gel of colony PCR of pdCas9-w-X4 (lanes 1-11). All samples seems to have the sgRNA insert, even though the bands are not very precise.
Ladder: 1kb Generuler.

Part 2: Assemble pdCas9-w-sgRNA + sgRNA
24.08.2015 - 02.09.2015

Extract sgRNA from pdCas9-w-sgRNA and open pdCas9-w-sgRNA by Q5 PCR
24.08.2015, 25.08.2015, 28.08.2015, 31.08.2015

Amplified sgRNA cassettes (Z4, Z35, X4 and X35) are expected to be 400 bp. All were successfully amplified (cf. Fig.10a and Fig.10b).
Amplified pdCas9-w-sgRNA (Z0, Z4, X0 and X4) are expected to be about 7000 bp. All were successfully amplified (cf. Fig.10a and Fig.10b).

Figure 10a Figure 10b
Fig.10 - Gels of PCR products of pdCas9-w-sgRNA and sgRNA cassettes
Fig.10a - Gel of PCR products for the construction of pdCas9-w-sgRNA: pdCas9-w-Z0 (lane 1), pdCas9-w-Z4 (lane 2), sgRNA Z4 (lane 3), pdCas9-w-X0 (lane 4), pdCas9-w-X4 (lane 5) and sgRNA X4 (lane 6), all were successfully amplified.
Fig.10b - Gel of PCR products sgRNA Z35 (lane 7) and sgRNA X35 (lane 8), both successfully amplified. (Lanes 1-6 are for the construction of pAraC-sgRNA, see below.)
Ladder: 1kb Generuler.

Assemble pdCas9-w-sgRNA-sgRNA constructs
Gibson assembly, transformation: 26.08.2015, 31.08.2015. Colony PCR: 31.08.2015, 02.09.2015

Colony PCR primers are placed such as amplicons are 724 bp if Gibson assembly worked and are 390 bp if it did not (self-ligation).
All necessary constructs were successfully obtained. Following colonies were kept for our constructs: colony #1 for pdCas9-w-Z0-Z4 (cf. Fig.11a), colony #4 (2nd attempt) for pdCas9-w-Z0-Z35 (cf. Fig.11c), colony #6 for pdCas9-w-Z4-Z35 (cf. Fig.11b), colony #4 for pdCas9-w-X0-X4 (cf. Fig.11c), colony #2 for pdCas9-w-X0-X35 (cf. Fig.11d) and colony #1 for pdCas9-w-X4-X35 (cf. Fig.11e).

Figure 11a Figure 11b Figure 11c Figure 11d Figure 11e
Fig.11 - Gels of colony PCR of pdCas9-w-sgRNAs
Fig.11a - Gel of colony PCR of pdCas9-w-Z0-Z4 (lanes 1-2), successful for colony #1, and colony PCR of pdCas9-w-Z0-Z35, self-ligation for all colonies. Ladder: 1kb Generuler.
Fig.11b - Gel of colony PCR of pdCas9-w-Z4-Z35, successful for all colonies. Ladder: 2-log DNA ladder.
Fig.11c - Gel of colony PCR of pdCas9-w-Z0-Z35 (2nd attempt), successful for colonies #1 and #4, and colony PCR of pdCas9-w-X0-X4 (part 1), successful for colonies #2 and #4. Ladder: 2-log DNA ladder.
Fig.11d - Gel of colony PCR of pdCas9-w-X0-X4 (part 2), maybe successful for colonies #8, #9 and #10 (gel unclear), and colony PCR of pdCas9-w-X0-X35, successful for colony #2. Ladder: 2-log DNA ladder.
Fig.11e - Gel of colony PCR of pdCas9-w-X4-X35, successful for colony #1 (maybe others, gel unclear). Ladder: 2-log DNA ladder.

Construction of pWJ89alt
05.08.2015 - 13.08.2015

pWJ89alt contains GFP controlled by the promoter J23117alt, which can be activated by dCas9-w bound to sgRNA X4 and inhibited by dCas9-w bound to sgRNA X0 or X35.

Materials and method

  • Phusion and Q5 PCR (cf. Protocols) pWJ89 without its J23117 promoter with primers f_Rmv_J23117_of_pWJ89 and r_Rmv_J23117_of_pWJ89 + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols). pWJ89 was a gift from David Bikard.
  • Phusion and Q5 PCR J23117alt promoter with primers f_G_J23117Alt1IDT and r_G_J23117Alt1IDT + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols). J23117alt was synthesized by IDT.
  • Gibson assembly of pWJ89alt with purified PCR products pWJ89 (without J23117) and J23117alt promoter + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Cl_pWJ89 and r_Sq_J23117alt primers + agarose gel electrophoresis of 2 µL PCR products + sequencing (Microsynth)

Results

PCR pWJ89
05.08.2015

Successful PCR reactions are expected to yield 4400 bp amplicons.
Both negative control lanes (cf. Fig.12) are empty, which means there is no contamination. Phusion PCR did not work, but Q5 PCR did (cf. Fig.12). We will work with this sample for next steps.

