Difference between revisions of "Team:Cork Ireland/Parts"
(11 intermediate revisions by 2 users not shown) | |||
Line 250: | Line 250: | ||
list-style: none; | list-style: none; | ||
border-style: solid; | border-style: solid; | ||
− | border-color: | + | border-color: #444444; |
− | background: # | + | background: #3EDAAD; |
font-size: 0.6em; | font-size: 0.6em; | ||
+ | border-radius: 5px; | ||
} | } | ||
#fixed_menu a, #fixed_menu2 a{ | #fixed_menu a, #fixed_menu2 a{ | ||
text-decoration: none; | text-decoration: none; | ||
− | color: | + | color: black; |
} | } | ||
#fixed_menu a:hover, #fixed_menu2 a:hover { | #fixed_menu a:hover, #fixed_menu2 a:hover { | ||
− | color: | + | color: white; |
} | } | ||
Line 355: | Line 356: | ||
margin: 10px; | margin: 10px; | ||
font-size: 1.2em; | font-size: 1.2em; | ||
+ | } | ||
+ | |||
+ | #parts h2 { | ||
+ | font-size: 1.8em; | ||
+ | text-align: center; | ||
+ | color: #E02121; | ||
+ | } | ||
+ | |||
+ | #parts div { | ||
+ | padding-top: 5%; | ||
+ | padding-bottom: 20px; | ||
+ | } | ||
+ | |||
+ | #parts p { | ||
+ | font-size: 1.2em; | ||
+ | } | ||
+ | |||
+ | #parts figure { | ||
+ | text-align:center; | ||
} | } | ||
Line 418: | Line 438: | ||
<img src="https://static.igem.org/mediawiki/2014/d/d7/Sysuchina_igemdeLogo.png" id="igem_logo"/> | <img src="https://static.igem.org/mediawiki/2014/d/d7/Sysuchina_igemdeLogo.png" id="igem_logo"/> | ||
</a> | </a> | ||
− | <img src="https://static.igem.org/mediawiki/2015/ | + | <img src="https://static.igem.org/mediawiki/2015/a/a2/PartsCork.png" alt="Pacman Basehunter" id="banner_pic"/> |
<nav> | <nav> | ||
<ul> | <ul> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a> | ||
+ | <a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a> | ||
Line 440: | Line 461: | ||
</div> | </div> | ||
<div id="main_col"> | <div id="main_col"> | ||
− | + | <div id="parts"> | |
− | <div id=" | + | <div id="part1"> |
<h2>55bp HPV Detector (K1698001)</h2> | <h2>55bp HPV Detector (K1698001)</h2> | ||
− | <p>Sequence: | + | <p>Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAA |
− | + | AAGCTtcagccattaggtgtgggcattagtggCACTGC</p> | |
<figure> | <figure> | ||
<img src="https://static.igem.org/mediawiki/2015/6/61/55bpDetectorCork.jpg" alt="Description goes here"/> | <img src="https://static.igem.org/mediawiki/2015/6/61/55bpDetectorCork.jpg" alt="Description goes here"/> | ||
<figcaption> | <figcaption> | ||
− | |||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
Line 458: | Line 478: | ||
Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.</p> | Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.</p> | ||
− | <p>For protocol for construction of detector by digestion of plasmid see | + | <p>For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>. |
The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length. | The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length. | ||
− | The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see | + | The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p> |
− | <p>The sequence of this part with K584001 biobrick part may be found on the Registry of | + | <p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts. |
− | <p>For more information on how the detector plasmid worked see | + | <p>For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p> |
− | <p>Assessment of this detector parts selectivity may also be seen here | + | <p>Assessment of this detector parts selectivity may also be seen here <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>. |
</p> | </p> | ||
Line 473: | Line 493: | ||
<img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/> | <img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/> | ||
<figcaption> | <figcaption> | ||
− | |||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
Line 479: | Line 498: | ||
</div> | </div> | ||
− | <div id=" | + | <div id="part2"> |
<h2>62bp SRY (K1698002) </h2> | <h2>62bp SRY (K1698002) </h2> | ||
− | <p>Sequence: | + | <p>Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTT |
− | + | ATGGGTACCAATAATAAAAGCTTGTGGTCC | |
+ | CGTGGTGAGAGGCACAAGTTGGCACTGC</p> | ||
<p>Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. | <p>Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. | ||
Line 491: | Line 511: | ||
Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.</p> | Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.</p> | ||
− | <p>For protocol for construction of detector by digestion of plasmid see | + | <p>For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.<p/> |
<p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts</p> | <p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts</p> | ||
− | <p>For more information on how the detector plasmid worked see | + | <p>For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>. |
− | + | ||
</p> | </p> | ||
Line 502: | Line 521: | ||
