Difference between revisions of "Team:Cork Ireland/Parts"

 
(16 intermediate revisions by 2 users not shown)
Line 135: Line 135:
 
#project {
 
#project {
 
background: white;
 
background: white;
width: 85%;
 
 
text-align: left;
 
text-align: left;
margin: 10%;
 
 
font-size: 1.2em;
 
font-size: 1.2em;
 
border-style: ridge;
 
border-style: ridge;
 +
        margin-top: 10%;
 +
}
 +
 +
#project figure {
 +
    text-align: center;
 
}
 
}
  
Line 247: Line 250:
 
list-style: none;
 
list-style: none;
 
border-style: solid;
 
border-style: solid;
border-color: black;
+
border-color: #444444;
background: #336600;
+
background: #3EDAAD;
 
font-size: 0.6em;
 
font-size: 0.6em;
 +
        border-radius: 5px;
 
}
 
}
  
 
#fixed_menu a, #fixed_menu2 a{
 
#fixed_menu a, #fixed_menu2 a{
 
text-decoration: none;
 
text-decoration: none;
color: white;
+
color: black;
  
 
}
 
}
  
 
#fixed_menu a:hover, #fixed_menu2 a:hover {
 
#fixed_menu a:hover, #fixed_menu2 a:hover {
color: yellow;
+
color: white;
 
}
 
}
  
Line 352: Line 356:
 
margin: 10px;
 
margin: 10px;
 
font-size: 1.2em;
 
font-size: 1.2em;
 +
}
 +
 +
#parts h2 {
 +
      font-size: 1.8em;
 +
      text-align: center;
 +
      color: #E02121;
 +
}
 +
 +
#parts div {
 +
      padding-top: 5%;
 +
      padding-bottom: 20px;
 +
}
 +
 +
#parts p {
 +
      font-size: 1.2em;
 +
}
 +
 +
#parts figure {
 +
      text-align:center;
 
}
 
}
  
Line 415: Line 438:
 
                 <img src="https://static.igem.org/mediawiki/2014/d/d7/Sysuchina_igemdeLogo.png" id="igem_logo"/>
 
                 <img src="https://static.igem.org/mediawiki/2014/d/d7/Sysuchina_igemdeLogo.png" id="igem_logo"/>
 
                 </a>
 
                 </a>
<img src="https://static.igem.org/mediawiki/2015/8/86/BasehunterBannerCork2015.png" alt="Pacman Basehunter" id="banner_pic"/>
+
<img src="https://static.igem.org/mediawiki/2015/a/a2/PartsCork.png" alt="Pacman Basehunter" id="banner_pic"/>
 
<nav>
 
<nav>
 
<ul>
 
<ul>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>
Line 437: Line 461:
 
</div>
 
</div>
 
<div id="main_col">
 
<div id="main_col">
+
<div id="parts">
<div id="project">
+
<div id="part1">
 
<h2>55bp HPV Detector (K1698001)</h2>
 
<h2>55bp HPV Detector (K1698001)</h2>
  
  
  
                         <p>Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAAAAGCTt
+
                         <p>Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAA
cagccattaggtgtgggcattagtggCACTGC</p>
+
AAGCTtcagccattaggtgtgggcattagtggCACTGC</p>
  
 
                         <figure>
 
                         <figure>
 
                         <img src="https://static.igem.org/mediawiki/2015/6/61/55bpDetectorCork.jpg" alt="Description goes here"/>
 
                         <img src="https://static.igem.org/mediawiki/2015/6/61/55bpDetectorCork.jpg" alt="Description goes here"/>
 
                         <figcaption>
 
                         <figcaption>
                        Caption goes here
 
 
                         </figcaption>
 
                         </figcaption>
 
                         </figure>
 
                         </figure>
Line 455: Line 478:
 
Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.</p>
 
Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.</p>
  
<p>For protocol for construction of detector by digestion of plasmid see HERE.
+
<p>For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.
  
 
The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length.
 
The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length.
  
The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see (STANDARDISATION OF RESULTS section)</p>
+
The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p>
<p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standsrd Parts.
+
<p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.
  
<p>For more information on how the detector plasmid worked see (RESULTS : DETECTORS)</p>
+
<p>For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p>
  
<p>Assessment of this detector parts selectivity may also be seen here (RESULTS : SELECTIVITY)
+
<p>Assessment of this detector parts selectivity may also be seen here <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.
 
