Difference between revisions of "Team:DTU-Denmark/Project/MAGE"

 
(4 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
     <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1, user-scalable=no">
 
     <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1, user-scalable=no">
 
     <meta http-equiv="X-UA-Compatible" content="IE=edge">
 
     <meta http-equiv="X-UA-Compatible" content="IE=edge">
   
 
   
 
    <link href="/Team:DTU-Denmark/loadphpcss?action=raw&ctype=text/css" rel="stylesheet">
 
    <link href="/Team:DTU-Denmark/bootstrapcss?action=raw&ctype=text/css" rel="stylesheet">
 
    <link href="/Team:DTU-Denmark/font-awesomecss?action=raw&ctype=text/css" rel="stylesheet">
 
    <link href="/Team:DTU-Denmark/wikicss?action=raw&ctype=text/css" rel="stylesheet">
 
    <link href="/Team:DTU-Denmark/timelinecss?action=raw&ctype=text/css" rel="stylesheet">
 
    <link href="/Team:DTU-Denmark/menufixcss?action=raw&ctype=text/css" rel="stylesheet">
 
  
   
+
      <link rel=stylesheet href="/Team:DTU-Denmark/loadphpcss?action=raw&ctype=text/css">
 +
      <link rel=stylesheet href="/Team:DTU-Denmark/bootstrapcss?action=raw&ctype=text/css">
 +
      <link rel=stylesheet href="/Team:DTU-Denmark/font-awesomecss?action=raw&ctype=text/css">
 +
      <link rel=stylesheet href="/Team:DTU-Denmark/wikicss?action=raw&ctype=text/css">
 +
      <link rel=stylesheet href="/Team:DTU-Denmark/timelinecss?action=raw&ctype=text/css">
 +
      <link rel=stylesheet href="/Team:DTU-Denmark/menufixcss?action=raw&ctype=text/css">
 +
 
 
     <script type="text/javascript" src="/Team:DTU-Denmark/jqueryjs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/jqueryjs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/bootstrapjs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/bootstrapjs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/jqueryeasingjs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/jqueryeasingjs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/wikijs?action=raw&ctype=text/javascript"></script>
 
     <script type="text/javascript" src="/Team:DTU-Denmark/wikijs?action=raw&ctype=text/javascript"></script>
 +
 
     <!-- MathJax (LaTeX for the web) -->
 
     <!-- MathJax (LaTeX for the web) -->
 
     <script src="https://2015.igem.org/common/MathJax-2.5-latest/MathJax.js?config=TeX-AMS-MML_SVG"></script>
 
     <script src="https://2015.igem.org/common/MathJax-2.5-latest/MathJax.js?config=TeX-AMS-MML_SVG"></script>
    <!-- HTML5 shim and Respond.js for IE8 support of HTML5 elements and media queries -->
 
    <!-- WARNING: Respond.js doesn't work if you view the page via file:// -->
 
    <!--[if lt IE 9]>
 
      <script src="https://oss.maxcdn.com/html5shiv/3.7.2/html5shiv.min.js"></script>
 
      <script src="https://oss.maxcdn.com/respond/1.4.2/respond.min.js"></script>
 
    <![endif]-->
 
 
      
 
      
 
   </head>
 
   </head>
Line 44: Line 37:
 
             <i class="fa fa-bars"></i>
 
             <i class="fa fa-bars"></i>
 
           </button>
 
           </button>
           <a class="navbar-brand navimg" href="#"><img src="/wiki/images/b/b7/DTU-Denmark_dtulogo.png"></a>
+
           <a class="navbar-brand navimg" href="#"><img src="https://static.igem.org/mediawiki/2015/b/b7/DTU-Denmark_dtulogo.png"></a>
 
         </div>
 
         </div>
 
         <!-- Collect the nav links, forms, and other content for toggling -->
 
         <!-- Collect the nav links, forms, and other content for toggling -->
 
         <div class="collapse navbar-collapse" id="nav-collapse">
 
         <div class="collapse navbar-collapse" id="nav-collapse">
 
           <ul class="nav navbar-nav">
 
           <ul class="nav navbar-nav">
<li >
+
                <li >
<a href="/Team:DTU-Denmark"
+
                <a href="/Team:DTU-Denmark"
  >Home
+
                  >Home
                                          </a></li>
+
                  </a></li>
<li  
+
                <li  
+
               
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
  >
+
                >
<a href=""
+
                <a href=""
  class="dropdown-toggle"
+
                  class="dropdown-toggle"
  data-toggle="dropdown"
+
                  data-toggle="dropdown"
  role="button"
+
                  role="button"
  aria-expanded="false">Team and Attributions
+
                  aria-expanded="false">Team and Attributions
                                          <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
+
                  <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Team"
+
                <a href="/Team:DTU-Denmark/Team"
  >Team
+
                  >Team
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Attributions"
+
                <a href="/Team:DTU-Denmark/Attributions"
  >Attributions
+
                  >Attributions
                                          </a></li></ul></li>
+
                  </a></li></ul></li>
<li  
+
                <li  
+
               
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
                   
+
                 
+
 
                      
 
                      
 
                       class="active"
 
                       class="active"
 
                      
 
                      
                 
+
               
                   
+
                 
+
                   
+
                 
+
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
  >
+
                >
<a href=""
+
                <a href=""
  class="dropdown-toggle"
+
                  class="dropdown-toggle"
  data-toggle="dropdown"
+
                  data-toggle="dropdown"
  role="button"
+
                  role="button"
  aria-expanded="false">Project
+
                  aria-expanded="false">Project
                                          <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
+
                  <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
<li >
+
                <li >
<a href=""
+
                <a href="/Team:DTU-Denmark/Project/Overview"
  >None
+
                  >Overview
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Project/Overview"
+
                <a href="/Team:DTU-Denmark/Project/Background"
  >Overview
+
                  >Background
                                          </a></li>
+
                  </a></li>
<li >
+
                <li class="active">
<a href="/Team:DTU-Denmark/Project/Background"
+
                <a href="/Team:DTU-Denmark/Project/MAGE"
  >Background
+
                  >MAGE subtilis
                                          </a></li>
+
                  </a></li>
<li class="active">
+
                <li >
<a href="/Team:DTU-Denmark/Project/MAGE"
+
                <a href="/Team:DTU-Denmark/Project/Tyrocidine"
  >MAGE Subtilis
+
                  >Tyrocidine
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Project/Surfactin"
+
                <a href="/Team:DTU-Denmark/Project/Chip"
  >Surfactin
+
                  >Lab-on-a-disc
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Project/Tyrocidine"
+
                <a href="/Team:DTU-Denmark/Project/Inteins"
  >Tyrocidine
+
                  >Inteins
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Project/Chip"
+
                <a href="/Team:DTU-Denmark/Project/Detection"
  >Lab-on-a-disc
+
                  >Detection of NRP
                                          </a></li>
+
                  </a></li></ul></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Project/Intein"
+
                <a href="/Team:DTU-Denmark/Practices"
  >Intein
+
                  >Human Practices
                                          </a></li>
+
                  </a></li>
<li >
+
                <li  
<a href="/Team:DTU-Denmark/Project/Detection"
+
               
  >Detection of NRP
+
                                          </a></li>
+
<li >
+
<a href="/Team:DTU-Denmark/Project/POC_MAGE"
+
  >Proof of concept of MAGE in B. subtilis
+
                                          </a></li></ul></li>
+
<li >
+
<a href="/Team:DTU-Denmark/Practices"
+
  >Human Practices
+
                                          </a></li>
+
<li  
+
+
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
  >
+
                >
<a href=""
+
                <a href=""
  class="dropdown-toggle"
+
                  class="dropdown-toggle"
  data-toggle="dropdown"
+
                  data-toggle="dropdown"
  role="button"
+
                  role="button"
  aria-expanded="false">Parts
+
                  aria-expanded="false">Parts Collection
                                          <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
+
                  <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Parts/Parts"
+
                <a href="/Team:DTU-Denmark/Parts"
  >Parts
+
                  >Parts
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Description"
+
                <a href="/Team:DTU-Denmark/Description"
  >Characterisation of xylR
+
                  >Characterisation of xylR
                                          </a></li></ul></li>
+
                  </a></li></ul></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Journal"
+
                <a href="/Team:DTU-Denmark/Journal"
  >Journal
+
                  >Journal
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Software"
+
                <a href="/Team:DTU-Denmark/Software"
  >Software
+
                  >Software
                                          </a></li>
+
                  </a></li>
<li  
+
                <li  
+
               
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
 
                      
 
                      
                 
+
               
  >
+
                >
<a href=""
+
                <a href=""
  class="dropdown-toggle"
+
                  class="dropdown-toggle"
  data-toggle="dropdown"
+
                  data-toggle="dropdown"
  role="button"
+
                  role="button"
  aria-expanded="false">Achievements
+
                  aria-expanded="false">Achievements
                                          <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
+
                  <span class="caret"></span></a><ul class="dropdown-menu" role="menu">
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Achievements"
+
                <a href="/Team:DTU-Denmark/Achievements"
  >Overview of Achievements
+
                  >Key Achievements
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Collaborations"
+
                <a href="/Team:DTU-Denmark/Collaborations"
  >Collaborations
+
                  >Collaborations
                                          </a></li>
+
                  </a></li>
<li >
+
                <li >
<a href="/Team:DTU-Denmark/Judging%20Form"
+
                <a href="/Team:DTU-Denmark/Judging_Form"
  >Judging Form
+
                  >Judging Form
                                          </a></li></ul></li>
+
                  </a></li></ul></li>
 
             <li class="hidden-xs">
 
             <li class="hidden-xs">
 
               <a href="http://facebook.com/dtubiobuilders" data-toggle="tooltip" data-placement="bottom" title="Follow us on Facebook">
 
               <a href="http://facebook.com/dtubiobuilders" data-toggle="tooltip" data-placement="bottom" title="Follow us on Facebook">
Line 219: Line 194:
 
             <li class="hidden-lg">
 
             <li class="hidden-lg">
 
               <a href="https://igem.org" target="_blank" class="navimg">
 
               <a href="https://igem.org" target="_blank" class="navimg">
                 <img src="/wiki/images/a/af/DTU-Denmark_igemlogo.png">
+
                 <img src="https://static.igem.org/mediawiki/2015/a/af/DTU-Denmark_igemlogo.png">
 
               </a>
 
               </a>
 
             </li>
 
             </li>
Line 226: Line 201:
 
       </div>
 
       </div>
 
     </nav>
 
     </nav>
    <nav class="navbar navbar-default extrabar hidden-xs hidden" data-spy="affix">
+
 
      <div class="container-fluid" id="scrollspy">
+
 
        <ul class="nav navbar-nav">
+
<nav class="navbar navbar-default extrabar hidden-xs hidden" data-spy="affix">
          <li><a class="page-scroll" href="#Overview-Strain">Overview Strain</a></li><li><a class="page-scroll" href="#Methods-Strain">Methods Strain</a></li><li><a class="page-scroll" href="#optimization-of-MAGE-in-B.-subtilis">optimization of MAGE in B. subtilis</a></li><li><a class="page-scroll" href="#Dilution-Equation">Dilution Equation</a></li><li><a class="page-scroll" href="#References">References</a></li>
+
  <div class="container-fluid" id="scrollspy">
        </ul>
+
    <ul class="nav navbar-nav">
      </div>
+
      <li><a class="page-scroll" href="#Abstract">Abstract</a></li><li><a class="page-scroll" href="#MAGEcompetentBsubtilisstrains">MAGE competent B. subtilis strains</a></li><li><a class="page-scroll" href="#ProofofconceptofMAGEinBsubtilis">Proof of concept of MAGE in B. subtilis</a></li><li><a class="page-scroll" href="#OptimizationofMAGEinBsubtilis">Optimization of MAGE in B. subtilis</a></li><li><a class="page-scroll" href="#Surfactin">Surfactin</a></li><li><a class="page-scroll" href="#DilutionEquation">Dilution Equation</a></li><li><a class="page-scroll" href="#References">References</a></li>
    </nav>
+
    </ul>
    <div class="jumbotron hero bg-hero">
+
  </div>
 +
</nav>
 +
 
 +
 
 +
<div class="jumbotron hero" style="background-image: url(https://static.igem.org/mediawiki/2015/0/0b/DTU-Denmark_hero.jpg)">
 
       <div class="igem-logo visible-lg">
 
       <div class="igem-logo visible-lg">
 
         <a href="https://igem.org" target="_blank">
 
         <a href="https://igem.org" target="_blank">
           <img src="/wiki/images/a/af/DTU-Denmark_igemlogo.png">
+
           <img src="https://static.igem.org/mediawiki/2015/a/af/DTU-Denmark_igemlogo.png">
 
         </a>
 
         </a>
 
       </div>
 
       </div>
Line 243: Line 222:
 
           <div class="col-md-12">
 
           <div class="col-md-12">
 
              
 
              
            <h3><br></h3>
+
<h3><br></h3>
            <h1>MAGE Subtilis</h1>
+
<h1>MAGE subtilis</h1>
           
+
 
 
             <hr/>
 
             <hr/>
 +
           
 +
           
 
             <ul class="list-inline hidden-xs hidden-sm">
 
             <ul class="list-inline hidden-xs hidden-sm">
 
                
 
                
 
               <li>
 
               <li>
                 <a id="Overview-Strain-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Overview-Strain">Overview Strain</a>
+
                 <a id="Abstract-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Abstract">Abstract</a>
 +
              </li>
 +
             
 +
              <li>
 +
                <a id="MAGEcompetentBsubtilisstrains-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#MAGEcompetentBsubtilisstrains">MAGE competent B. subtilis strains</a>
 +
              </li>
 +
             
 +
              <li>
 +
                <a id="ProofofconceptofMAGEinBsubtilis-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#ProofofconceptofMAGEinBsubtilis">Proof of concept of MAGE in B. subtilis</a>
 
               </li>
 
               </li>
 
                
 
                
 
               <li>
 
               <li>
                 <a id="Methods-Strain-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Methods-Strain">Methods Strain</a>
+
                 <a id="OptimizationofMAGEinBsubtilis-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#OptimizationofMAGEinBsubtilis">Optimization of MAGE in B. subtilis</a>
 
               </li>
 
               </li>
 
                
 
                
 
               <li>
 
               <li>
                 <a id="optimization-of-MAGE-in-B.-subtilis-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#optimization-of-MAGE-in-B.-subtilis">optimization of MAGE in B. subtilis</a>
+
                 <a id="Surfactin-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Surfactin">Surfactin</a>
 
               </li>
 
               </li>
 
                
 
                
 
               <li>
 
               <li>
                 <a id="Dilution-Equation-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#Dilution-Equation">Dilution Equation</a>
+
                 <a id="DilutionEquation-submenu" class="btn btn-default btn-transparent btn-lg page-scroll" href="#DilutionEquation">Dilution Equation</a>
 
