Difference between revisions of "Team:Cork Ireland/Parts"

(Prototype team page)
 
 
(19 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
{{Cork_Ireland}}
 
{{Cork_Ireland}}
 
<html>
 
<html>
 +
<head>
 +
      <title>Basehunter Home</title>
 +
</head>
  
−
<h2> Part Documentation</h2>
+
<style>
 +
/*
 +
* Basic structure removed
 +
*/
  
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
+
.firstHeading{
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
+
  display: none;
 +
}
  
 +
#globalWrapper, #content{
 +
  width: 100%;
 +
  border: 0px;
 +
  position: relative;
 +
  padding:0;
 +
  margin-bottom:0;
 +
}
  
−
<div class="highlightBox">
+
#menuContainer{
−
<h4>Note</h4>
+
display: none;
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
+
}
−
</div>
+
  
 +
body {
 +
font-family: Arial, Verdana, sans-serif;
 +
        margin: 0;
 +
        padding: 0;
 +
}
 +
 +
header {
 +
        padding: 15px 15px 10px; 15px;
 +
background: #444444;
 +
        border-radius: 5px;
 +
        margin: 0;
 +
}
  
 +
header h1 {
 +
margin: 0;
 +
display: inline;
 +
color: white;
 +
font-size: 2em;
 +
}
 +
header img {
 +
float: left;
 +
}
  
−
<h4>Adding parts to the registry</h4>
+
#igem_logo {
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
+
        height: 13%;
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
+
        width: 13%;
 +
}
  
 +
#banner_pic {
 +
border-radius: 25px;
 +
        border-bottom-right-radius: 0;
 +
        border-bottom-left-radius: 0;
 +
        width: 74.5%;
 +
        margin: 10px;
 +
        margin-bottom: 0;
 +
}
  
−
<h4>What information do I need to start putting my parts on the Registry?</h4>
+
nav {
−
<p>The information needed to initially create a part on the Registry is:</p>
+
clear: both;
−
<ul>
+
text-align: center;
−
<li>Part Name</li>
+
        background: #3EDAAD;
−
<li>Part type</li>
+
        border-radius: 10px;
−
<li>Creator</li>
+
        min-width: 700px;
−
<li>Sequence</li>
+
}
−
<li>Short Description (60 characters on what the DNA does)</li>
+
 
−
<li>Long Description (Longer description of what the DNA does)</li>
+
nav ul {
−
<li>Design considerations</li>
+
margin: 0;
−
</ul>
+
display: inline;
 +
}
 +
 
 +
nav ul a li {
 +
list-style: none;
 +
display: inline-block;
 +
padding: 15px 15px;
 +
}
 +
 
 +
nav ul a {
 +
text-decoration: none;
 +
color: black;
 +
font-size: 1.1em;
 +
}
 +
 
 +
nav ul a:visited {
 +
text-decoration: none;
 +
color: black;
 +
}
 +
 
 +
nav ul a:hover {
 +
text-decoration: none;
 +
color: white;
 +
}
 +
 
 +
.content {
 +
clear: both;
 +
height: 100%;
 +
}
 +
 
 +
.col {
 +
float: left;
 +
width: 12%;
 +
margin: 0;
 +
}
 +
 
 +
#main_col {
 +
    background: white;
 +
    width: 74.5%;
 +
    margin: 0;
 +
    padding: 0;
 +
    max-width: 800px;
 +
    min-width: 600px;
 +
    margin: auto;
 +
}
 +
 
 +
#project h2 {
 +
font-size: 2em;
 +
padding: 10px;
 +
        margin: 10px;
 +
        color: #E02121;
 +
        text-align: center;
 +
}
 +
 
 +
#team h2 {
 +
font-size: 2em;
 +
color: white;
 +
padding-left: 20px;
 +
}
 +
 
 +
#project {
 +
background: white;
 +
text-align: left;
 +
font-size: 1.2em;
 +
border-style: ridge;
 +
        margin-top: 10%;
 +
}
 +
 