</p>
 
</p>
  
 
                         <figure>
 
                         <figure>
                         <img src="Link goes here" alt="Description goes here"/>
+
                         <img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
 
 +
</div>
 +
 +
<div id="part2">
 +
<h2>62bp SRY (K1698002) </h2>
 +
 
 +
 
 +
 
 +
                        <p>Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTT
 +
ATGGGTACCAATAATAAAAGCTTGTGGTCC
 +
CGTGGTGAGAGGCACAAGTTGGCACTGC</p>
 +
 
 +
<p>Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome.
 +
 
 +
Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.</p>
 +
 
 +
<p>For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.<p/>
 +
 
 +
<p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts</p>
 +
 
 +
<p>For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.
 +
</p>
 +
 
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/7/7f/32bpSRYCork.JPG" alt="Description goes here"/>
 
                         <figcaption>
 
                         <figcaption>
                        Caption goes here
 
 
                         </figcaption>
 
                         </figcaption>
 
                         </figure>
 
                         </figure>
Line 478: Line 528:
 
 
  
</div>
+
<div id="part3">
 +
<h2>32bp SRY Detector (K1698003)</h2>
 +
 
 +
 
 +
 
 +
                        <p>Sequence: GCTCTTCAgttgcctcaacaaaactgGTACCAAT
 +
AATAAAAGCTtacaaccttctgcaCACTGC</p>
 +
 
 +
<p>
 +
Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome.
 +
 
 +
For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.
 +
 
 +
The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p>
 +
 
 +
<p>
 +
 
 +
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.</p>
 +
 
 +
<p>
 +
For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>. </p>
 +
 
 +
</p>
 +
 
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/1/1e/32bpSRYCorkiGEM.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
 
 +
</div>
 +
 
 +
<div id="part4">
 +
<h2>24bp TB Detector (K1698004)</h2>
 +
 
 +
 
 +
 
 +
                        <p>Sequence: GCTCTTCTCAGCCTTCCCGgtacctaa
 +
ttcggatcCGCTGGCTACCCCACTGC</p>
 +
 
 +
<p>
 +
Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome
 +
 
 +
For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.
 +
 
 +
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.<p>
 +
 
 +
For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.
 +
 
 +
</p>
 +
 
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
                        </div>
 +
 
 +
</div>
 
 
 
<div class="col">
 
<div class="col">
                <p></p>
+
<ul id="fixed_menu">
 +
<li>Quick Links:</li>
 +
<a href="#part1"><li>K1698001</li></a>
 +
<a href="#part2"><li>K1698002</li></a>
 +
                                <a href="#part3"><li>K1698003</li></a>
 +
                                <a href="#part4"><li>K1698004</li></a>
 +
</ul>
 
</div>
 
</div>
 
</div>
 
</div>
Line 491: Line 605:
 
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>
 
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>

Latest revision as of 15:28, 9 November 2015

Basehunter Home

Loading menubar.....

55bp HPV Detector (K1698001)

Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAA AAGCTtcagccattaggtgtgggcattagtggCACTGC

Description goes here

Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.

For protocol for construction of detector by digestion of plasmid see here. The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length. The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see here.

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see here.

Assessment of this detector parts selectivity may also be seen here here.

Description goes here

62bp SRY (K1698002)

Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTT ATGGGTACCAATAATAAAAGCTTGTGGTCC CGTGGTGAGAGGCACAAGTTGGCACTGC

Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.

For protocol for construction of detector by digestion of plasmid see here.

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts

For more information on how the detector plasmid worked see here.

Description goes here

32bp SRY Detector (K1698003)

Sequence: GCTCTTCAgttgcctcaacaaaactgGTACCAAT AATAAAAGCTtacaaccttctgcaCACTGC

Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome. For protocol for construction of detector by digestion of plasmid see here. The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see here.

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see here.

Description goes here

24bp TB Detector (K1698004)

Sequence: GCTCTTCTCAGCCTTCCCGgtacctaa ttcggatcCGCTGGCTACCCCACTGC

Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome For protocol for construction of detector by digestion of plasmid see here. The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see here.

Description goes here