               </li>
 
               </li>
 
                
 
                
Line 273: Line 262:
 
                
 
                
 
               <li>
 
               <li>
                 <a id="Overview-Strain-submenu" class="page-scroll" href="#Overview-Strain">Overview Strain</a>
+
                 <a id="Abstract-submenu" class="page-scroll" href="#Abstract">Abstract</a>
 
               </li>
 
               </li>
 
                
 
                
 
               <li>
 
               <li>
                 <a id="Methods-Strain-submenu" class="page-scroll" href="#Methods-Strain">Methods Strain</a>
+
                 <a id="MAGEcompetentBsubtilisstrains-submenu" class="page-scroll" href="#MAGEcompetentBsubtilisstrains">MAGE competent B. subtilis strains</a>
 
               </li>
 
               </li>
 
                
 
                
 
               <li>
 
               <li>
                 <a id="optimization-of-MAGE-in-B.-subtilis-submenu" class="page-scroll" href="#optimization-of-MAGE-in-B.-subtilis">optimization of MAGE in B. subtilis</a>
+
                 <a id="ProofofconceptofMAGEinBsubtilis-submenu" class="page-scroll" href="#ProofofconceptofMAGEinBsubtilis">Proof of concept of MAGE in B. subtilis</a>
 
               </li>
 
               </li>
 
                
 
                
 
               <li>
 
               <li>
                 <a id="Dilution-Equation-submenu" class="page-scroll" href="#Dilution-Equation">Dilution Equation</a>
+
                 <a id="OptimizationofMAGEinBsubtilis-submenu" class="page-scroll" href="#OptimizationofMAGEinBsubtilis">Optimization of MAGE in B. subtilis</a>
 +
              </li>
 +
             
 +
              <li>
 +
                <a id="Surfactin-submenu" class="page-scroll" href="#Surfactin">Surfactin</a>
 +
              </li>
 +
             
 +
              <li>
 +
                <a id="DilutionEquation-submenu" class="page-scroll" href="#DilutionEquation">Dilution Equation</a>
 
               </li>
 
               </li>
 
                
 
                
Line 293: Line 290:
 
                
 
                
 
             </ul>
 
             </ul>
 +
           
 +
           
 
           </div>
 
           </div>
 
         </div>
 
         </div>
 +
       
 
         <div class="row">
 
         <div class="row">
 
           <div class="col-md-12">
 
           <div class="col-md-12">
 
             Scroll down for more<br>
 
             Scroll down for more<br>
             <a href="#Overview-Strain" class="btn btn-circle btn-transparent page-scroll">
+
             <a href="#Abstract" class="btn btn-circle btn-transparent page-scroll">
 
               <i class="fa fa-angle-double-down"></i>
 
               <i class="fa fa-angle-double-down"></i>
 
             </a>
 
             </a>
 
           </div>
 
           </div>
 
         </div>
 
         </div>
 +
       
 
       </div>
 
       </div>
 
     </div>
 
     </div>
 
      
 
      
+
   
<div id="Overview-Strain">
+
       
 +
<div id="Abstract">
 
   <div class="container">
 
   <div class="container">
 +
 
 
     <div class="row col-md-12">
 
     <div class="row col-md-12">
 
       <h1>
 
       <h1>
         Overview Strain
+
         Abstract
 
       </h1>
 
       </h1>
       <p>In order for MAGE (Multiplex Automated Genome Engineering) to work at a high efficiency, a strain with inserted recombinase and inhibited or knocked out mismatch repair gene has to be used [1]. In our project, two different recombinases were used: a recombination protein Beta from the E. coli phage Lambda, which was codon optimized for B. subtilis 168, and GP35, a recombinase from the B.subtilis phage SPP1 [2]. The mismatch repair proteins known as MutS and MutL were knocked out by transforming pSB1C3_recombinase plasmid into the B. subtilis W168. Since the MutL protein is dependent on the binding of MutS, the knockout of the mutS disables the function of the MutL protein [3].&nbsp;For doing proof of concept of MAGE in B. subtilis 168 four different strains was produced via genetic recombineering. All derived from Bacillus subtilis 168 WT:</p>
+
       
 +
        <p style="text-align: justify;">We showed indications that we made a&nbsp;&nbsp;MAGE competent strains of <em>B. subtilis 168</em>, in which we were able to introduce mutations using oligos. For&nbsp;a proof of concept three different approaches were tried, but only the last method turned out to be useful. In this approach, we took advantage of a point mutation in the ribosome of <em>B. subtilis 168 </em>which provides&nbsp;the strain&nbsp;streptomycin resistant. We were not able generate a sufficient amount of data to significantly proof our results. Experiments were&nbsp;carried out to optimize MAGE in <em>B. subtilis 168, </em>but these result were inconclusive<em>. </em>In spite of the unclear results, we decided to continue to see if we would be able to change the specificity of a NRPS module. We did get vague&nbsp;data suggesting&nbsp;that we were able to change the product of the native <em>B. subtilis 168 </em>nonribosomal peptide (NRP) - surfactin. Due to time constrains the strain was not&nbsp;sequence this&nbsp;mutant, so the successful substitution in surfactin&nbsp;is&nbsp;not confirmed.</p>
 +
 
 +
       
 +
    </div>
 +
   
 +
  </div>
 +
</div>
 +
   
 +
       
 +
<div id="MAGEcompetentBsubtilisstrains">
 +
  <div class="container">
 +
 
 +
    <div class="row col-md-12">
 +
       <h1>
 +
        MAGE competent B. subtilis strains
 +
      </h1>
 +
       
 +
        <h2>Overview</h2>
 +
 
 +
<p style="text-align: justify;">Compared to <em>E. coli</em>, the&nbsp;<em>B. subtilis </em>has more native NRPS&rsquo;, therefore it has more NRP precursors natively available. Proof and optimization of MAGE in <em>B. subtilis </em>would be valuable knowledge for developing novel NRPS&rsquo;.&nbsp;To proof the concept of MAGE in <em>B. subtilis</em> we designed oligos that could introduce a point mutation in the s12 subunit of the ribosome,&nbsp;inducing&nbsp;streptomycin resistance [1]. In order for MAGE (Multiplex Automated Genome Engineering) to work at a high efficiency, a strain with inserted recombinase and inhibited or knocked out mismatch repair gene has to be used [2]. In our project, two different recombinases were used: a recombination protein Beta from the <em>E. coli</em> phage Lambda, which was codon optimized for <em>B. subtilis 168</em>, and GP35, a recombinase from the B.subtilis phage SPP1 [3]. The mismatch repair proteins known as MutS and MutL were knocked out by transforming pSB1C3_recombinase plasmid into the <em>B. subtilis W168</em>. Since the MutL protein is dependent on the binding of MutS, the knockout of the mutS disables the function of the MutL protein [4].</p>
 +
 
 +
<p>Four <em>Bacillus subtilis</em> strains which expressed a recombinase were created by genetically engineering the wild type strain 168:</p>
  
 
<ul>
 
<ul>
Line 322: Line 347:
 
</ul>
 
</ul>
  
 +
<p>The growth of all the mutants was compared to the wild type to test for growth bias. The growth of <em>∆mutS::GP35-neoR,</em> <em>∆amyE::beta-neoR </em>and <em>∆amyE::GP35-neoR </em>was shown to be faster growing than the wild type strain.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<h2>Achievements</h2>
 +
 +
<ul>
 +
<li>We made the following four <em>B. subtilis </em>strains
 +
 +
<ul>
 +
<li><em>∆amyE::beta-neoR</em></li>
 +
<li><em>∆amyE::GP35-neoR</em></li>
 +
<li><em>∆mutS::beta-neoR</em></li>
 +
<li><em>∆mutS::GP35-neoR</em></li>
 +
</ul>
 +
</li>
 +
</ul>
 +
 +
<p>&nbsp;</p>
 +
 +
<h2>Methods</h2>
 +
 +
<p style="text-align: justify;">All the strain were made by homologous recombineering. For this purpose four different plasmids were assembled. Two plasmids contained homologous regions to up- and downstream of mutS and two plasmids containing homologous regions to the <em>amyE </em>locus.&nbsp;Thus, the plasmids are able to do a double-crossover into the genome of <em>B. subtilis 168</em> deleting the CDS of <em>mutS </em>or <em>amyE </em>from the genome. These regions were enclosing a neomycin resistance cassette carrying its own promoter, RBS and terminator (the exact position of these are unknown to us). Besides the neomycin resistance cassette, the mutS homologous regions were&nbsp;enclosing an expression cassette for a recombinase. Two different recombinases, GP35 and beta, were used resulting in two plasmids. The content of the expression cassette is shown in the following table.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<table border="0" cellpadding="0" cellspacing="0" style="width:482px;" width="602">
 +
<tbody>
 +
<tr>
 +
<td>
 +
<p>Feature</p>
 +
</td>
 +
<td>
 +
<p>Name</p>
 +
</td>
 +
<td>
 +
<p>Obtained form</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p>Promoter</p>
 +
</td>
 +
<td>
 +
<p>BBa_k823002</p>
 +
</td>
 +
<td>
 +
<p><a href="http://parts.igem.org/Part:BBa_K823002">iGEM part registry&nbsp;</a></p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p>RBS</p>
 +
</td>
 +
<td>&nbsp;</td>
 +
<td>
 +
<p>Optimized for the recombinase CDS using the RBS calculator provided by https://salislab.net/software/</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p>CDS</p>
 +
</td>
 +
<td>
 +
<p>Beta or GP35</p>
 +
</td>
 +
<td>
 +
<p>See below</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p>Terminator</p>
 +
</td>
 +
<td>
 +
<p>BBa_B0014</p>
 +
</td>
 +
<td>
 +
<p><a href="http://parts.igem.org/Part:BBa_B0014">iGEM part registry</a></p>
 +
</td>
 +
</tr>
 +
</tbody>
 +
</table>
 +
 +
<p>Tabel 1. The general structure of the recombinase expression cassette.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<div aria-multiselectable="true" class="panel-group" id="accordion" role="tablist">
 +
<div class="panel panel-default">
 +
<div class="panel-heading" id="headingOne" role="tab">
 +
<h4 class="panel-title"><a aria-controls="collapseOne" aria-expanded="false" class="collapsed" data-parent="#accordion" data-toggle="collapse" href="#collapseOne" role="button">Obtaining the recombinase CDS&#39;</a></h4>
 +
</div>
 +
 +
<div aria-labelledby="headingOne" class="panel-collapse collapse" id="collapseOne" role="tabpanel">
 +
<div class="panel-body">
 +
<div class="panel-body">
 +
<h3>Beta Protein</h3>
 +
 +
<p style="text-align: justify;">The sequence was obtained from GenBank (Id: KT232076.1), since this sequence is from an <em>E. coli </em>phage the sequence was codon optimized for <em>B. subtilis 168 </em>avoiding the restriction sites suggested by the iGEM REF10 standards. A TAA stop codon was added at the end &nbsp;of the CDS.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<h3><strong>GP35</strong></h3>
 +
 +
<p style="text-align: justify;">As in Sun2015 this sequence was obtained from the genome of the Bacillus phage SPP1 (NCBI: NC_004166.2)[3]. The CDS for &ldquo;gene 35&rdquo; is from basepair 32175 to basepair 33038 in the genome of SPP1. The only alteration done to this CDS was that the native TAG stop codon was changed to two TAA stop codons because of iGEM preferences.</p>
 +
</div>
 +
</div>
 +
</div>
 +
</div>
 +
 +
<p style="text-align: justify;">FOr each of the two recombinases a&nbsp;DNA sequence containing promoter, RBS, CDS and terminator flacked by&nbsp;homologous regions to <em>amyE</em> integration plasmids pDG268neo for <em>B. subtilis</em> was designed. Each of these two sequences&nbsp;was splitted to two sequences with 20bp of overlapping sequence and ordered as four gblocks from IDT.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<h3>Cloning</h3>
 +
 +
<p style="text-align: justify;">The two correlated gblocks were cloned into pDG268neo using gibson assembly and transformed into <em>E. coli</em> - resulting in pDG268neo_beta and pDG268_GP35. The insert of the correct sequence were verified by sequencing.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p><img alt="" src="/files/Wiki_pDG268_recombinase_Map.png" style="width: 500px; height: 524px;" /></p>
 +
 +
<p style="text-align: justify;"><span style="font-size:14px;">Figure 1.&nbsp;Representation of&nbsp;the inserted&nbsp;plasmid&nbsp;pDG268neo_recombinase. The plasmid exists with&nbsp;each of the recombinase proteins CDSs (Beta and GP35). They also have different RBSs since they are optimized for the CDS. The&nbsp;neoR cassette contains&nbsp;a promoter and RBS and&nbsp;a terminator, but sequences and positions of these features are not known.</span><span style="font-size:11px;"></span></p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p style="text-align: justify;">These two plasmids were transformed into <em>B. subtilis 168 </em>using natural competence and transformants was verified using colony PCR. Resulting in the following two strains:</p>
 +
 +
<ul>
 +
<li><em>∆amyE::beta-neoR</em></li>
 +
<li><em>∆amyE::GP35-neoR</em></li>
 +
</ul>
 +
 +
<p style="text-align: justify;">For the construction of the remaining&nbsp;two strains, a DNA fragment containing the <em>neoR</em> cassette and the recombinase expression cassette was amplified by PCR from pDG268neo_beta and pDG268neo_GP35. This was carried out by primers with homologous tails for a mutS upstream fragment in one side and for a mutS downstream fragment in the other side. Appropriate mutS up- and downstream fragments were amplified from the <em>B. subtilis</em> genome, using a cPCR approach. This PCR was carried out by primers that contained tails homologous to the biobrick suffix and the biobrick prefix. The biobrick backbone&nbsp;was amplified from BBa_J04450, with primers&nbsp;that amplifies&nbsp;from the&nbsp;biobrick prefix to the biobrick suffix. Thus, the four fragments: <em>recombinase-neoR, mutS upstream, mutS downstream </em>and the linearized pSB1C3 could be assembled&nbsp;using gibson assembly&nbsp;into two different plasmids: pSB1C3_beta-neoR and pSB1C3_GP35-neoR, see Figure 2.</p>
 +
 +
<p><img alt="" src="/files/Wiki_pSB1C3_recombinase_Map.png" style="height: 557px; width: 500px;" /></p>
 +
 +
<p><span style="font-size:14px;">Figure 2.&nbsp;Representation of&nbsp;the inserted&nbsp;plasmids pSB1C3_recombinase after the inital&nbsp;insertion of the&nbsp;plasmid pDG268neo_recombinase.&nbsp;The plasmid exists with&nbsp;each of the recombinase proteins CDSs (Beta and GP35),&nbsp;They also have different RBSs since they are optimized for the CDS and the&nbsp;neoR cassette contains&nbsp;a promoter and RBS and&nbsp;a terminator, but sequences and positions of these features are not known.</span></p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>The two plasmids were linearized by XhoI cutting out the <em>cmR</em> from the pSB1C3 backbone. Using natural competence the two linearized plasmids were transformed into <em>B. subtilis 168. </em>Inserts were verified by cPCR. Resulting in the last two strains:</p>
 +
 +
<ul>
 +
<li><em>∆mutS::beta-neoR</em></li>
 +
<li><em>∆mutS::GP35-neoR</em></li>
 +
</ul>
 +
 +
<p>&nbsp;</p>
 +
 +
<p><strong><span style="font-size:20px;">Growth Experiment</span></strong></p>
 +
 +
<p>The protocol was followed for creation of MAGE competent Bacillus. The growth of the wild type B. subtilis 168 and all mutants was measured using OD<sub>600</sub> measurements.&nbsp;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<h2>Results and Conclusion</h2>
 +
 +
<h3>Construction of MAGE competent strains</h3>
 +
 +
<p>For results on the construction of the four MAGE competent strains take a look in our <a href="https://static.igem.org/mediawiki/2015/7/75/DTU-Denmark_straingeneration.pdf">lab-notebook</a>.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p><img alt="" src="http://dtuwiki2-drewt.rhcloud.com/files/growth_generation_time.png" style="height: 265px; width: 500px;" /></p>
 +
 +
<p>Figure 3. Generation time of the different mutants measure in minutes.</p>
 +
 +
<p>The different mutants were compared to the wild type. From figure 3 it is clear that the generation time of the mutS::GP35 and the amyE mutants showed to be faster growing than the wild type. The mutS::beta was shown to be slower growing than the wild type, this mutant is the one that is best at recombineering. It is possible that the problem is the high constitutive expression of the beta protein in the cell that interferes with the growth of the cell. This could be solved by using an inducible promoter.</p>
 +
 +
<p>&nbsp;</p>
 +
</div>
 +
 +
       