 +
#project figure {
 +
    text-align: center;
 +
}
 +
 
 +
#project p {
 +
        margin: 25px;
 +
}
 +
 
 +
#video {
 +
        padding-bottom: 25px;
 +
}
 +
 
 +
#main_col p {
 +
padding: 10px;
 +
}
 +
 
 +
.team_desc {
 +
border-style: outset;
 +
margin: 15px;
 +
font-size: 1.2em;
 +
}
 +
 
 +
.team_desc h3 {
 +
color: white;
 +
font-size: 1.6em;
 +
text-align: center;
 +
}
 +
 
 +
.team_desc img {
 +
float: left;
 +
background: yellow;
 +
padding: 5px;
 +
}
 +
.team_desc .right_img {
 +
float: right;
 +
background: red;
 +
padding: 5px;
 +
}
 +
 
 +
.team_desc p {
 +
padding: 10px;
 +
margin: 10px;
 +
background: green;
 +
text-align: center;
 +
}
 +
 
 +
#Africa div, #corkSynBio div{
 +
border-style: groove;
 +
padding: 15px;
 +
margin: 15px;
 +
}
 +
 
 +
#Africa img {
 +
float: left;
 +
border-style: double;
 +
border-color: #CC9900;
 +
margin: 10px;
 +
}
 +
 
 +
#Africa, #corkSynBio {
 +
text-align:center;
 +
color: white;
 +
}
 +
 
 +
#Africa p, #corkSynBio p {
 +
text-align: left;
 +
font-size: 1.2em;
 +
}
 +
 
 +
#notebook {
 +
font-size: 1.2em;
 +
}
 +
 
 +
#notebook h2 {
 +
text-align: center;
 +
color: yellow;
 +
}
 +
 
 +
#notebook h3 {
 +
text-align: center;
 +
color: #FF0000;
 +
padding-top: 15px;
 +
}
 +
 
 +
#notebook div p{
 +
padding-left: 15px;
 +
padding-right: 15px;
 +
}
 +
 
 +
#notebook div  img {
 +
display: block;
 +
margin-left: auto;
 +
margin-right: auto;
 +
margin-top: 10px;
 +
margin-bottom: 10px;
 +
border-style: double;
 +
border-color: #3399FF;
 +
}
 +
 
 +
#fixed_menu {
 +
position: fixed;
 +
right: 0;
 +
bottom: 0;
 +
width: 10%;
 +
}
 +
 
 +
#fixed_menu li, #fixed_menu2 li {
 +
list-style: none;
 +
border-style: solid;
 +
border-color: #444444;
 +
background: #3EDAAD;
 +
font-size: 0.6em;
 +
        border-radius: 5px;
 +
}
 +
 
 +
#fixed_menu a, #fixed_menu2 a{
 +
text-decoration: none;
 +
color: black;
 +
 
 +
}
 +
 
 +
#fixed_menu a:hover, #fixed_menu2 a:hover {
 +
color: white;
 +
}
 +
 
 +
#fixed_menu2 {
 +
position:fixed;
 +
right: -5%;
 +
bottom: 0;
 +
width: 10%;
 +
}
 +
 
 +
#notebook div {
 +
border-radius: 10px;
 +
background-color: white;
 +
margin: 15px;
 +
}
 +
 
 +
#interlab div {
 +
border-radius: 10px;
 +
background-color: #FFFF99;
 +
border-style: ridge;
 +
margin: 15px;
 +
}
 +
 
 +
#interlab div h2 {
 +
font-size: 1.5em;
 +
text-align: center;
 +
}
 +
 
 +
#interlab div h3 {
 +
margin-left: 15px;
 +
}
 +
 
 +
#interlab div p, #interlab div li {
 +
font-size: 1.2em;
 +
}
 +
 
 +
#interlab div  img {
 +
display: block;
 +
margin-left: auto;
 +
margin-right: auto;
 +
margin-top: 10px;
 +
margin-bottom: 10px;
 +
border-style: double;
 +
border-color: #FF3300;
 +
}
 +
 
 +
.question {
 +
padding-bottom: 5px;
 +
list-style: circle;
 +
}
 +
 
 +
.answer {
 +
padding-bottom: 15px;
 +
list-style: square;
 +
}
 +
 
 +
#interlab .result_pic {
 +
float: left;
 +
margin: 15px;
 +
text-align: center;
 +
}
 +
 