Figure 12
Fig.12 - Gel of pWJ89 amplified without J23117 promoter by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control.
Ladder: 1kb Generuler.

PCR J23117alt promoter
05.08.2015

Successful PCR reactions are expected to yield 340 bp amplicons.
Both negative control lanes (cf. Fig.13) are empty, which means there is no contamination. Both Phusion and Q5 PCR worked (cf. Fig.13). We will work with the sample amplified by Q5 PCR.

Figure 13
Fig.13 - Gel of J23117alt promoter amplified by PCR. Lane 1: Phusion PCR, lane 2: Phusion PCR negative control, lane 3: Q5 PCR, lane 4: Q5 PCR negative control.
Ladder: 1kb Generuler.

Gibson assembly of pWJ89alt
Gibson assembly, transformation: 10.08.2015, Colony PCR: 11.08.2015

Colony PCR showed two colonies for which Gibson assembly worked. However, images of gels of colony PCR were lost for technical reasons.
Sequencing confirmed that both colonies were in fact pWJ89alt and that one had a deletion but the other one did not have any mutations. We kept the mutation-free colony and stored it in a Glycerol stock (cf. Protocols).

Construction of pAraC-sgRNA
25.08.2015 - 03.09.2015

We made 3 pAraC-sgRNA constructs: pAraC-Z0 and pAraC-Z4 contain sgRNA Z0 or Z4 producing cassettes controlled by promoter pBAD-AraC (positively regulated by arabinose) and pAraC-Z0-Z4 contains sgRNA Z0 producing cassette controlled by promoter pBAD-AraC and sgRNA Z4 producing cassette controlled by promoter pBAD (constitutively active).

Materials and method

  • Linearize pAraC by Q5 PCR (cf. Protocols) with primers f_opn_pAraC and r_opn_pAraC + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols). pAraC, called pFIP on Addgene, was a gift from Jay Keasling (Addgene plasmid #17565) [3].
  • Extract sgRNA from pdCas9-w-sgRNA by Q5 PCR (cf. Protocols) with primers as indicated in table below + agarose gel electrophoresis of 2 µL PCR products + PCR product purification (cf. Protocols)
  • Gibson assembly of pAraC-sgRNA constructs with purified PCR products pAraC and sgRNA + transformation (cf. Protocols) of ultra-competent DH5a cells (NEB). Control with colony PCR (cf. Protocols) with primers f_Sqc2_CoP_pAraCsgRNAs_sg1 and r_CoP_pAraCsgRNAs primers + agarose gel electrophoresis of 2 µL PCR products + sequencing (Microsynth)
Construct sgRNA cassette(s) Forward primer(s) / Reverse primer(s)
pAraC-Z0 Z0 f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAinpAraC
pAraC-Z4 Z4 f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAinpAraC
pAraC-Z0-Z4 Z0
Z4		 f_Gbs_sgRNAinpAraC / r_Gbs_sgRNAwoAra
f_Gbs_sgRNAwoAra_VS / r_Gbs_sgRNAinpAraC

Results

PCR pAraC and sgRNA
25.08.2015, 26.08.2015

Successfully amplified PCR products should be 5612 bp for pAraC and 370 bp for the sgRNAs.
pAraC was successfully amplified and we will use sample #1 for the next steps (cf. Fig.14b). sgRNAs Z0 and Z4 were successfully amplified with different sets of primers, as indicated in table above (cf. Fig.14a).

Figure 14a Figure 14b
Fig.14 - Gels of pArac and sgRNA PCR products
Fig.14a (same as Fig.10b) - Gel of PCR products pAraC (lanes 1-2), unsuccessfully amplified, and sgRNA Z0 and Z4 (1) for pAraC-Z0 and pAraC-Z4 (lanes 3-4), sgRNA Z0 and Z4 (2) for pAraC-Z0-Z4 (lanes 5-6), successfully amplified. (Lanes 7-8 are for the construction of pdCas9-w-sgRNA, see above.)
Fig.14b - Gel of pAraC PCR product, both successfully amplified but sample #1 is clearer.
Ladder: 1kb Generuler.

Assemble pAraC-sgRNA constructs
Gibson assembly and transformation: 28.08.2015, 01.09.2015, Colony PCR: 31.08.2015, 02.09.2015

Colony PCR (pictures of gels are were not very conclusive) and sequencing confirmed Gibson assembly was successful for one colony for each construct.