 
     </div>
 
     </div>
 +
   
 
   </div>
 
   </div>
 
</div>
 
</div>
+
   
+
       
<div id="Methods-Strain">
+
<div id="ProofofconceptofMAGEinBsubtilis">
 
   <div class="container">
 
   <div class="container">
 +
 
 
     <div class="row col-md-12">
 
     <div class="row col-md-12">
 
       <h1>
 
       <h1>
         Methods Strain
+
         Proof of concept of MAGE in B. subtilis
 
       </h1>
 
       </h1>
      <p>All the strain were made by homologous recombineering. Plasmids containing cassettes that were able to do a double-crossover homologous recombineering into the genome of B. subtilis 168 (referred to as knockout (KO) plasmid). These were used to, simultaneously, delete the desired gene (amyE or mutS) and inserting the expression cassette for one of the recombinases: beta or GP35.</p>
+
       
 +
        <h3>Overview</h3>
  
<p><img alt="" src="/wiki/images/a/a4/DTU-Denmark_pDG268neo_recombinase.png" style="width: 400px; height: 397px;" /><img alt="" src="/wiki/images/c/c1/DTU-Denmark_pSB1C3neo_recombinase.png" style="width: 400px; height: 397px;" /></p>
+
<p style="text-align: justify;">To establish&nbsp;proof-the-concept of MAGE in <em>B. subtilis 168</em> several methods were tested, but only one method turned out to be useable. The methods used for proofing MAGE in <em>B. subtilis</em> were&nbsp;as&nbsp;following:</p>
 +
 
 +
<ol>
 +
<li>Knockout of <em>upp</em></li>
 +
<li>Knockout of <em>amyE</em></li>
 +
<li>Introducing streptomycin resistance</li>
 +
</ol>
 +
 
 +
<p style="text-align: justify;">The ideal&nbsp;method was established to be the&nbsp;introduction of&nbsp;streptomycin resistance, allowing indication of successful&nbsp;oligo induced&nbsp;changes&nbsp;in the genome of <em>B. subtilis</em><em>.</em></p>
 +
 
 +
<p>&nbsp;</p>
 +
 
 +
<h3>Achievements</h3>
 +
 
 +
<ul>
 +
<li>Indications&nbsp;suggest a successful&nbsp;introduction of&nbsp;MAGE in <em>B. subtilis.</em></li>
 +
<li>Indications identifies&nbsp;the beta-protein to be&nbsp;more efficient, than the GP35.</li>
 +
</ul>
  
<p>Four different plasmids was assembled to make the four MAGE ready strains:<br />
+
<h3>Methods</h3>
pDG268neo_Beta-neoR<br />
+
pDG268neo_GP35-neoR<br />
+
pSB1C3_Beta-neoR<br />
+
pSB1C3_GP35-neoR</p>
+
  
<p><br />
+
<p style="text-align: justify;">The <a href="http://modest.biosustain.dtu.dk/" target="_blank">MODEST</a> program was used to design oligos for the experiments[5]. The&nbsp;oligo was designed to introduce a point mutation in the 12S&nbsp;subunit in the ribosome of <em>B. subtilis 168,&nbsp;</em>introducing&nbsp;streptomycin resistance [1]. Thus, it allows the selection of&nbsp;mutants growing&nbsp;on streptomycin. The four engineered&nbsp;strains and the wild type of&nbsp;<em>B. subtilis 168</em> were prepared&nbsp;electroporation competent and electroporated with the oligo. The recovering&nbsp;bacteria was&nbsp;diluted and spread onto LB plates and incubated overnight. Single colonies were screened for streptomycin resistance by streaking them onto both LB and LB + streptomycin and following replicaplated.</p>
Missing: figure tekst: Shows the general concepts of the two plasmids pDG268neo_recombinase and pSB1C3_recombinase. Both exists in two versions, one with each of the recombinase proteins CDSs (Beta and GP35). Those also have different RBSs since they are optimized for the CDS. Upstream of neoR is a promoter and RBS and downstream of neoR is a terminator, but sequences and positions of these features are not known.</p>
+
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
 +
<div aria-multiselectable="true" class="panel-group" id="accordion22" role="tablist">
 
<div class="panel panel-default">
 
<div class="panel panel-default">
<div class="panel-heading" id="headingTen" role="tab">
+
<div class="panel-heading" id="headingTwentytwo" role="tab">
<h4 class="panel-title"><a aria-controls="collapseTen" aria-expanded="false" class="collapsed" data-parent="#accordion" data-toggle="collapse" href="#collapseTen" role="button">Insert of recombinase in <em>amyE</em></a></h4>
+
<h4 class="panel-title"><a aria-controls="collapseTwentytwo" aria-expanded="false" class="collapsed" data-parent="#accordion" data-toggle="collapse" href="#collapseTwentytwo" role="button"><em>upp</em> and <em>amyE</em>&nbsp;screening</a></h4>
 
</div>
 
</div>
  
<div aria-labelledby="headingTen" class="panel-collapse collapse" id="collapseTen" role="tabpanel">
+
<div aria-labelledby="headingTwentytwo" class="panel-collapse collapse" id="collapseTwentytwo" role="tabpanel">
 
<div class="panel-body">
 
<div class="panel-body">
 
<div class="panel-body">
 
<div class="panel-body">
<p>For pDG268neo_recobinase a DNA sequence containing following features</p>
+
<p>To test MAGE compliance,&nbsp;an attempt was made&nbsp;to knockout the amyE and upp gens in <em>B. subtilis</em> by using oligoes&nbsp;to&nbsp;incorporate&nbsp;three stop codons in the coding sequences. Both <em>upp</em> and <em>amyE</em> selection showed to be unable to yield conclusive results.</p>
  
<p>Missing: make a table on following</p>
+
<h4><strong>Theory</strong></h4>
  
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Promoter: PliaG from BBa_K823002 was used.</p>
+
<p style="text-align: justify;"><strong><em>amyE</em></strong> is a gene in <em>B. subtilis</em> coding for a amylase protein that can degrade starch. Starch can be colored by an iodine in an ethanol solution and amylase activity is seen by a formed clearing&nbsp;zone&nbsp;due to the degraded starch.</p>
  
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; RBSs were optimized for the specific CDS using the salis lab RBS calculator (Missing <a href="https://www.denovodna.com/software/">https://www.denovodna.com/software/</a>)</p>
+
<p style="text-align: justify;">Knocking out the <strong><em>upp</em></strong> gene is a common method for counter selection and the knockout prevents the cell to retrieve pyrimidine&rsquo;s from the media. <em>upp<sup>+</sup>&nbsp;c</em>ells growing on minimal media with the pyrimidine analog 5-FU and without any pyrimidine&rsquo;s, would&nbsp;accumulate&nbsp;toxins derived form 5-FU&nbsp;causing the cells to die.&nbsp;The screening allows the&nbsp;cells that have an inactivated <em>upp </em>gene to&nbsp;persist as the toxin is not&nbsp;accumulated [6].&nbsp;</p>
  
<p>●&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; CDS for recombination protein beta or GP35</p>
+
<h4><strong>Method</strong></h4>
  
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Terminator: we use rho-independent Part:BBa_B0014</p>
+
<p style="text-align: justify;">Knockout was attempted using the&nbsp;oligoes shown in Table 1. The oligoes were designed using the program <a href="http://modest.biosustain.dtu.dk/">MODEST.</a> The oligo was designed with three point mutations resulting in stop codons in the sequence of the genes.</p>
  
<p><i>Sequence was ordered from IDT as two gblocks (for each recombinase) with overlapping regions, thus they can be assembled with Gibsom assembly.</i></p>
+
<table border="0" cellpadding="0" cellspacing="1">
 +
<thead>
 +
<tr>
 +
<th style="width:37px;">
 +
<p align="center"><strong>Name</strong></p>
 +
</th>
 +
<th style="width:427px;">
 +
<p align="center"><strong>Oligos</strong></p>
 +
</th>
 +
<th>
 +
<p align="center"><strong>Length</strong></p>
 +
</th>
 +
<th>
 +
<p align="center"><strong>point mutation</strong></p>
  
<p>&nbsp;</p>
+
<p align="center"><strong>position</strong></p>
 +
</th>
 +
</tr>
 +
</thead>
 +
<tbody>
 +
<tr>
 +
<td style="width:37px;">
 +
<p>mage_amyE-1</p>
 +
</td>
 +
<td style="width:427px;">
 +
<p>AAGTAACGGTTGCCAATTTGATACGATGTCGGCTGATACAGtCAtTACtAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACT</p>
 +
</td>
 +
<td>
 +
<p>90</p>
 +
</td>
 +
<td>
 +
<p>45-53</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td style="width:37px;">
 +
<p>mage_upp-1</p>
 +
</td>
 +
<td style="width:427px;">
 +
<p>GGGTAATTTCAAATGCCATGAGTGTAGCCACTTCATCTACTtACTaTCaAAAATCCTTCGTACCTGTATTTTCATTCCGTATATATGTCA</p>
 +
</td>
 +
<td>
 +
<p>90</p>
 +
</td>
 +
<td>
 +
<p>44-52</p>
 +
</td>
 +
</tr>
 +
</tbody>
 +
</table>
  
<p>pDG268neo was linearized in a PCR with primers, so that the native <i>lacZ </i>was omitted. This linearized plasmid was purified and used in a Gibsom assembly reaction with two cognate gblocks. This is shown on the figure missing.</p>
+
<p><span style="font-size:14px;">Table 2. The oligoes used for knockout attempt of <em>amyE</em> and <em>upp</em>.</span></p>
  
<p><img alt="" src="/wiki/images/d/d9/DTU-Denmark_pDG268_1.png" style="width: 700px; height: 835px;" /></p>
+
<p style="text-align: justify;"><span style="font-size:14px;"><em>B. subtilis strain 168 </em>with <em>GP35</em> or <em>lambda beta</em> inserted in <em>amyE</em> or <em>mutS</em> knockouts were made&nbsp;electrocompetent using protocol found <a href="http://dtuwiki2-drewt.rhcloud.comhttps://static.igem.org/mediawiki/2015/2/2e/DTU-Denmark_Electro_competent_protocol.pdf">here</a>.&nbsp;<em>amyE</em> and <em>upp </em>were electroporated with the oligoes shown in Table 1. The cells were electroporated at 2.0kV using 0.2cm cuvettes. Prior to the screening the electroporated cells were grown over night on 5y neomycin + LB agar plates, and following&nbsp;restreaked to respectively screening media, e.i. &nbsp;5y neomycin + 1% starch + LB for or minimal media with 25uM 5-FU using the <a href="http://dtuwiki2-drewt.rhcloud.comhttps://static.igem.org/mediawiki/2015/5/52/DTU-Denmark_Minimal_media_protocol.pdf">minimal media protocol</a>.&nbsp;</span></p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p><i>Missing figure text: Gibsom assembly of the pDG268neo_GP35, the gblocks was fused to the &ldquo;gp35 Gblocks fused&rdquo; in the same reaction. The Gibsom assembly of pDG268neo_beta was similar.</i></p>
+
<h4><strong>Results </strong></h4>
  
<p>This resulted in two different plasmids pDG268neo_beta and pDG268neo_gp35.</p>
+
<p style="text-align: justify;">The <em>amyE</em> screening proved&nbsp;to be insuficient to produce&nbsp;clear results and therefore this selection was abandoned. The 5-FU plates were incubated for three days before colonies were visible. To confirm that strain&nbsp;could grow on 5-FU,&nbsp;the colonies were restreacked onto new 5-FU plates. The bacteria could not grow after four days of incubation.</p>
  
<p>&nbsp;</p>
+
<p>The methodshowed to be inadequate to prove the MAGE method in <em>Bacillus</em>.</p>
 
</div>
 
</div>
 
</div>
 
</div>
Line 388: Line 651:
 
</div>
 
</div>
  
<div class="panel panel-default">
+
<p>&nbsp;</p>
<div class="panel-heading" id="headingEleven" role="tab">
+
<h4 class="panel-title"><a aria-controls="collapseEleven" aria-expanded="false" class="collapsed" data-parent="#accordion" data-toggle="collapse" href="#collapseEleven" role="button"><em>mutS</em> deletion</a></h4>
+
</div>
+
  
<div aria-labelledby="headingTen" class="panel-collapse collapse" id="collapseEleven" role="tabpanel">
+
<h3>Results&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</h3>
<div class="panel-body">
+
<p>The two mutS KO plasmids was made of the following DNA fragments:</p>
+
  
<p>1.&nbsp;&nbsp;&nbsp;&nbsp; About 500 bp up- and downstream from <i>mutS</i> was amplified, using primers with tails.</p>
+
<h4>MAGE proof of concept</h4>
  
<p>2.&nbsp;&nbsp;&nbsp;&nbsp; Recombinase and neoR expression cassettes was amplified from the pDG268neo_recombinase</p>
+
<p style="text-align: justify;">To screen for the introduced streptomycin resistance single colonies were&nbsp;colony picked onto both LB and LB + streptomycin. The&nbsp;CFUs on the different plates are listed in the Table 2 below and plates shown in Figure 1. Unfortunately, the data for the two <em>amyE</em> strains got lost.</p>
  