 +
#interlab figcaption {
 +
text-align: center;
 +
padding-bottom: 15px;
 +
}
 +
 
 +
#achieve h2 {
 +
text-align: center;
 +
}
 +
 
 +
#gold, #gold_dis {
 +
background: #FFD700;
 +
border-style: double;
 +
border-radius: 10px;
 +
margin: 10px;
 +
font-size: 1.2em;
 +
}
 +
 
 +
#silver, #silver_dis {
 +
background: #C0C0C0;
 +
border-style: solid;
 +
border-radius: 10px;
 +
margin: 10px;
 +
font-size: 1.2em;
 +
}
 +
 
 +
#bronze, #bronze_dis {
 +
background: #CD7F32;
 +
border-style: dotted;
 +
border-radius: 10px;
 +
margin: 10px;
 +
font-size: 1.2em;
 +
}
 +
 
 +
#parts h2 {
 +
      font-size: 1.8em;
 +
      text-align: center;
 +
      color: #E02121;
 +
}
 +
 
 +
#parts div {
 +
      padding-top: 5%;
 +
      padding-bottom: 20px;
 +
}
 +
 
 +
#parts p {
 +
      font-size: 1.2em;
 +
}
 +
 
 +
#parts figure {
 +
      text-align:center;
 +
}
 +
 
 +
.clearfix:after {
 +
    content: ".";
 +
    display: block;
 +
    height: 0;
 +
    clear: both;
 +
    visibility: hidden;
 +
}
 +
 
 +
.clearfix {display: inline-block;}
 +
 
 +
/* Hides from IE-mac \*/
 +
* html .clearfix {height: 1%;}
 +
.clearfix {display: block;}
 +
/* End hide from IE-mac */
 +
/* @end */
 +
 
 +
footer {
 +
clear: both;
 +
text-align: center;
 +
border-radius: 10px;
 +
}
 +
 
 +
footer ul {
 +
margin: 0;
 +
display: inline;
 +
text-align: center;
 +
}
 +
footer img {
 +
display: inline;
 +
}
 +
footer ul a li {
 +
list-style: none;
 +
display: inline-block;
 +
padding: 5px 15px;
 +
}
 +
 
 +
footer ul a {
 +
text-decoration: none;
 +
        color: #444444;
 +
}
 +
 
 +
footer ul a:visited {
 +
        color: #444444;
 +
}
 +
 
 +
footer ul a:hover {
 +
        text-decoration: none;
 +
        color: #E02121;
 +
}
 +
 
 +
</style>
 +
 
 +
<body>
 +
  <div id="globalWrapper">
 +
  <div id='top_menu_under' class='noprint'></div>
 +
  <div id='top_menu_14'    class='noprint'>Loading menubar.....</div> <!-- Will be replaced with the jQuery.load -->
 +
 
 +
<header>
 +
                <a href="https://www.igem.org/Main_Page">
 +
                <img src="https://static.igem.org/mediawiki/2014/d/d7/Sysuchina_igemdeLogo.png" id="igem_logo"/>
 +
                </a>
 +
<img src="https://static.igem.org/mediawiki/2015/a/a2/PartsCork.png" alt="Pacman Basehunter" id="banner_pic"/>
 +
<nav>
 +
<ul>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Notebook"><li>Notebook</li></a>
 +
                                <a href= "https://2015.igem.org/Team:Cork_Ireland/Parts"><li>Parts</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Collaborations"><li>Collaborations</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/InterlabStudy"><li>Interlab Study</li></a>
 +
                                <a href= "https://2015.igem.org/Team:Cork_Ireland/Attributions"><li>Attributions</li></a>
 +
                                <a href= "https://2015.igem.org/Team:Cork_Ireland/Achievements"<li>Achievements</li></a>
 +
</ul>
 +
</nav>
 +
</header>
 +
 +
<div id="content">
 +
<div class="col">
 +
<p></p>
 +
</div>
 +
<div id="main_col">
 +
<div id="parts">
 +
<div id="part1">
 +
<h2>55bp HPV Detector (K1698001)</h2>
 +
 