<img src="https://static.igem.org/mediawiki/2015/7/7f/32bpSRYCork.JPG" alt="Description goes here"/> | <img src="https://static.igem.org/mediawiki/2015/7/7f/32bpSRYCork.JPG" alt="Description goes here"/> | ||
<figcaption> | <figcaption> | ||
− | |||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
Line 510: | Line 528: | ||
− | <div id=" | + | <div id="part3"> |
<h2>32bp SRY Detector (K1698003)</h2> | <h2>32bp SRY Detector (K1698003)</h2> | ||
Line 521: | Line 539: | ||
Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome. | Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome. | ||
− | For protocol for construction of detector by digestion of plasmid see | + | For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>. |
− | The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see | + | The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p> |
<p> | <p> | ||
Line 530: | Line 548: | ||
<p> | <p> | ||
− | For more information on how the detector plasmid worked see | + | For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>. </p> |
</p> | </p> | ||
Line 537: | Line 555: | ||
<img src="https://static.igem.org/mediawiki/2015/1/1e/32bpSRYCorkiGEM.JPG" alt="Description goes here"/> | <img src="https://static.igem.org/mediawiki/2015/1/1e/32bpSRYCorkiGEM.JPG" alt="Description goes here"/> | ||
<figcaption> | <figcaption> | ||
− | |||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
Line 543: | Line 560: | ||
</div> | </div> | ||
− | <div id=" | + | <div id="part4"> |
<h2>24bp TB Detector (K1698004)</h2> | <h2>24bp TB Detector (K1698004)</h2> | ||
− | <p>Sequence: | + | <p>Sequence: GCTCTTCTCAGCCTTCCCGgtacctaa |
+ | ttcggatcCGCTGGCTACCCCACTGC</p> | ||
<p> | <p> | ||
Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome | Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome | ||
− | For protocol for construction of detector by digestion of plasmid see | + | For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>. |
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.<p> | The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.<p> | ||
− | For more information on how the detector plasmid worked see | + | For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>. |
</p> | </p> | ||
Line 564: | Line 582: | ||
<img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/> | <img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/> | ||
<figcaption> | <figcaption> | ||
− | |||
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
+ | </div> | ||
</div> | </div> | ||
<div class="col"> | <div class="col"> | ||
− | + | <ul id="fixed_menu"> | |
+ | <li>Quick Links:</li> | ||
+ | <a href="#part1"><li>K1698001</li></a> | ||
+ | <a href="#part2"><li>K1698002</li></a> | ||
+ | <a href="#part3"><li>K1698003</li></a> | ||
+ | <a href="#part4"><li>K1698004</li></a> | ||
+ | </ul> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 581: | Line 605: | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a> | ||
+ | <a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a> | ||
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a> | <a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a> |
Latest revision as of 15:28, 9 November 2015
55bp HPV Detector (K1698001)
Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAA AAGCTtcagccattaggtgtgggcattagtggCACTGC
Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.
For protocol for construction of detector by digestion of plasmid see here. The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length. The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see here.
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.
For more information on how the detector plasmid worked see here.
Assessment of this detector parts selectivity may also be seen here here.
62bp SRY (K1698002)
Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTT ATGGGTACCAATAATAAAAGCTTGTGGTCC CGTGGTGAGAGGCACAAGTTGGCACTGC
Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.
For protocol for construction of detector by digestion of plasmid see here.
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts
For more information on how the detector plasmid worked see here.
32bp SRY Detector (K1698003)
Sequence: GCTCTTCAgttgcctcaacaaaactgGTACCAAT AATAAAAGCTtacaaccttctgcaCACTGC
Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome. For protocol for construction of detector by digestion of plasmid see here. The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see here.
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.
For more information on how the detector plasmid worked see here.
24bp TB Detector (K1698004)
Sequence: GCTCTTCTCAGCCTTCCCGgtacctaa ttcggatcCGCTGGCTACCCCACTGC
Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome For protocol for construction of detector by digestion of plasmid see here. The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.
For more information on how the detector plasmid worked see here.