<p>3. &nbsp; &nbsp; Linearized pSB1C3&nbsp;was used as template.</p>
+
<p style="text-align: justify;">&nbsp;</p>
 +
 
 +
<table border="0" cellpadding="0" cellspacing="0">
 +
<tbody>
 +
<tr>
 +
<td style="text-align: center;">&nbsp;</td>
 +
<td>
 +
<p style="text-align: center;"><strong>CFUs on LB </strong></p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;"><strong>CFUs on 500y streptomycin </strong></p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;"><strong>Frequency </strong></p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p style="text-align: center;"><strong><em>∆mutS::beta-neoR</em></strong></p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">52</p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">7</p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">0,13</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p style="text-align: center;"><strong><em>∆mutS::GP35-neoR</em></strong></p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">100</p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">1</p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">0,01</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p style="text-align: center;"><strong>WT</strong></p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">100</p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">0</p>
 +
</td>
 +
<td>
 +
<p style="text-align: center;">0</p>
 +
</td>
 +
</tr>
 +
</tbody>
 +
</table>
 +
 
 +
<p>Table 3. Listing&nbsp;of CFUs in both the selective and non-selective streptomycin resistance&nbsp;plates and their&nbsp;calculated frequency.</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p>These fragments was assembled into two different plasmids pSB1C3_<em>mutS::beta-neo<sup>R</sup></em>&nbsp;and pSB1C3_<em>mutS::gp35-neo<sup>R</sup></em>&nbsp;using Gibsom assembly.</p>
+
<p><img alt="" src="/files/POC_MAGEbeta_1.png" /><img alt="" src="/files/POC_MAGEGP35_2.png" style="width: 333px; height: 351px;" /></p>
 +
 
 +
<p style="text-align: justify;"><span style="font-size:14px;">Figure 4.&nbsp;The pictures show the colonies that was able to grow on 500y streptomycin after electroporation of the&nbsp;oligo. To the left is <em>∆mutS::beta-neoR</em> and to the right is <em>∆mutS::GP35-neoR</em>. It is a typo that the plates say &ldquo;spec&rdquo; and not &ldquo;strep&rdquo; on the plates.</span></p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p><img alt="" src="/wiki/images/d/dc/DTU-Denmark_pDG268_2.png" style="width: 1413px; height: 720px;" /></p>
+
<p>The screened mutant was verified by &ldquo;stamp replicating&rdquo; the plates with the mutants.</p>
  
<p><i>Missing figure text: Gibsom assembly of the pSB1C3_beta. The feature called &ldquo;mutL&rdquo; corresponding mutS downstream. The Gibsom assembly of pSB1C3_GP35 was similar.</i></p>
+
<p><img alt="" src="/files/POC_MAGEbeta_1.png" /><img alt="" src="/files/POC_MAGEGP35_1.png" /></p>
  
<p>All plasmids were verified by restriction enzyme digestion.</p>
+
<p>Figure 5.&nbsp;&nbsp;Stamp replications of the streptomycin resistant mutant.&nbsp;To the left is ∆mutS::beta-neoR and to the right is ∆mutS::GP35-neoR. It is a typo that the plates say &ldquo;spec&rdquo; and not &ldquo;strep&rdquo;.</p>
  
<p>We prepared naturel competent <i>B. subtilis 168</i> to be transformed. The plasmids were linearized with restriction enzymes. Then transformed into naturally competent <i>B. subtilis 168</i>, transformants were selected on 5ɣ neo. Transformants were verified with colony PCRs.</p>
+
<p>&nbsp;</p>
</div>
+
 
</div>
+
<h2>Discussion</h2>
 +
 
 +
<p style="text-align: justify;"><span style="font-size:14px;">It was established&nbsp;that&nbsp;streptomycin resistance as screening method did not provide sufficient data. The main issue was to&nbsp;quantify the&nbsp;actual&nbsp;mutants and separate them from&nbsp;spontaneous mutants. Time restrains&nbsp;limited&nbsp;the option of sequencing&nbsp;any of the mutants to verify the insertions. Experiments could be replicated&nbsp;to support the data.&nbsp;If&nbsp;the&nbsp;experimental data is accurate, the findings suggest&nbsp;the beta protein to be&nbsp;more efficient than the GP35,&nbsp;contradicts Sun et al. 2015, but we hypothesis that this could be due to the&nbsp;shorter oligos&nbsp;used compared to theirs[3]. Other reasons could be that GP35 is dependent on other gene products from the SPP1 phage such as GP34 or GP33, but this has not been confirmed.</span></p>
 
</div>
 
</div>
  
 +
       
 
     </div>
 
     </div>
 +
   
 
   </div>
 
   </div>
 
</div>
 
</div>
+
   
+
       
<div id="optimization-of-MAGE-in-B.-subtilis">
+
<div id="OptimizationofMAGEinBsubtilis">
 
   <div class="container">
 
   <div class="container">
 +
 
 
     <div class="row col-md-12">
 
     <div class="row col-md-12">
 
       <h1>
 
       <h1>
         optimization of MAGE in B. subtilis
+
         Optimization of MAGE in B. subtilis
 
       </h1>
 
       </h1>
      <p><o:p></o:p><span style="font-size:14px;font-family:Arial;color:#333333;background-color:#ffffff;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"></span></p>
+
       
 +
        <p><o:p></o:p><span style="font-size:14px;font-family:Arial;color:#333333;background-color:#ffffff;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"></span></p>
  
<p><span style="font-size:20px;"><strong>Background </strong></span></p>
+
<p><span style="font-size:20px;"><strong>Overview </strong></span></p>
  
<p>Oligo amount was predicted to be optimal at 5 &micro;M oligo added to electrocompetent cells [1].&nbsp;</p>
+
<p>Different experiments were made to optimize the MAGE procedure. Three different experiments were conducted, to test the right amount&nbsp;and length of the oligos. additionally the mismatch frequency was attempted to be quantified. In our experiments the optimal length was shown to be 80nt which correlates with the expected 90nt. Optimal amount of oligo was showed to be 5uM, which also fits with the expectations. Interestingly the number of mismatches with the highest transformation rate was 5 mismatches, this is unexpected. Using streptomycin oligoes seemed to have a high systematic error.</p>
  
<p>The optimal length of oligos in <em>E.coli</em> has shown to be 90nt [4]. We wanted to test if this is also the case for <em>B. subtilis</em>.</p>
+
<p>&nbsp;</p>
  
<p>The mismatch frequency was desired to quantify the frequency of inserting bigger changes in the genome. In <em>E. coli</em> the larger mismatch part is the lower is the transformation frequency[4].</p>
+
<p><span style="font-size:20px;"><strong>Background </strong></span></p>
 +
 
 +
<p>We ran different optimization experiments to test if recombineering in B. subtilis could be optimized in the same way as for E. coli. For E. coli the optimal amount of oligo is 5&micro;M&nbsp;[2].&nbsp; with a legnth of 90nt [7]. The mismatch frequency of E. coli could be fitted by a binomial distribution.</p>
 +
 
 +
<p>&nbsp;</p>
  
 
<p><span style="font-size:20px;"><strong>Experimental design</strong></span></p>
 
<p><span style="font-size:20px;"><strong>Experimental design</strong></span></p>
Line 445: Line 776:
 
<p>Using the dilution equation and the functional MAGE method, different experiments were run to optimize the efficiency of MAGE in <em>Bacillus</em>.</p>
 
<p>Using the dilution equation and the functional MAGE method, different experiments were run to optimize the efficiency of MAGE in <em>Bacillus</em>.</p>
  
<p>The three analyzed factors include amount of oligo used, the length of the oligos and the impact of the number of base pair mismatches in the oligo.</p>
+
<p>The three analyzed factors includes:<br />
 +
amount of oligo used, the length of the oligos, and&nbsp;the number of base pair mismatches inserted into the oligo.</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p><span style="font-size:20px;"><strong>Achivements </strong></span></p>
+
<p><span style="font-size:20px;"><strong>Achievements </strong></span></p>
  
 
<ul>
 
<ul>
<li>characterized the insertion frequency of mismatches in the genome of B. subtilis</li>
+
<li>Characterized the insertion frequency of mismatches in the genome of B. subtilis.</li>
<li>characterized the insertion frequency of oligoes with different length in the genome of B. subtilis</li>
+
<li>Characterized the insertion frequency of oligoes with different length in the genome of B. subtilis.</li>
<li>The an estimate of the optimal amount of oligo was found</li>
+
<li>The an estimate of the optimal amount of oligo was found.</li>
 
</ul>
 
</ul>
  
Line 461: Line 793:
 
<p><span style="font-size:20px;"><strong>Methods</strong></span></p>
 
<p><span style="font-size:20px;"><strong>Methods</strong></span></p>
  
<p>All three experiments followed &quot;MAGE in Bacillus subtilis 168&quot;&nbsp;<a href="None" target="_blank">protocol</a>. The oligo we used is shown below introducing streptomycin resistance with one mismatch.</p>
+
<p>All three experiments followed the &quot;MAGE in Bacillus subtilis 168&quot;&nbsp;<a href="https://static.igem.org/mediawiki/2015/0/0e/DTU-Denmark_MAGE_in_baccilus.pdf" target="_blank">protocol</a>. The oligo we used is shown below introducing streptomycin resistance with one mismatch.</p>
  
 
<table border="1" cellpadding="1" cellspacing="1" style="width: 500px;">
 
<table border="1" cellpadding="1" cellspacing="1" style="width: 500px;">
Line 471: Line 803:
 
</tr>
 
</tr>
 
<tr>
 
<tr>
<td>B_Sub_Mods0007.1mutationrpsL</td>
+
<td>B_Sub_Mods0007.1mutationrpsL&nbsp;</td>
 
<td>
 
<td>
 
<p dir="ltr" id="docs-internal-guid-104a6dbc-e363-bef5-da9b-8e98ab13ead0" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size: 14.6667px; font-family: Arial; background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;">GAAGTGCTGAGTTCGGTTTgttCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT</span></p>
 
<p dir="ltr" id="docs-internal-guid-104a6dbc-e363-bef5-da9b-8e98ab13ead0" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size: 14.6667px; font-family: Arial; background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;">GAAGTGCTGAGTTCGGTTTgttCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT</span></p>
 
</td>
 
</td>
<td>90</td>
+
<td>&nbsp;90</td>
 
</tr>
 
</tr>
 
</tbody>
 
</tbody>
 
</table>
 
</table>
 +
 +
<p>&nbsp;</p>
  
 
<p>The amount &nbsp;of oligo was varied between 0.05 - 6.25uM.</p>
 
<p>The amount &nbsp;of oligo was varied between 0.05 - 6.25uM.</p>
  
<p><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">In the mismatch frequency experiment six oligos with 1-6 mismatches&nbsp; individually.&nbsp; (Missing: link to protocol and labnotes).</span></p>
+
<p><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">In the mismatch frequency experiment, six oligos with 1-6 mismatches&nbsp;individually was created to be inserted. </span></p>
 +
 
 +
<table border="1" cellpadding="1" cellspacing="1" style="width: 500px;">
 +
<tbody>
 +
<tr>
 +
<td>name</td>
 +
<td>Sequence</td>
 +
<td>Length</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8320,null,null,null,null,null,null,null,2,null,null,null,null,null,11]" data-sheets-value="[null,2,&quot;rpsL 1mm&quot;]" style="font-size:110%;font-family:arial,sans,sans-serif;">rpsL 1mm</span></td>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8705,[null,0],null,null,null,null,null,null,null,null,0,null,null,null,10]" data-sheets-value="[null,2,&quot;G*A*AGTGCTGAGTTCGGTTTTCTCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT&quot;]" style="font-size:100%;font-family:arial,sans,sans-serif;">G*A*AGTGCTGAGTTCGGTTTTCTCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT</span></td>
 +
<td>90</td>
 +
</tr>
 +
<tr>
 +
<td><span data-sheets-userformat="[null,null,8320,null,null,null,null,null,null,null,2,null,null,null,null,null,11]" data-sheets-value="[null,2,&quot;rpsL 1mm&quot;]" style="font-size:110%;font-family:arial,sans,sans-serif;">rpsL 2mm</span></td>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8705,[null,0],null,null,null,null,null,null,null,null,0,null,null,null,10]" data-sheets-value="[null,2,&quot;G*A*AGTGCTGAGTTCGGTTTCCTCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT&quot;]" style="font-size:100%;font-family:arial,sans,sans-serif;">G*A*AGTGCTGAGTTCGGTTTCCTCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT</span></td>
 +
<td>90</td>
 +
</tr>
 +
<tr>
 +
<td><span data-sheets-userformat="[null,null,8320,null,null,null,null,null,null,null,2,null,null,null,null,null,11]" data-sheets-value="[null,2,&quot;rpsL 1mm&quot;]" style="font-size:110%;font-family:arial,sans,sans-serif;">rpsL 3mm</span></td>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8705,[null,0],null,null,null,null,null,null,null,null,0,null,null,null,10]" data-sheets-value="[null,2,&quot;C*G*AAGTGCTGAGTTCGGTTTCCGCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCT&quot;]" style="font-size:100%;font-family:arial,sans,sans-serif;">C*G*AAGTGCTGAGTTCGGTTTCCGCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCT</span></td>
 +
<td>90</td>
 +
</tr>
 +
<tr>
 +
<td><span data-sheets-userformat="[null,null,8320,null,null,null,null,null,null,null,2,null,null,null,null,null,11]" data-sheets-value="[null,2,&quot;rpsL 1mm&quot;]" style="font-size:110%;font-family:arial,sans,sans-serif;">rpsL 4mm</span></td>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8705,[null,0],null,null,null,null,null,null,null,null,0,null,null,null,10]" data-sheets-value="[null,2,&quot;C*A*AACGAACACGAGCATATTTACGAAGTGCTGAGTTCGGTTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGG&quot;]" style="font-size:100%;font-family:arial,sans,sans-serif;">C*A*AACGAACACGAGCATATTTACGAAGTGCTGAGTTCGGTTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGG</span></td>
 +
<td>90</td>
 +
</tr>
 +
<tr>
 +
<td><span data-sheets-userformat="[null,null,8320,null,null,null,null,null,null,null,2,null,null,null,null,null,11]" data-sheets-value="[null,2,&quot;rpsL 1mm&quot;]" style="font-size:110%;font-family:arial,sans,sans-serif;">rpsL 5mm</span></td>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8705,[null,0],null,null,null,null,null,null,null,null,0,null,null,null,10]" data-sheets-value="[null,2,&quot;A*C*GAGCATATTTACGAAGTGCTGAGTTCGGCTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATAC&quot;]" style="font-size:100%;font-family:arial,sans,sans-serif;">A*C*GAGCATATTTACGAAGTGCTGAGTTCGGCTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATAC</span></td>
 +
<td>90</td>
 +
</tr>
 +
<tr>
 +
<td><span data-sheets-userformat="[null,null,8320,null,null,null,null,null,null,null,2,null,null,null,null,null,11]" data-sheets-value="[null,2,&quot;rpsL 1mm&quot;]" style="font-size:110%;font-family:arial,sans,sans-serif;">rpsL 6mm</span></td>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,8705,[null,0],null,null,null,null,null,null,null,null,0,null,null,null,10]" data-sheets-value="[null,2,&quot;A*G*TCAAACGAACACGAGCATATTTACGAAGTGCTGAGTTTGGCTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTG&quot;]" style="font-size:100%;font-family:arial,sans,sans-serif;">A*G*TCAAACGAACACGAGCATATTTACGAAGTGCTGAGTTTGGCTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTG</span></td>
 +
<td>90</td>
 +
</tr>
 +
</tbody>
 +
</table>
 +
 