 +
 
 +
 
 +
                        <p>Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAA
 +
AAGCTtcagccattaggtgtgggcattagtggCACTGC</p>
 +
 
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/6/61/55bpDetectorCork.jpg" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
<p>
 +
Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.</p>
 +
 
 +
<p>For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.
 +
 
 +
The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length.
 +
 
 +
The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p>
 +
<p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.
 +
 
 +
<p>For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p>
 +
 
 +
<p>Assessment of this detector parts selectivity may also be seen here <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.
 +
</p>
 +
 
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
 
 +
</div>
 +
 +
<div id="part2">
 +
<h2>62bp SRY (K1698002) </h2>
 +
 
 +
 
 +
 
 +
                        <p>Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTT
 +
ATGGGTACCAATAATAAAAGCTTGTGGTCC
 +
CGTGGTGAGAGGCACAAGTTGGCACTGC</p>
 +
 
 +
<p>Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome.
 +
 
 +
Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.</p>
 +
 
 +
<p>For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.<p/>
 +
 
 +
<p>The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts</p>
 +
 
 +
<p>For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.
 +
</p>
 +
 
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/7/7f/32bpSRYCork.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
 
 +
</div>
 +
 
 +
 +
 
 +
<div id="part3">
 +
<h2>32bp SRY Detector (K1698003)</h2>
 +
 
 +
 
 +
 
 +
                        <p>Sequence: GCTCTTCAgttgcctcaacaaaactgGTACCAAT
 +
AATAAAAGCTtacaaccttctgcaCACTGC</p>
 +
 
 +
<p>
 +
Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome.
 +
 
 +
For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.
 +
 
 +
The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.</p>
  
 
<p>
 
<p>
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
 
  
 +
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.</p>
 +
 +
<p>
 +
For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>. </p>
 +
 +
</p>
 +
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/1/1e/32bpSRYCorkiGEM.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
 +
</div>
  
 +
<div id="part4">
 +
<h2>24bp TB Detector (K1698004)</h2>
  
  
  
 +
                        <p>Sequence: GCTCTTCTCAGCCTTCCCGgtacctaa
 +
ttcggatcCGCTGGCTACCCCACTGC</p>
  
−
<h4>Inspiration</h4>
+
<p>
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
+
Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome
  
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
+
For protocol for construction of detector by digestion of plasmid see <a href="https://static.igem.org/mediawiki/2015/8/88/ProtocolsCork.pdf">here</a>.
−
<ul>
+
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
+
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
+
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
+
−
</ul>
+
  
 +
The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.<p>
  
 +
For more information on how the detector plasmid worked see <a href="https://2015.igem.org/Team:Cork_Ireland/Project#standard">here</a>.
  
−
<h4>Part Table </h4>
+
</p>
−
</html>
+
−
<groupparts>iGEM015 Example</groupparts>
+
−
<html>
+
  
 +
                        <figure>
 +
                        <img src="https://static.igem.org/mediawiki/2015/9/98/55bdCorkDetector.JPG" alt="Description goes here"/>
 +
                        <figcaption>
 +
                        </figcaption>
 +
                        </figure>
 +
                        </div>
  