Transistor activity assay

To do activity assays, we transformed (cf. Transformation Protocol) JEN202 cells with different constructs and measured the fluorescence with a plate reader or by flow cytometry. Results can be found on our Results page. A more detailed protocol can be found in this sheet

Primer table

Name Sequence Associated part
f_Cl_pWJ89 gtgagcggataacaatttcacac pWJ89/pWJ89alt
f_ColPCR_sgRNAs GGAAGCCGCTGAATTACAAGCCG pdCas9-w-sgRNA
f_G_J23117Alt1IDT acatcctgtccgtccGGCGTATCACGAGGCCCT J23117alt
f_Gb_pWJ89alt caggtttgccggctgaaagcAAGCAGAGGAGCAAAAGC pWJ89alt
f_Gbs_pdCas9 CTCGAGTAAGGATCTCCAG pdCas9
f_Gbs_sgRNA-A ctcgctcactgactcgctac sgRNA cassettes
f_Gbs_sgRNAinpAraC acaaagcgggaccaaagccatga pdCas9-w-sgRNA
f_Gbs_sgRNAinPd atttatctcttcaaatgtagcacctgaagtctcgctcactgactcgct pdCas9-w-sgRNA
f_Gbs_sgRNAwoAra TTATAACATATCGTTCCATGAAGGCCAGAAgcgggaccaaagccatga pdCas9-w-sgRNA
f_Gbs_w ACACGCATTGATTTGAGTCA pWJ66
f_Mt_A2080C_pdCas9-w TGACTTTTCGcATTCCTTATTATGTTG pdCas9-w
f_opn_d9w cagccccatacgatataagt pdCas9-w-sgRNA
f_opn_pAraC tcactatagggcgaattggag pAraC
f_Sq_CoP_pdCas92ndIns cctccaagccagttacctcg pdCas9-w-sgRNA
f_Sqc2_CoP_pAraCsgRNAs_sg1 aacctttcattcccagcggt pAraC-sgRNA
f_Rmv_J23117_of_pWJ89 GGATTGTGCTAGCgAATTCCT pWJ89
r_G_J23117Alt1IDT ttcgctagcacaatccGCTAGCACAATCCCGATATCTC J23117alt
r_ColPCR_sgRNAs cgcctggtatctttatagtcctgtcggg pdCas9-w-sgRNA
r_CoP_pAraCsgRNAs ggaataagggcgacacgg pAraC-sgRNA
r_G_J23117Alt1IDT ttcgctagcacaatccGCTAGCACAATCCCGATATCTC J23117alt
r_Gb_pWJ89alt gcaattctggaagaaatagcAAAAAAAGCACCGACTCG pWJ89alt
r_Gbs_pdCas9 GTCACCTCCTAGCTGACTC pdCas9
r_Gbs_sgRNA-B tggcatcttccaggaaatc sgRNA cassettes/td>
r_Gbs_sgRNAinpAraC cggccccagctccaattcgccctatagtgactggcatcttccaggaaatctcc pdCas9-w-sgRNA
r_Gbs_sgRNAinPd actagtaacaacttatatcgtatggggctgccgttcgtaagccatttccg pdCas9-w-sgRNA
r_Gbs_sgRNAwoAra TTCTGGCCTTCATGGAACGATATGTTATAAtggcatcttccaggaaatctcc pdCas9-w-sgRNA
r_Gbs_w atttgatgcctggagatccttactcgagTTAACGACGACCTTCAGCA pWJ66
r_Mt_A2080C_pdCas9-w AGATTTTTTCAATCTTCTCACG pdCas9-w
r_opn_d9w acttcaggtgctacatttga pdCas9w-w-sgRNAS
r_opn_pAraC gtttttgtcatggctttggtcc pAraC
r_Rmv_J23117_of_pWJ89 ggacggacaggatgtatgct pWJ89
r_Scq_pdCas9_w_sgRNA ctgatttgagcgtcagat pdCas9-w-sgRNA
r_Sq_CoP_pAraC2ndInsert gtactgcgatgagtggcagg pdCas9-w-sgRNA
r_Sq_J23117alt ATATGATCTGGGTATCTCGCAAAG pWJ89/pWJ89alt
r_Sqc_T2reporter gaaacaggcgatgctgctta pWJ89alt

References

[1] Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell. 2013 Feb 28;152(5):1173-83. doi: 10.1016/j.cell.2013.02.022. 10.1016/j.cell.2013.02.022 PubMed 23452860
[2] Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Bikard D, Jiang W, Samai P, Hochschild A, Zhang F, Marraffini LA. Nucleic Acids Res. 2013 Jun 12. 10.1093/nar/gkt520 PubMed 23761437
[3] A tightly regulated inducible expression system utilizing the fim inversion recombination switch. Ham TS, Lee SK, Keasling JD, Arkin AP. Biotechnol Bioeng. 2006 May 5. 94(1):1-4. 10.1002/bit.20916 PubMed 16534780

EPFL 2015 iGEM bioLogic Logic Orthogonal gRNA Implemented Circuits