 +
<p>&nbsp;</p>
  
 
<p>For the varying of length ssDNA from 50-100nt was used with one mismatch.</p>
 
<p>For the varying of length ssDNA from 50-100nt was used with one mismatch.</p>
Line 492: Line 889:
 
<p><span style="font-size:20px;"><strong>Results</strong></span></p>
 
<p><span style="font-size:20px;"><strong>Results</strong></span></p>
  
<p>&nbsp;<img alt="" src="/wiki/images/7/76/DTU-Denmark_Oligo_amunt_picture.png" /></p>
+
<p>The transformation frequency varies from 18-50%&nbsp;in the oligo amount experiment, this seems to be a too high number when comparing to earlier results, and the standard transformation frequency for MAGE in <em>E. coli</em>. The data seems to suggest that the optimal oligo amount for transformation is 5 uM. This correlates with the optimal amount for E coli [7].&nbsp;The Figure 4 below&nbsp;shows the transformation frequency for the oligo amount experiment.&nbsp;The oligo length data shown in Figure 5&nbsp;seems to suggest that the optimal oligo length is 80nt this correlates well with the the optimal length for E coli being 90nt.</p>
  
<p><span style="font-size:14px;">Figure 1. the efficacy of oligo amount versus transformation rate</span>&nbsp;</p>
+
<p><img alt="" src="http://dtuwiki2-drewt.rhcloud.com/files/oligo_concentration.png" style="width: 500px; height: 320px;" /></p>
  
<p>The Figure 1 above shows the transformation frequency for the oligo amount experiment.</p>
+
<p><span style="font-size:14px;">Figure 6. the efficacy of oligo amount versus transformation rate</span>&nbsp;</p>
  
<p>The transformation frequency varies from 18-50%&nbsp; in the oligo amount experiment, this seems to be a too high number when comparing to earlier results and the standard transformation frequency for MAGE in <em>E. coli</em>. The data seems to suggest that the optimal oligo amount for transformation is 5 uM. This correlates with the optimal amount for E coli [4].</p>
+
<p>&nbsp;</p>
 
+
<p><img alt="" src="/wiki/images/4/40/DTU-Denmark_oligo_length_picture.png " style="width: 700px; height: 415px;" /></p>
+
  
<p><span style="font-size:14px;">Figure 2 Shows the transformation frequency of oligo length.</span></p>
+
<p><img alt="" src="/files/oligo%20length%20picture.png " style="width: 500px; height: 312px;" /></p>
  
<p>The oligo length data shown in Figure 2 seems to suggest that the optimal oligo length is 80nt this correlates well with the the optimal length for E coli being 90nt.</p>
+
<p><span style="font-size:14px;">Figure 7.&nbsp;Shows the transformation frequency of oligo length.</span></p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
Line 510: Line 905:
 
<p dir="ltr" id="docs-internal-guid-e99b4f48-e322-d98b-5b51-d939937253b5" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"></span></p>
 
<p dir="ltr" id="docs-internal-guid-e99b4f48-e322-d98b-5b51-d939937253b5" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"></span></p>
  
<p dir="ltr" id="docs-internal-guid-e99b4f48-e323-cfc1-61f5-6f8f4e30bfe0" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><img alt="" src="/wiki/images/c/ce/DTU-Denmark_mismatch_frequency_.png" style="width: 700px; height: 419px;" /></p>
+
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><img alt="" src="http://dtuwiki2-drewt.rhcloud.com/files/mismatch_frequency.png" style="width: 500px; height: 301px;" /></p>
  
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14px;">Figure 3 Shows transformation frequency of with extra mismatches from 1-6.</span></p>
+
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14px;">Figure 8&nbsp;Shows transformation frequency of with extra mismatches from 1-6.</span></p>
  
<p>The Figure 3 above showes the transformation frequency for mismatch insertion. This results does not correleate with the asomption that the lower the amount of mismatches the higher the transforation rate. Here the opposite is shown. This can be do to the high uncertanty in using streptyomcine resistens.</p>
+
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;">&nbsp;</p>
 +
 
 +
<p>The Figure 8&nbsp;above shows the transformation frequency for mismatch insertion. This results does not correlate with the assumption that the lower the amount of mismatches the higher the transformation rate. Here the opposite is shown. This can be do to the high uncertainty in using streptomycin resistance. because of this the frequency pr. mismatch was not calculated.</p>
 +
 
 +
<p>&nbsp;</p>
  
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">The three Figures shown above varieties greatly. It is possible that the cells were not optimally electro competent. These experiment need to be redone to define if the experimental setup is incorrect or if some other variation is in play.</span></p>
+
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">The three figures shown above varies greatly. It is possible that the cells were not optimally electro competent. These experiment need to be redone to define if the experimental setup is incorrect or if some other variation is in play.</span></p>
  
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span></p>
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span></p>
Line 526: Line 925:
 
<p>Selection of the colonies was difficult because of possible background from spontaneous mutants that became visible after 2 days and the risk of adding too much cell mass onto the plate when colony picking, this could be mistaken as a growing colony.</p>
 
<p>Selection of the colonies was difficult because of possible background from spontaneous mutants that became visible after 2 days and the risk of adding too much cell mass onto the plate when colony picking, this could be mistaken as a growing colony.</p>
  
<p>The results will need to be validated preferably using another screening method, since false positives seems to be an issue when using streptomycine as selection marker. It could be suggested to use a GFP with a inserted stop codon in the genome. The MAGE protocol could then be optimized for making knockins, this could be screened by using flow cytometry.</p>
+
<p>&nbsp;</p>
 +
 
 +
<p>The results will need to be validated preferably using another screening method, since false positives seems to be an issue when using streptomycin as selection marker. It could be suggested to use a GFP with a inserted stop codon in the genome. The MAGE protocol could then be optimized for making knockins, this could be screened by using flow cytometry.</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p>Conclusion</p>
+
<p><span style="font-size:20px;"><strong>Conclusion</strong></span></p>
  
<p>The experiements indicate that that 5 mismatches of with a length of 80nt and using 5uM of oligo would optimize the MAGE method. The data is of pure quality and nothing certain can be concluded from this experiment.&nbsp;</p>
+
<p>The experiments indicate that 5bp mismatches with a length of 80nt and using 5uM of oligo would optimize the MAGE method in Bacillus. The data is of pure quality and nothing certain can be concluded from this experiment.&nbsp;</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
Line 544: Line 945:
 
<p><span style="font-size:20px;"><strong>Background</strong></span></p>
 
<p><span style="font-size:20px;"><strong>Background</strong></span></p>
  
<p>A great strength of the &nbsp;MAGE method is that it can be iterated until the amount of cells with the wanted change high (doi:10.1038/nature08187). We wanted to best if this also is the case in B. subtilis. Our experiments suggest that the this might be the case.</p>
+
<p>A great strength of the &nbsp;MAGE method is that it can be iterated until the amount of cells with the wanted change is high [7]. We wanted to test if this also is the case in B. subtilis. Our experiments suggest that the this might be the case.</p>
  
 
<p><span style="font-size:20px;"><strong>Experimental design</strong></span></p>
 
<p><span style="font-size:20px;"><strong>Experimental design</strong></span></p>
  
<p>We hypothesized that if the MAGE protocol was repeated multiple times the amount of transformants would rise. This was tested by running four cycles of the OGRE protocol. The progress could be followed by plating a dilution of the sample on streptomycin plates after every round and calculating the start value of the culture from the OD<sub>600</sub> measurements. It was necessary to colony pick colonies onto streptomycin plates this gave usable results.</p>
+
<p>We hypothesized that if the MAGE protocol was repeated multiple times, the amount of transformants would rise. This was tested by running four cycles of the MAGE protocol. The progress could be followed by plating a dilution of the sample on streptomycin plates after every round and calculating the start value of the culture from the OD<sub>600</sub> measurements. It was necessary to colony pick onto streptomycin plates, which&nbsp;gave usable results.</p>
  
<p><span style="font-size:20px;"><strong>Achivements</strong></span></p>
+
<p><span style="font-size:20px;"><strong>Achievements</strong></span></p>
  
<p>&middot; &nbsp;&nbsp;&nbsp;&nbsp; showed that colony picking is an ineffective method of quantifying OGRE frequency.</p>
+
<ul>
 +
<li>Identified&nbsp;that colony picking is a insufficient method to&nbsp;quantifying MAGE&nbsp;frequency.</li>
 +
<li>Showed that the knockout of mutS has a significant effect on<strong> </strong>the transformation frequency</li>
 +
<li>developing a procedure for repeating MAGE in <em>Bacillus</em></li>
 +
</ul>
  
<p>&middot; &nbsp;&nbsp;&nbsp;&nbsp; showed that the knockout of mutS has a significant effect on</p>
+
<p><span style="font-size:20px;"><strong>Materials </strong></span></p>
 +
 
 +
<p>The protocol specially made for this procedure was followed. This protocol takes approximately 6 hours for every cycle. Four cycles was run.</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p><span style="font-size:20px;"><strong>Materials </strong></span></p>
+
<p><span style="font-size:20px;"><strong>Results</strong></span></p>
  
<p>The protocol specially med for this procedure was followed ( MISSING see procol for multeple MAGE). This protocol takes approximately 6 hours for every cycle. Four cycles was run</p>
+
<p>We had problems with finding the optimal dilutions. This cause a lack of data for some of the samples, new cells were re-plated from the glycerol stock of the differed MAGE cycles, but the same problem was encounted again.&nbsp; There was a high variation in the amounts of transformants on the plates. We recommend to use the OD calculator for making an approximation of the correct dilution factor.</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p><span style="font-size:20px;"><strong>Results</strong></span></p>
+
<p><img alt="" src="http://dtuwiki2-drewt.rhcloud.com/files/MAGE_cycles_frequency.png" style="width: 500px; height: 301px;" /></p>
 +
 
 +
<p><span style="font-size:14px;">Figure 9. The frequency for the insertion of the streptomycin phenotype can be seen for the samples.</span><o:p></o:p></p>
 +
 
 +
<p>It seems that <em>mutS::beta</em> is better than the wild type, <em>mutS::GP35</em> and <em>amyE::GP35</em>. The experiment indicates that many MAGE cycles gives a higher yield than a single cycle, but the data is inconsistent when looking at Figure 4. The experiment will need to be run with a better method of testing if the insertion has been incorporated into the genome.</p>
 +
 
 +
<p><o:p></o:p></p>
 +
 
 +
       
 +
    </div>
 +
   
 +
  </div>
 +
</div>
 +
   
 +
       
 +
<div id="Surfactin">
 +
  <div class="container">
 +
 
 +
    <div class="row col-md-12">
 +
      <h1>
 +
        Surfactin
 +
      </h1>
 +
       
 +
        <p><span style="font-size:20px;"><strong>Overview </strong></span></p>
  
<p>We had problems with finding the optimal dilutions. This cause the lack of data for some of the samples, new cells were replated from the glycerol stock of the differed MAGE cycles, but same problem was encountered again.&nbsp; There was a high variation in the amounts of transformants on the plates. We recommend to use the OD calculator ( MISSING make link) for making an approximation of the correct dilution factor.</p>
+
<p>To test if the MAGE method could be used to change the affinity of the A domain in a NRPS. The A domain in the 5th module of the synthase producing surfactin was changed and results were verified using using MALDI-TOF. Results indicate that the desired change was incorporated. The production efficiency of the bacteria was strongly reduced.</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
<p><img alt="" src="/wiki/images/c/c4/DTU-Denmark_mutliple_OGRE_Frequency_.png" style="width: 700px; height: 395px;" /></p>
+
<p><span style="font-size:20px;"><strong>Achievements</strong></span></p>
  
<p><span style="font-size:12px;">Figure 4. The frequency for the insertion of the streptomycin phenotype can be seen for the samples.</span><o:p></o:p></p>
+
<ul>
 +
<li>showed that the MAGE method can be used to change the specificity of a A domain in the surfactine synthase</li>
 +
</ul>
  
<p>The data for figure 4 can be seen <a href=":files:OGRE%20cycles%20data.xls">here</a></p>
+
<p>&nbsp;</p>
  
<p>It seems that <em>mutS::beta</em> is better than the wild type, <em>mutS::GP35</em> and <em>amyE::GP35</em>. We cannot conclude that more MAGE cycles gives a higher yield than a single cycle, because this result is not constant when looking at Figure MISSING variation in the data is so great. The experiment will need to be run with a better method of testing if the insertion has been incorporated into the genome.</p>
+
<p><span style="font-size:20px;"><strong>Experimental design</strong></span></p>
  
<p><o:p></o:p></p>
+
<p>Surfactin is a surfactant&nbsp;cyclic lipopeptide produced by&nbsp;<em>Bacillus subtilis</em> important for sporulation in&nbsp;<em>B. subtilis</em>[8]&nbsp;and is used as an antibiotic[9]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). AntiSMASH prediction of adenylation domain specificity corresponds&nbsp;to surfactant. The NRPS modules are divided out on three contigs (ctg1_354-5) with 3, 3, and 1 module, respectively as shown in figure 1</p>
  