 +
</div>
 +
 +
<div class="col">
 +
<ul id="fixed_menu">
 +
<li>Quick Links:</li>
 +
<a href="#part1"><li>K1698001</li></a>
 +
<a href="#part2"><li>K1698002</li></a>
 +
                                <a href="#part3"><li>K1698003</li></a>
 +
                                <a href="#part4"><li>K1698004</li></a>
 +
</ul>
 +
</div>
 +
</div>
 +
 +
 +
<footer>
 +
<div>
 +
<ul>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland"><li>Home</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Project"><li>Our Project</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Design"><li>Design</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Practices"><li>Outreach</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Team"><li>Team</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Notebook"><li>Notebook</li></a>
 +
                                <a href= "https://2015.igem.org/Team:Cork_Ireland/Parts"><li>Parts</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/Collaborations"><li>Collaborations</li></a>
 +
<a href= "https://2015.igem.org/Team:Cork_Ireland/InterlabStudy"><li>Interlab Study</li></a>
 +
                                <a href= "https://2015.igem.org/Team:Cork_Ireland/Attributions"><li>Attributions</li></a>
 +
                                <a href= "https://2015.igem.org/Team:Cork_Ireland/Achievements"<li>Achievements</li></a>
 +
</ul>
 +
</div>
 +
 +
<div>
 +
<a href="http://www.lilly.ie/en/index.aspx" TARGET=_BLANK>
 +
<img src="https://static.igem.org/mediawiki/2015/archive/2/21/20150901113248%21Rsz_m_dc.jpg" alt="Sponsored by Lilly">
 +
</a>
 +
 +
<a href="https://www.igem.org/Main_Page">
 +
<img src="https://static.igem.org/mediawiki/2015/6/6b/IGEM-animated.gif" alt="iGEM Main Page">
 +
</a>
 +
 +
<a href="http://www.janssen.ie/" TARGET=_Blank>
 +
<img src="https://static.igem.org/mediawiki/2015/2/21/Rsz_m_dc.jpg" alt="Sponsored by Jansen">
 +
</a>
 +
 +
<p>Cork iGEM 2015</p>
 +
</div>
 +
</footer>
 +
</body>
  
−
</div>
+
</div> <div class="visualClear"></div>
 +
    </div>
 +
</div>
 +
    </div>
 +
</body>
 
</html>
 
</html>

Latest revision as of 15:28, 9 November 2015

Basehunter Home

Loading menubar.....

55bp HPV Detector (K1698001)

Sequence: CTCTTCAcctgtgtaggtgttgaggtaggtcgtggGTACCAATAATAA AAGCTtcagccattaggtgtgggcattagtggCACTGC

Description goes here

Part may be activated by established protocol to become a detector plasmid for a 55bp Target sequence, found on the HPV L1 Capsid gene.

For protocol for construction of detector by digestion of plasmid see here. The Target is located in the HPV genome flanked by HaeIII restriction sites. Detector may work best if genomic sample first digested with this enzyme to create target fragment of the correct length. The part was cloned into a plasmid containing BBa_K584001 to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see here.

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see here.

Assessment of this detector parts selectivity may also be seen here here.

Description goes here

62bp SRY (K1698002)

Sequence: GCTCTTCACCATGTCAAGCGCCCCATGAATGCATTT ATGGGTACCAATAATAAAAGCTTGTGGTCC CGTGGTGAGAGGCACAAGTTGGCACTGC

Part may be activated by established protocol to become a detector plasmid for a 62bp Target sequence, found on the SRY gene, located on the Y chromosome. Further optimisation of part is needed for use in distinguishing male and female genomic DNA. Part is accurate in detecting target when isolated from a genomic sample.

For protocol for construction of detector by digestion of plasmid see here.

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts

For more information on how the detector plasmid worked see here.

Description goes here

32bp SRY Detector (K1698003)

Sequence: GCTCTTCAgttgcctcaacaaaactgGTACCAAT AATAAAAGCTtacaaccttctgcaCACTGC

Part may be activated by established protocol to become a detector plasmid for a 32bp Target sequence, found on the SRY gene, located on the Y chromosome. For protocol for construction of detector by digestion of plasmid see here. The part was cloned into a plasmid containing BBa_K584001 (after biobrick prefix) to allow examination of cells following successful transformation using a fluorescent microscope. Also, presence of GFP expressing part meant that detector colonies could be differentiated from control colonies. For more information see here.

The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see here.

Description goes here

24bp TB Detector (K1698004)

Sequence: GCTCTTCTCAGCCTTCCCGgtacctaa ttcggatcCGCTGGCTACCCCACTGC

Part may be activated by established protocol to become a detector plasmid for a 24bp target sequence found on the Mycobacterium tuberculosis genome For protocol for construction of detector by digestion of plasmid see here. The sequence of this part with K584001 biobrick part may be found on the Registry of Standard Parts.

For more information on how the detector plasmid worked see here.

Description goes here