Difference between revisions of "Team:Paris Bettencourt/Notebook/VitaminB2"
| Line 13: | Line 13: | ||
<li>25 μL LifeTech MasterMix (2X) | <li>25 μL LifeTech MasterMix (2X) | ||
</ul> | </ul> | ||
| − | + | </br> | |
<b>RibA</b> + <b>o15.001</b> (GCGCCCGAAGACTTATGCAG) + <b>o15.002</b>(GGCCCCGCGCATATGAAG)</br> | <b>RibA</b> + <b>o15.001</b> (GCGCCCGAAGACTTATGCAG) + <b>o15.002</b>(GGCCCCGCGCATATGAAG)</br> | ||
<b>RibD</b> + <b>o15.003</b>(CGCTATAGAAGACTTGAGAAGATCTG) + <b>o15.004</b>(GCGCGGCACCACATATGAAG)</br> | <b>RibD</b> + <b>o15.003</b>(CGCTATAGAAGACTTGAGAAGATCTG) + <b>o15.004</b>(GCGCGGCACCACATATGAAG)</br> | ||
| Line 21: | Line 21: | ||
</br> | </br> | ||
For each PCR reaction, a negative control without matrix DNA was prepared.</br> | For each PCR reaction, a negative control without matrix DNA was prepared.</br> | ||
| + | </br> | ||
| + | <table style="width:100%"> | ||
| + | |||
| + | <tr> | ||
| + | <td><b>time (min)</b></td> | ||
| + | <td><b>temperature (°C)</b></td> | ||
| + | <td><b>function</b></td> | ||
| + | </tr> | ||
| + | |||
| + | <tr> | ||
| + | <td>3:00</td> | ||
| + | <td>98</td> | ||
| + | <td>melting</td> | ||
| + | </tr> | ||
| + | |||
| + | <tr> | ||
| + | <td>0:30</td> | ||
| + | <td>98</td> | ||
| + | <td>melting</td> | ||
| + | </tr> | ||
| + | |||
| + | <tr> | ||
| + | <td>0:30</td> | ||
| + | <td>52</td> | ||
| + | <td>annealing</td> | ||
| + | </tr> | ||
| + | |||
| + | <tr> | ||
| + | <td>1:00</td> | ||
| + | <td>72</td> | ||
| + | <td>extension</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td> </td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>10:00</td> | ||
| + | <td>72</td> | ||
| + | <td>extension</td> | ||
| + | </tr> | ||
| − | 30sec at 98°C</br> | + | <tr> |
| − | 12 cycles</br> | + | <td>forever</td> |
| − | + | <td>12</td> | |
| − | + | <td>storage</td> | |
| − | + | </tr> | |
| + | </table> | ||
| + | <li>30sec at 98°C</br> | ||
| + | </br>12 cycles</br> | ||
| + | <li> 10sec at 98°C</br> | ||
| + | <li> 30sec at 52°C</br> | ||
| + | <li> 1min at 72°C</br> | ||
</br> | </br> | ||
| − | 10min at 72°C</br> | + | <li>10min at 72°C</br> |
until opening at 12°C</br> | until opening at 12°C</br> | ||
</br> | </br> | ||
Revision as of 15:12, 10 August 2015
13/07
- Received gBlocks RibA, RibD, RibE, RibT25 and RibT48 and amplification oligos from IDT. Dilution in water and PCR amplification, using the following protocol:
- 1 μL gBlock (0.1 to 1ng)
- 1 μL forward primer (10 μM)
- 1 μL reverse primer (10 μM)
- 22 μL DNAse/RNAse free water
- 25 μL LifeTech MasterMix (2X)
- 30sec at 98°C 12 cycles
- 10sec at 98°C
- 30sec at 52°C
- 1min at 72°C
- 10min at 72°C until opening at 12°C
| time (min) | temperature (°C) | function |
| 3:00 | 98 | melting |
| 0:30 | 98 | melting |
| 0:30 | 52 | annealing |
| 1:00 | 72 | extension |
| 10:00 | 72 | extension |
| forever | 12 | storage |