 +
<p>&nbsp;</p>
 +
 +
<p><img alt="" src="http://dtuwiki2-drewt.rhcloud.com/files/surfactin.png" style="width: 500px; height: 254px;" /></p>
 +
 +
<p><span style="font-size:14px;">Figure 10. Picture of surfactine synthase [10]&nbsp;</span></p>
 +
 +
<p><img alt="" src="https://static.igem.org/mediawiki/2015/7/78/DTU-Denmark_surfactin_highlight.png" style="height: 285px; width: 400px;" /></p>
 +
 +
<p><span style="font-size:14px;">Figure 11. Picture of surfactin</span></p>
 +
 +
<p>The fifth module of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp-&gt;Asn. Two different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table 1), yielding different number of mismatches in the oligo.</p>
 +
 +
<p><span style="font-size:14px;"><strong>Table 4&nbsp;</strong>List of oligos used to modify surfactin NRPS.</span></p>
 +
 +
<p><span style="font-size:14px;"></span></p>
 +
 +
<p><span style="font-size:14px;">
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}--> 
 +
</style>
 +
<span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTAC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);"></span></span></p>
 +
 +
<table border="1" cellpadding="1" cellspacing="1" style="width: 500px;">
 +
<tbody>
 +
<tr>
 +
<td>&nbsp;oligo name</td>
 +
<td>sequence</td>
 +
<td>LengthMutation(Stacelhaus)</td>
 +
<td>
 +
<p>length</p>
 +
</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<p>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span style="font-size:12px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16119285],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;Oligo_surf_Asp-&gt;Asn_1_l&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">Oligo_surf_</span></span></p>
 +
 +
<p><span style="font-size:12px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16119285],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;Oligo_surf_Asp-&gt;Asn_1_l&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">Asp-&gt;Asn_1_l</span></span></p>
 +
</td>
 +
<td>
 +
<p><span style="font-size:14px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTAC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGA</span></span></p>
 +
 +
<p><span style="font-size:14px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTAC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">TAAA</span><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTAC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">TTCGGTATGTCCATACATCTTAC</span></span></p>
 +
</td>
 +
<td>H322E, I330S</td>
 +
<td>200</td>
 +
</tr>
 +
<tr>
 +
<td>
 +
<style type="text/css"><!--td {border: 1px solid #ccc;}br {mso-data-placement:same-cell;}-->
 +
</style>
 +
<span data-sheets-userformat="[null,null,513,[null,0],null,null,null,null,null,null,null,null,0]" data-sheets-value="[null,2,&quot;oligo_surf asp-&gt;Asn_2_I&quot;]" style="font-size:13px;font-family:arial,sans,sans-serif;">oligo_surf asp-&gt;Asn_2_I</span></td>
 +
<td>
 +
<p><span style="font-size:14px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGGGATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCT</span></span></p>
 +
 +
<p><span style="font-size:14px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGGGATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">GTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGG</span></span></p>
 +
 +
<p><span style="font-size:14px;"><span data-sheets-userformat="[null,null,10755,[null,0],[null,2,16777215],null,null,null,null,null,null,null,0,null,[null,2,3355443],null,11]" data-sheets-value="[null,2,&quot;T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGGGATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC&quot;]" style="font-family: arial,sans,sans-serif; color: rgb(51, 51, 51);">GATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC</span></span></p>
 +
</td>
 +
<td>V299L,&nbsp;H322E, I330S&nbsp;</td>
 +
<td>200</td>
 +
</tr>
 +
</tbody>
 +
</table>
 +
 +
<p>&nbsp;</p>
 +
 +
<h2><span style="font-size:20px;">Methods</span></h2>
 +
 +
<p>Electrocompetent <em>B. subtilis&Delta;mutS::beta-neo<sup>R</sup> </em>or&nbsp;<em>&Delta;mutS::GP35-neo<sup>R</sup></em>&nbsp; mutation was used.&nbsp; Three oligoes were used for this experiment. The two showed in table 1 was used separately, and the streptomycin resisters oligo called B_sub_Mods0007.1mutationrpsL was used to select for the desired change. 100uL of cells was mixed with 5uL of the surfactine changing oligo, and 0.5uL of the streptomycin resistance oligo was used in accordance with the protocol for <a href="https://static.igem.org/mediawiki/2015/2/2e/DTU-Denmark_Electro_competent_protocol.pdf" target="_blank">electroporation.</a></p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p><span style="font-size:20px;"><strong>Results </strong></span></p>
 +
 +
<p>See surfactine part in Detection of NRP</p>
 +
 +
       
 
     </div>
 
     </div>
 +
   
 
   </div>
 
   </div>
 
</div>
 
</div>
+
   
+
       
<div id="Dilution-Equation">
+
<div id="DilutionEquation">
 
   <div class="container">
 
   <div class="container">
 +
 
 
     <div class="row col-md-12">
 
     <div class="row col-md-12">
 
       <h1>
 
       <h1>
 
         Dilution Equation
 
         Dilution Equation
 
       </h1>
 
       </h1>
      <p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:20px;"><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 700; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;">Overview</span></span></p>
+
       
 +
        <p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:20px;"><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 700; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;">Overview</span></span></p>
  
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">The</span><a href="https://2008.igem.org/Team:Imperial_College" style="text-decoration:none;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span><span style="font-size:14.666666666666666px;font-family:Arial;color:#1155cc;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:underline;vertical-align:baseline;">Imperial iGEM 2008</span></a><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> team has made an equation for calculating CFU from OD<sub>600</sub>. We tried to validate their equation by using our own data. Unfortunately the variation in our results was too high to validate their equation. Based on their results we made a calculator that could compute the optimal dilution for plating to get a countable number of colonies.</span></p>
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">The</span><a href="https://2008.igem.org/Team:Imperial_College" style="text-decoration:none;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span><span style="font-size:14.666666666666666px;font-family:Arial;color:#1155cc;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:underline;vertical-align:baseline;">Imperial iGEM 2008</span></a><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> team has made an equation for calculating CFU from OD<sub>600</sub>. We tried to validate their equation by using our own data. Unfortunately the variation in our results was too high to validate their equation. Based on their results we made a calculator that could compute the optimal dilution for plating to get a countable number of colonies.</span></p>
Line 613: Line 1,127:
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">Y = CFU/mL</span></p>
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">Y = CFU/mL</span></p>
  
<p><img alt="" src="/wiki/images/4/4b/DTU-Denmark_plot_CFU_vs_OD.png" style="width: 700px; height: 372px;" /></p>
+
<p><img alt="" src="/files/plot%20CFU%20vs%20OD.png" style="width: 700px; height: 372px;" /></p>
  
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14px;"><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;">Figure 1. Our attempt to validate the Imperial College 2008 teams OD too CFU measurements. It is clear that the R</span><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: super;">2</span><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;"> value is not close optimal.</span></span></p>
+
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14px;"><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;">Figure 12. Our attempt to validate the Imperial College 2008 teams OD too CFU measurements. It is clear that the R</span><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: super;">2</span><span style="font-family: Arial; color: rgb(0, 0, 0); background-color: transparent; font-weight: 400; font-style: normal; font-variant: normal; text-decoration: none; vertical-align: baseline;"> value is not close optimal.</span></span></p>
  
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;">&nbsp;</p>
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;">&nbsp;</p>
Line 621: Line 1,135:
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span></p>
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span></p>
  
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">As can be seen from the figure 1 shown above our data could not validate the equation completely. Though our data trends towards Imperials 2008s equation</span><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">.</span></p>
+
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;"><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">As can be seen from the figure 8&nbsp;shown above our data could not validate the equation completely. Though our data trends towards Imperials 2008s equation</span><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;">.</span></p>
  
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;">&nbsp;</p>
 
<p dir="ltr" style="line-height:1.38;margin-top:0pt;margin-bottom:0pt;">&nbsp;</p>
Line 655: Line 1,169:
 
<p><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span></p>
 
<p><span style="font-size:14.666666666666666px;font-family:Arial;color:#000000;background-color:transparent;font-weight:400;font-style:normal;font-variant:normal;text-decoration:none;vertical-align:baseline;"> </span></p>
  
 +
       
 
     </div>
 
     </div>
 +
   
 
   </div>
 
   </div>
 
</div>
 
</div>
+
   
+
       
 
<div id="References">
 
<div id="References">
 
   <div class="container">
 
   <div class="container">
 +
 
 
     <div class="row col-md-12">
 
     <div class="row col-md-12">
 
       <h1>
 
       <h1>
 
         References
 
         References
 
       </h1>
 
       </h1>
      <ol>
 
 
          
 
          
          <li>Carr, P. A., Wang, H. H., Sterling, B., Isaacs, F. J., Lajoie, M. J., Xu, G., … Jacobson, J. M. (2012). Enhanced multiplex genome engineering through co-operative oligonucleotide co-selection. Nucleic Acids Research, 40(17). doi:10.1093/nar/gks455</li>
+
<ol>
       
+
   
          <li>Sun, Z., Deng, A., Hu, T., Wu, J., Sun, Q., Bai, H., … Wen, T. (2015). A high-efficiency recombineering system with PCR-based ssDNA in Bacillus subtilis mediated by the native phage recombinase GP35. Applied Microbiology and Biotechnology, 99(12), 5151–5162. <a href="http://dx.doi.org/10.1007/s00253-015-6485-5" target="_blank">doi:10.1007/s00253-015-6485-5</a></li>
+
  <li>Acquisition of Certain Streptomycin-Resistant (str) Mutations Enhances Antibiotic Production in Bacteria, YOSHIKO HOSOYA,1 SUSUMU OKAMOTO,1 HIDEYUKI MURAMATSU,2 AND KOZO OCHI, National Food Research Institute,1 and Exploratory Research Laboratories, Fujisawa Pharmaceutical Co.,2 Tsukuba, Ibaraki, Japan</li>
       
+
   
          <li>Ginetti, F., Perego, M., Albertini, A. M., &amp; Galizzi, A. (1996). Bacillus subtilis mutS mutL operon: Identification, nucleotide sequence and mutagenesis. Microbiology, 142(8), 2021–2029. doi:10.1099/13500872-142-8-2021</li>
+
  <li>Carr, P. A., Wang, H. H., Sterling, B., Isaacs, F. J., Lajoie, M. J., Xu, G., … Jacobson, J. M. (2012). Enhanced multiplex genome engineering through co-operative oligonucleotide co-selection. Nucleic Acids Research, 40(17), e132–e132. <a href="http://dx.doi.org/10.1093/nar/gks455" target="_blank">doi:10.1093/nar/gks455</a></li>
       
+
   
          <li>Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R., & Church, G. M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894–898. <a href="http://dx.doi.org/10.1038/nature08187" target="_blank">doi:10.1038/nature08187</a></li>
+
  <li>Sun, Z., Deng, A., Hu, T., Wu, J., Sun, Q., Bai, H., … Wen, T. (2015). A high-efficiency recombineering system with PCR-based ssDNA in Bacillus subtilis mediated by the native phage recombinase GP35. Applied Microbiology and Biotechnology, 99(12), 5151–5162. <a href="http://dx.doi.org/10.1007/s00253-015-6485-5" target="_blank">doi:10.1007/s00253-015-6485-5</a></li>
       
+
   
      </ol>
+
  <li>Ginetti, F., Perego, M., Albertini, A. M., & Galizzi, A. (1996). Bacillus subtilis mutS mutL operon: identification, nucleotide sequence and mutagenesis. Microbiology, 142(8), 2021–2029. <a href="http://dx.doi.org/10.1099/13500872-142-8-2021" target="_blank">doi:10.1099/13500872-142-8-2021</a></li>
 +
   
 +
  <li>Bonde, M. T., Klausen, M. S., Anderson, M. V., Wallin, A. I. N., Wang, H. H., & Sommer, M. O. A. (2014). MODEST: a web-based design tool for oligonucleotide-mediated genome engineering and recombineering. Nucleic Acids Research, 42(W1), W408–W415. <a href="http://dx.doi.org/10.1093/nar/gku428" target="_blank">doi:10.1093/nar/gku428</a></li>
 +
   
 +
  <li>Dong, H., & Zhang, D. (2014). Current development in genetic engineering strategies of Bacillus species. Microbial Cell Factories, 13(1), 63. <a href="http://dx.doi.org/10.1186/1475-2859-13-63" target="_blank">doi:10.1186/1475-2859-13-63</a></li>
 +
   
 +
  <li>Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R., & Church, G. M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894–898. <a href="http://dx.doi.org/10.1038/nature08187" target="_blank">doi:10.1038/nature08187</a></li>
 +
   
 +
  <li>Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8</li>
 +
   
 +
  <li>Drug Development Research July - August 2000, Volume 50, Issue 3-4 Pages 203–583, Issue edited by: David Gurwitz</li>
 +
   
 +
  <li>Koglin, A., Löhr, F., Bernhard, F., Rogov, V. V., Frueh, D. P., Strieter, E. R., … Dötsch, V. (2008). Structural basis for the selectivity of the external thioesterase of the surfactin synthetase. Nature, 454(7206), 907–911. <a href="http://dx.doi.org/10.1038/nature07161" target="_blank">doi:10.1038/nature07161</a></li>
 +
   
 +
</ol>
 +
 
 
     </div>
 
     </div>
 +
   
 
   </div>
 
   </div>
 
</div>
 
</div>
+
   
     <div class="container">
+
      
 +
<footer class="container">
 
       <div class="row">
 
       <div class="row">
 
         <div class="col-md-2 col-md-offset-2">
 
         <div class="col-md-2 col-md-offset-2">
 
           <a href="http://www.dtu.dk" target="_blank">
 
           <a href="http://www.dtu.dk" target="_blank">
             <img src="/wiki/images/b/b7/DTU-Denmark_dtulogo.png" height="130px">
+
             <img src="https://static.igem.org/mediawiki/2015/b/b7/DTU-Denmark_dtulogo.png" height="130px">
 
           </a>
 
           </a>
 
         </div>
 
         </div>
Line 701: Line 1,234:
 
         <div class="col-md-2">
 
         <div class="col-md-2">
 
           <a href="https://igem.org" style="float:left" target="_blank">
 
           <a href="https://igem.org" style="float:left" target="_blank">
               <img src="/wiki/images/a/af/DTU-Denmark_igemlogo.png" height="90px">
+
               <img src="https://static.igem.org/mediawiki/2015/a/af/DTU-Denmark_igemlogo.png" height="90px">
 
           </a>
 
           </a>
 
         </div>
 
         </div>
 
       </div>
 
       </div>
     </div>
+
     </footer>
 
     <div class="sponsors">
 
     <div class="sponsors">
       <div class="container-fluid">
+
       <div class="container">
 
         <div class="row">
 
         <div class="row">
 
            
 
            
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://www.lundbeckfonden.com/" target="_blank">
 
             <a href="http://www.lundbeckfonden.com/" target="_blank">
               <img src="/wiki/images/e/e2/DTU-Denmark_Lundbeckfonden.jpg">
+
               <img src="https://static.igem.org/mediawiki/2015/e/e2/DTU-Denmark_Lundbeckfonden.jpg">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 718: Line 1,251:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://www.ottomoensted.dk" target="_blank">
 
             <a href="http://www.ottomoensted.dk" target="_blank">
               <img src="/wiki/images/3/35/DTU-Denmark_Ottomoensted.png">
+
               <img src="https://static.igem.org/mediawiki/2015/3/35/DTU-Denmark_Ottomoensted.png">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 724: Line 1,257:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://www.novonordiskfonden.dk/en" target="_blank">
 
             <a href="http://www.novonordiskfonden.dk/en" target="_blank">
               <img src="/wiki/images/5/5c/DTU-Denmark_NovoNordiskFonden_logo.png">
+
               <img src="https://static.igem.org/mediawiki/2015/5/5c/DTU-Denmark_NovoNordiskFonden_logo.png">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 730: Line 1,263:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="https://dk.vwr.com/" target="_blank">
 
             <a href="https://dk.vwr.com/" target="_blank">
               <img src="/wiki/images/e/ea/DTU-Denmark_VWR.jpg">
+
               <img src="https://static.igem.org/mediawiki/2015/e/ea/DTU-Denmark_VWR.jpg">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 736: Line 1,269:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://frisenette.dk" target="_blank">
 
             <a href="http://frisenette.dk" target="_blank">
               <img src="/wiki/images/c/c8/DTU-Denmark_Frisenette.jpg">
+
               <img src="https://static.igem.org/mediawiki/2015/c/c8/DTU-Denmark_Frisenette.jpg">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 742: Line 1,275:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://www.in-vitro.dk/" target="_blank">
 
             <a href="http://www.in-vitro.dk/" target="_blank">
               <img src="/wiki/images/7/7c/DTU-Denmark_In_Vitro.jpg">
+
               <img src="https://static.igem.org/mediawiki/2015/7/7c/DTU-Denmark_In_Vitro.jpg">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 748: Line 1,281:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="https://dk.fishersci.com/dk/" target="_blank">
 
             <a href="https://dk.fishersci.com/dk/" target="_blank">
               <img src="/wiki/images/b/b4/DTU-Denmark_Fisher_Scientific.jpg">
+
               <img src="https://static.igem.org/mediawiki/2015/b/b4/DTU-Denmark_Fisher_Scientific.jpg">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 754: Line 1,287:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://us.akg.com/akg-homepage-us.html" target="_blank">
 
             <a href="http://us.akg.com/akg-homepage-us.html" target="_blank">
               <img src="/wiki/images/9/9d/DTU-Denmark_AKG.png">
+
               <img src="https://static.igem.org/mediawiki/2015/9/9d/DTU-Denmark_AKG.png">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 760: Line 1,293:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://www.macrogen.com/" target="_blank">
 
             <a href="http://www.macrogen.com/" target="_blank">
               <img src="/wiki/images/1/11/DTU-Denmark_Marcogen.jpg">
+
               <img src="https://static.igem.org/mediawiki/2015/1/11/DTU-Denmark_Marcogen.jpg">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 766: Line 1,299:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="http://www.snapgene.com/" target="_blank">
 
             <a href="http://www.snapgene.com/" target="_blank">
               <img src="/wiki/images/5/58/DTU-Denmark_Snapgene.png">
+
               <img src="https://static.igem.org/mediawiki/2015/5/58/DTU-Denmark_Snapgene.png">
 
             </a>
 
             </a>
 
           </div>
 
           </div>
Line 772: Line 1,305:
 
           <div class="sponsorlogo">
 
           <div class="sponsorlogo">
 
             <a href="https://www.neb.com/" target="_blank">
 
             <a href="https://www.neb.com/" target="_blank">
               <img src="/wiki/images/e/e0/DTU-Denmark_NEB_logo.png">
+
               <img src="https://static.igem.org/mediawiki/2015/e/e0/DTU-Denmark_NEB_logo.png">
 
             </a>
 
             </a>
 
           </div>
 
           </div>

Latest revision as of 15:12, 9 November 2015

Abstract

We showed indications that we made a  MAGE competent strains of B. subtilis 168, in which we were able to introduce mutations using oligos. For a proof of concept three different approaches were tried, but only the last method turned out to be useful. In this approach, we took advantage of a point mutation in the ribosome of B. subtilis 168 which provides the strain streptomycin resistant. We were not able generate a sufficient amount of data to significantly proof our results. Experiments were carried out to optimize MAGE in B. subtilis 168, but these result were inconclusive. In spite of the unclear results, we decided to continue to see if we would be able to change the specificity of a NRPS module. We did get vague data suggesting that we were able to change the product of the native B. subtilis 168 nonribosomal peptide (NRP) - surfactin. Due to time constrains the strain was not sequence this mutant, so the successful substitution in surfactin is not confirmed.

MAGE competent B. subtilis strains

Overview

Compared to E. coli, the B. subtilis has more native NRPS’, therefore it has more NRP precursors natively available. Proof and optimization of MAGE in B. subtilis would be valuable knowledge for developing novel NRPS’. To proof the concept of MAGE in B. subtilis we designed oligos that could introduce a point mutation in the s12 subunit of the ribosome, inducing streptomycin resistance [1]. In order for MAGE (Multiplex Automated Genome Engineering) to work at a high efficiency, a strain with inserted recombinase and inhibited or knocked out mismatch repair gene has to be used [2]. In our project, two different recombinases were used: a recombination protein Beta from the E. coli phage Lambda, which was codon optimized for B. subtilis 168, and GP35, a recombinase from the B.subtilis phage SPP1 [3]. The mismatch repair proteins known as MutS and MutL were knocked out by transforming pSB1C3_recombinase plasmid into the B. subtilis W168. Since the MutL protein is dependent on the binding of MutS, the knockout of the mutS disables the function of the MutL protein [4].

Four Bacillus subtilis strains which expressed a recombinase were created by genetically engineering the wild type strain 168:

  • ∆amyE::beta-neoR
  • ∆amyE::GP35-neoR
  • ∆mutS::beta-neoR
  • ∆mutS::GP35-neoR

The growth of all the mutants was compared to the wild type to test for growth bias. The growth of ∆mutS::GP35-neoR, ∆amyE::beta-neoR and ∆amyE::GP35-neoR was shown to be faster growing than the wild type strain.

 

Achievements

  • We made the following four B. subtilis strains
    • ∆amyE::beta-neoR
    • ∆amyE::GP35-neoR
    • ∆mutS::beta-neoR
    • ∆mutS::GP35-neoR

 

Methods

All the strain were made by homologous recombineering. For this purpose four different plasmids were assembled. Two plasmids contained homologous regions to up- and downstream of mutS and two plasmids containing homologous regions to the amyE locus. Thus, the plasmids are able to do a double-crossover into the genome of B. subtilis 168 deleting the CDS of mutS or amyE from the genome. These regions were enclosing a neomycin resistance cassette carrying its own promoter, RBS and terminator (the exact position of these are unknown to us). Besides the neomycin resistance cassette, the mutS homologous regions were enclosing an expression cassette for a recombinase. Two different recombinases, GP35 and beta, were used resulting in two plasmids. The content of the expression cassette is shown in the following table.

 

Feature

Name

Obtained form

Promoter

BBa_k823002

iGEM part registry 

RBS

 

Optimized for the recombinase CDS using the RBS calculator provided by https://salislab.net/software/

CDS

Beta or GP35

See below

Terminator

BBa_B0014

iGEM part registry

Tabel 1. The general structure of the recombinase expression cassette.

 

Beta Protein

The sequence was obtained from GenBank (Id: KT232076.1), since this sequence is from an E. coli phage the sequence was codon optimized for B. subtilis 168 avoiding the restriction sites suggested by the iGEM REF10 standards. A TAA stop codon was added at the end  of the CDS.

 

GP35

As in Sun2015 this sequence was obtained from the genome of the Bacillus phage SPP1 (NCBI: NC_004166.2)[3]. The CDS for “gene 35” is from basepair 32175 to basepair 33038 in the genome of SPP1. The only alteration done to this CDS was that the native TAG stop codon was changed to two TAA stop codons because of iGEM preferences.

FOr each of the two recombinases a DNA sequence containing promoter, RBS, CDS and terminator flacked by homologous regions to amyE integration plasmids pDG268neo for B. subtilis was designed. Each of these two sequences was splitted to two sequences with 20bp of overlapping sequence and ordered as four gblocks from IDT.

 

Cloning

The two correlated gblocks were cloned into pDG268neo using gibson assembly and transformed into E. coli - resulting in pDG268neo_beta and pDG268_GP35. The insert of the correct sequence were verified by sequencing.

 

Figure 1. Representation of the inserted plasmid pDG268neo_recombinase. The plasmid exists with each of the recombinase proteins CDSs (Beta and GP35). They also have different RBSs since they are optimized for the CDS. The neoR cassette contains a promoter and RBS and a terminator, but sequences and positions of these features are not known.

 

These two plasmids were transformed into B. subtilis 168 using natural competence and transformants was verified using colony PCR. Resulting in the following two strains:

  • ∆amyE::beta-neoR
  • ∆amyE::GP35-neoR

For the construction of the remaining two strains, a DNA fragment containing the neoR cassette and the recombinase expression cassette was amplified by PCR from pDG268neo_beta and pDG268neo_GP35. This was carried out by primers with homologous tails for a mutS upstream fragment in one side and for a mutS downstream fragment in the other side. Appropriate mutS up- and downstream fragments were amplified from the B. subtilis genome, using a cPCR approach. This PCR was carried out by primers that contained tails homologous to the biobrick suffix and the biobrick prefix. The biobrick backbone was amplified from BBa_J04450, with primers that amplifies from the biobrick prefix to the biobrick suffix. Thus, the four fragments: recombinase-neoR, mutS upstream, mutS downstream and the linearized pSB1C3 could be assembled using gibson assembly into two different plasmids: pSB1C3_beta-neoR and pSB1C3_GP35-neoR, see Figure 2.

Figure 2. Representation of the inserted plasmids pSB1C3_recombinase after the inital insertion of the plasmid pDG268neo_recombinase. The plasmid exists with each of the recombinase proteins CDSs (Beta and GP35), They also have different RBSs since they are optimized for the CDS and the neoR cassette contains a promoter and RBS and a terminator, but sequences and positions of these features are not known.

 

The two plasmids were linearized by XhoI cutting out the cmR from the pSB1C3 backbone. Using natural competence the two linearized plasmids were transformed into B. subtilis 168. Inserts were verified by cPCR. Resulting in the last two strains:

  • ∆mutS::beta-neoR
  • ∆mutS::GP35-neoR

 

Growth Experiment

The protocol was followed for creation of MAGE competent Bacillus. The growth of the wild type B. subtilis 168 and all mutants was measured using OD600 measurements. 

 

Results and Conclusion

Construction of MAGE competent strains

For results on the construction of the four MAGE competent strains take a look in our lab-notebook.

 

Figure 3. Generation time of the different mutants measure in minutes.

The different mutants were compared to the wild type. From figure 3 it is clear that the generation time of the mutS::GP35 and the amyE mutants showed to be faster growing than the wild type. The mutS::beta was shown to be slower growing than the wild type, this mutant is the one that is best at recombineering. It is possible that the problem is the high constitutive expression of the beta protein in the cell that interferes with the growth of the cell. This could be solved by using an inducible promoter.

 

Proof of concept of MAGE in B. subtilis

Overview

To establish proof-the-concept of MAGE in B. subtilis 168 several methods were tested, but only one method turned out to be useable. The methods used for proofing MAGE in B. subtilis were as following:

  1. Knockout of upp
  2. Knockout of amyE
  3. Introducing streptomycin resistance

The ideal method was established to be the introduction of streptomycin resistance, allowing indication of successful oligo induced changes in the genome of B. subtilis.

 

Achievements

  • Indications suggest a successful introduction of MAGE in B. subtilis.
  • Indications identifies the beta-protein to be more efficient, than the GP35.

Methods

The MODEST program was used to design oligos for the experiments[5]. The oligo was designed to introduce a point mutation in the 12S subunit in the ribosome of B. subtilis 168, introducing streptomycin resistance [1]. Thus, it allows the selection of mutants growing on streptomycin. The four engineered strains and the wild type of B. subtilis 168 were prepared electroporation competent and electroporated with the oligo. The recovering bacteria was diluted and spread onto LB plates and incubated overnight. Single colonies were screened for streptomycin resistance by streaking them onto both LB and LB + streptomycin and following replicaplated.

 

To test MAGE compliance, an attempt was made to knockout the amyE and upp gens in B. subtilis by using oligoes to incorporate three stop codons in the coding sequences. Both upp and amyE selection showed to be unable to yield conclusive results.

Theory

amyE is a gene in B. subtilis coding for a amylase protein that can degrade starch. Starch can be colored by an iodine in an ethanol solution and amylase activity is seen by a formed clearing zone due to the degraded starch.

Knocking out the upp gene is a common method for counter selection and the knockout prevents the cell to retrieve pyrimidine’s from the media. upp+ cells growing on minimal media with the pyrimidine analog 5-FU and without any pyrimidine’s, would accumulate toxins derived form 5-FU causing the cells to die. The screening allows the cells that have an inactivated upp gene to persist as the toxin is not accumulated [6]. 

Method

Knockout was attempted using the oligoes shown in Table 1. The oligoes were designed using the program MODEST. The oligo was designed with three point mutations resulting in stop codons in the sequence of the genes.

Name

Oligos

Length

point mutation

position

mage_amyE-1

AAGTAACGGTTGCCAATTTGATACGATGTCGGCTGATACAGtCAtTACtAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACT

90

45-53

mage_upp-1

GGGTAATTTCAAATGCCATGAGTGTAGCCACTTCATCTACTtACTaTCaAAAATCCTTCGTACCTGTATTTTCATTCCGTATATATGTCA

90

44-52

Table 2. The oligoes used for knockout attempt of amyE and upp.

B. subtilis strain 168 with GP35 or lambda beta inserted in amyE or mutS knockouts were made electrocompetent using protocol found hereamyE and upp were electroporated with the oligoes shown in Table 1. The cells were electroporated at 2.0kV using 0.2cm cuvettes. Prior to the screening the electroporated cells were grown over night on 5y neomycin + LB agar plates, and following restreaked to respectively screening media, e.i.  5y neomycin + 1% starch + LB for or minimal media with 25uM 5-FU using the minimal media protocol

 

Results

The amyE screening proved to be insuficient to produce clear results and therefore this selection was abandoned. The 5-FU plates were incubated for three days before colonies were visible. To confirm that strain could grow on 5-FU, the colonies were restreacked onto new 5-FU plates. The bacteria could not grow after four days of incubation.

The methodshowed to be inadequate to prove the MAGE method in Bacillus.

 

Results      

MAGE proof of concept

To screen for the introduced streptomycin resistance single colonies were colony picked onto both LB and LB + streptomycin. The CFUs on the different plates are listed in the Table 2 below and plates shown in Figure 1. Unfortunately, the data for the two amyE strains got lost.

 

 

CFUs on LB

CFUs on 500y streptomycin

Frequency

∆mutS::beta-neoR

52

7

0,13

∆mutS::GP35-neoR

100

1

0,01

WT

100

0

0

Table 3. Listing of CFUs in both the selective and non-selective streptomycin resistance plates and their calculated frequency.

 

Figure 4. The pictures show the colonies that was able to grow on 500y streptomycin after electroporation of the oligo. To the left is ∆mutS::beta-neoR and to the right is ∆mutS::GP35-neoR. It is a typo that the plates say “spec” and not “strep” on the plates.

 

The screened mutant was verified by “stamp replicating” the plates with the mutants.

Figure 5.  Stamp replications of the streptomycin resistant mutant. To the left is ∆mutS::beta-neoR and to the right is ∆mutS::GP35-neoR. It is a typo that the plates say “spec” and not “strep”.

 

Discussion

It was established that streptomycin resistance as screening method did not provide sufficient data. The main issue was to quantify the actual mutants and separate them from spontaneous mutants. Time restrains limited the option of sequencing any of the mutants to verify the insertions. Experiments could be replicated to support the data. If the experimental data is accurate, the findings suggest the beta protein to be more efficient than the GP35, contradicts Sun et al. 2015, but we hypothesis that this could be due to the shorter oligos used compared to theirs[3]. Other reasons could be that GP35 is dependent on other gene products from the SPP1 phage such as GP34 or GP33, but this has not been confirmed.

Optimization of MAGE in B. subtilis

Overview

Different experiments were made to optimize the MAGE procedure. Three different experiments were conducted, to test the right amount and length of the oligos. additionally the mismatch frequency was attempted to be quantified. In our experiments the optimal length was shown to be 80nt which correlates with the expected 90nt. Optimal amount of oligo was showed to be 5uM, which also fits with the expectations. Interestingly the number of mismatches with the highest transformation rate was 5 mismatches, this is unexpected. Using streptomycin oligoes seemed to have a high systematic error.

 

Background

We ran different optimization experiments to test if recombineering in B. subtilis could be optimized in the same way as for E. coli. For E. coli the optimal amount of oligo is 5µM [2].  with a legnth of 90nt [7]. The mismatch frequency of E. coli could be fitted by a binomial distribution.

 

Experimental design

Using the dilution equation and the functional MAGE method, different experiments were run to optimize the efficiency of MAGE in Bacillus.

The three analyzed factors includes:
amount of oligo used, the length of the oligos, and the number of base pair mismatches inserted into the oligo.

 

Achievements

  • Characterized the insertion frequency of mismatches in the genome of B. subtilis.
  • Characterized the insertion frequency of oligoes with different length in the genome of B. subtilis.
  • The an estimate of the optimal amount of oligo was found.

 

Methods

All three experiments followed the "MAGE in Bacillus subtilis 168" protocol. The oligo we used is shown below introducing streptomycin resistance with one mismatch.

oligo name sequence length
B_Sub_Mods0007.1mutationrpsL 

GAAGTGCTGAGTTCGGTTTgttCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT

 90

 

The amount  of oligo was varied between 0.05 - 6.25uM.

In the mismatch frequency experiment, six oligos with 1-6 mismatches individually was created to be inserted.

name Sequence Length
rpsL 1mm G*A*AGTGCTGAGTTCGGTTTTCTCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT 90
rpsL 2mm G*A*AGTGCTGAGTTCGGTTTCCTCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCTT 90
rpsL 3mm C*G*AAGTGCTGAGTTCGGTTTCCGCGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATACGTTAGTGTGCTCT 90
rpsL 4mm C*A*AACGAACACGAGCATATTTACGAAGTGCTGAGTTCGGTTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGG 90
rpsL 5mm A*C*GAGCATATTTACGAAGTGCTGAGTTCGGCTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTGTGGAGAAGATAC 90
rpsL 6mm A*G*TCAAACGAACACGAGCATATTTACGAAGTGCTGAGTTTGGCTTCCGTGGTGTCATTGTACCAACACGAGTACATACCCCGCGTTTTTG 90

 

For the varying of length ssDNA from 50-100nt was used with one mismatch.

In all experiment single colonies were taken from appropriate dilutions and colony picked onto 500ɣ strep. plates. Number colonies that was growing on colony picked strep plates was counted. The transformation efficiency was calculated as the ratio between re-streaked colonies growing on LB and on 500ɣ strep.

 

Results

The transformation frequency varies from 18-50% in the oligo amount experiment, this seems to be a too high number when comparing to earlier results, and the standard transformation frequency for MAGE in E. coli. The data seems to suggest that the optimal oligo amount for transformation is 5 uM. This correlates with the optimal amount for E coli [7]. The Figure 4 below shows the transformation frequency for the oligo amount experiment. The oligo length data shown in Figure 5 seems to suggest that the optimal oligo length is 80nt this correlates well with the the optimal length for E coli being 90nt.

Figure 6. the efficacy of oligo amount versus transformation rate 

 

Figure 7. Shows the transformation frequency of oligo length.

 

Figure 8 Shows transformation frequency of with extra mismatches from 1-6.

 

The Figure 8 above shows the transformation frequency for mismatch insertion. This results does not correlate with the assumption that the lower the amount of mismatches the higher the transformation rate. Here the opposite is shown. This can be do to the high uncertainty in using streptomycin resistance. because of this the frequency pr. mismatch was not calculated.

 

The three figures shown above varies greatly. It is possible that the cells were not optimally electro competent. These experiment need to be redone to define if the experimental setup is incorrect or if some other variation is in play.

 

Selection of the colonies was difficult because of possible background from spontaneous mutants that became visible after 2 days and the risk of adding too much cell mass onto the plate when colony picking, this could be mistaken as a growing colony.

 

The results will need to be validated preferably using another screening method, since false positives seems to be an issue when using streptomycin as selection marker. It could be suggested to use a GFP with a inserted stop codon in the genome. The MAGE protocol could then be optimized for making knockins, this could be screened by using flow cytometry.

 

Conclusion

The experiments indicate that 5bp mismatches with a length of 80nt and using 5uM of oligo would optimize the MAGE method in Bacillus. The data is of pure quality and nothing certain can be concluded from this experiment. 

 

Multiple Bacillus MAGE cycles

 

Background

A great strength of the  MAGE method is that it can be iterated until the amount of cells with the wanted change is high [7]. We wanted to test if this also is the case in B. subtilis. Our experiments suggest that the this might be the case.

Experimental design

We hypothesized that if the MAGE protocol was repeated multiple times, the amount of transformants would rise. This was tested by running four cycles of the MAGE protocol. The progress could be followed by plating a dilution of the sample on streptomycin plates after every round and calculating the start value of the culture from the OD600 measurements. It was necessary to colony pick onto streptomycin plates, which gave usable results.

Achievements

  • Identified that colony picking is a insufficient method to quantifying MAGE frequency.
  • Showed that the knockout of mutS has a significant effect on the transformation frequency
  • developing a procedure for repeating MAGE in Bacillus

Materials

The protocol specially made for this procedure was followed. This protocol takes approximately 6 hours for every cycle. Four cycles was run.

 

Results

We had problems with finding the optimal dilutions. This cause a lack of data for some of the samples, new cells were re-plated from the glycerol stock of the differed MAGE cycles, but the same problem was encounted again.  There was a high variation in the amounts of transformants on the plates. We recommend to use the OD calculator for making an approximation of the correct dilution factor.

 

Figure 9. The frequency for the insertion of the streptomycin phenotype can be seen for the samples.

It seems that mutS::beta is better than the wild type, mutS::GP35 and amyE::GP35. The experiment indicates that many MAGE cycles gives a higher yield than a single cycle, but the data is inconsistent when looking at Figure 4. The experiment will need to be run with a better method of testing if the insertion has been incorporated into the genome.

Surfactin

Overview

To test if the MAGE method could be used to change the affinity of the A domain in a NRPS. The A domain in the 5th module of the synthase producing surfactin was changed and results were verified using using MALDI-TOF. Results indicate that the desired change was incorporated. The production efficiency of the bacteria was strongly reduced.

 

Achievements

  • showed that the MAGE method can be used to change the specificity of a A domain in the surfactine synthase

 

Experimental design

Surfactin is a surfactant cyclic lipopeptide produced by Bacillus subtilis important for sporulation in B. subtilis[8] and is used as an antibiotic[9]. The cyclic peptide of surfactin is produced by a nonribosomal peptide synthase (NRPS). AntiSMASH prediction of adenylation domain specificity corresponds to surfactant. The NRPS modules are divided out on three contigs (ctg1_354-5) with 3, 3, and 1 module, respectively as shown in figure 1

 

Figure 10. Picture of surfactine synthase [10] 

Figure 11. Picture of surfactin

The fifth module of surfactin synthetase is responsible for incorporation of aspartic acid. Using the Stachelhaus code the fewest changes on nucleotide level that would lead to a change in amino acid is Asp->Asn. Two different oligos with either a change or no change in wobble position of the Stachelhaus code and with different length were designed (Table 1), yielding different number of mismatches in the oligo.

Table 4 List of oligos used to modify surfactin NRPS.

 oligo name sequence LengthMutation(Stacelhaus)

length

Oligo_surf_

Asp->Asn_1_l

C*A*TACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCTGTCGGGCCGTACTCATTGA

TAAATTCGGTATGTCCATACATCTTAC

H322E, I330S 200
oligo_surf asp->Asn_2_I

T*T*CGCAAATGCATCCGGCTCATACAGATCAACCCGCCCGGCGATGGCGCCGACCGTTGCTTCT

GTCGGGCCGTACTCATTGATAAATTCGGTATGTCCATACATCTTACGGAAGGCGATAACATCAGTCGG

GATGATTTTTTCTCCTCCCAAGAGGATCAAGCGCAAGGATTCAAAGTTCGCATCTTTTGCAAAACTGGC

V299L, H322E, I330S  200

 

Methods

Electrocompetent B. subtilisΔmutS::beta-neoR or ΔmutS::GP35-neoR  mutation was used.  Three oligoes were used for this experiment. The two showed in table 1 was used separately, and the streptomycin resisters oligo called B_sub_Mods0007.1mutationrpsL was used to select for the desired change. 100uL of cells was mixed with 5uL of the surfactine changing oligo, and 0.5uL of the streptomycin resistance oligo was used in accordance with the protocol for electroporation.

 

Results

See surfactine part in Detection of NRP

Dilution Equation

Overview

The Imperial iGEM 2008 team has made an equation for calculating CFU from OD600. We tried to validate their equation by using our own data. Unfortunately the variation in our results was too high to validate their equation. Based on their results we made a calculator that could compute the optimal dilution for plating to get a countable number of colonies.

 

Method

All the LB plate counts that we have done in our project was gathered and analyzed for this experiment. the data that was used can be seen here.

 

Results

The Imperial College team  modulated following equation.

Imperial equation: Y= 2*108 *X

Y = CFU/mL

Figure 12. Our attempt to validate the Imperial College 2008 teams OD too CFU measurements. It is clear that the R2 value is not close optimal.

 

As can be seen from the figure 8 shown above our data could not validate the equation completely. Though our data trends towards Imperials 2008s equation.

 

Dilution predictor

An equation for predicting a dilutions that will result in a countable number of CFUs was made from the Imperial College equation. The equation assume that 100µl is plated on a LB plate. The optimal amount of colonies is set to 150CFU on each plate.

 

YCFU=2*XOD*108

Yoptimal=150CFU/plate. This number can be varied to fit the user's preference.

d is the optimal dilution factor for getting 150CFU/plate.  E.i. optimal dilution will be 10d.

\(Y_{optimal} = {{Y_{CFU} } \over {10^d* 10}}\)

\(Y_{optimal} = {{2*X_{OD}*10^8} \over {10^fd* 10}}\)

\(10^d= {{2*X_{OD}*10^8} \over {10*Y_{optimal}}}\)

\(d= log_{10}( {{2*X_{OD}*10^8} \over {10*Y_{optimal}}} ) , Y_{optimal}=150\)

\(d= log_{10}( {{2*X_{OD}*10^8} \over {10*150}} ) \)

\(d= log_{10}( {{1.33*X_{OD}*10^5} } ) \)

The formula has not been thoroughly test and the correlation between OD and CFU is low in for our data. Generally the formula overestimates dilution. Therefore we suggest that both 10d and 10d-1 are plated. A future solution to the problem could be to introduce a calibration constant to the right hand side of the equation. The constant can be fitted by rerunning the experiment with more samples.

References

  1. Acquisition of Certain Streptomycin-Resistant (str) Mutations Enhances Antibiotic Production in Bacteria, YOSHIKO HOSOYA,1 SUSUMU OKAMOTO,1 HIDEYUKI MURAMATSU,2 AND KOZO OCHI, National Food Research Institute,1 and Exploratory Research Laboratories, Fujisawa Pharmaceutical Co.,2 Tsukuba, Ibaraki, Japan
  2. Carr, P. A., Wang, H. H., Sterling, B., Isaacs, F. J., Lajoie, M. J., Xu, G., … Jacobson, J. M. (2012). Enhanced multiplex genome engineering through co-operative oligonucleotide co-selection. Nucleic Acids Research, 40(17), e132–e132. doi:10.1093/nar/gks455
  3. Sun, Z., Deng, A., Hu, T., Wu, J., Sun, Q., Bai, H., … Wen, T. (2015). A high-efficiency recombineering system with PCR-based ssDNA in Bacillus subtilis mediated by the native phage recombinase GP35. Applied Microbiology and Biotechnology, 99(12), 5151–5162. doi:10.1007/s00253-015-6485-5
  4. Ginetti, F., Perego, M., Albertini, A. M., & Galizzi, A. (1996). Bacillus subtilis mutS mutL operon: identification, nucleotide sequence and mutagenesis. Microbiology, 142(8), 2021–2029. doi:10.1099/13500872-142-8-2021
  5. Bonde, M. T., Klausen, M. S., Anderson, M. V., Wallin, A. I. N., Wang, H. H., & Sommer, M. O. A. (2014). MODEST: a web-based design tool for oligonucleotide-mediated genome engineering and recombineering. Nucleic Acids Research, 42(W1), W408–W415. doi:10.1093/nar/gku428
  6. Dong, H., & Zhang, D. (2014). Current development in genetic engineering strategies of Bacillus species. Microbial Cell Factories, 13(1), 63. doi:10.1186/1475-2859-13-63
  7. Wang, H. H., Isaacs, F. J., Carr, P. A., Sun, Z. Z., Xu, G., Forest, C. R., & Church, G. M. (2009). Programming cells by multiplex genome engineering and accelerated evolution. Nature, 460(7257), 894–898. doi:10.1038/nature08187
  8. Nakano MM, Magnuson R, Myers A, Curry J, Grossman AD, Zuber P. srfA is an operon required for surfactin production, competence development, and efficient sporulation in Bacillus subtilis. J Bacteriol. 1991 Mar;173(5):1770-8
  9. Drug Development Research July - August 2000, Volume 50, Issue 3-4 Pages 203–583, Issue edited by: David Gurwitz
  10. Koglin, A., Löhr, F., Bernhard, F., Rogov, V. V., Frueh, D. P., Strieter, E. R., … Dötsch, V. (2008). Structural basis for the selectivity of the external thioesterase of the surfactin synthetase. Nature, 454(7206), 907–911. doi:10.1038/nature07161
Technical University of Denmark
Department of Systems Biology
Søltofts Plads 221
2800 Kgs. Lyngby
Denmark
P: +45 45 25 25 25
M: dtu-igem-2015@googlegroups.com